CN114574505A

CN114574505A - Monooxygenase gene phzO, encoded protein, genetic engineering strain, construction method and application thereof

Info

Publication number: CN114574505A
Application number: CN202210265608.1A
Authority: CN
Inventors: 胡洪波; 岳圣杰; 张雪洪; 刘文慧
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2022-03-17
Filing date: 2022-03-17
Publication date: 2022-06-03
Anticipated expiration: 2042-03-17
Also published as: CN114574505B

Abstract

The invention provides a monooxygenase gene phzO, a coding protein, a genetic engineering strain, a construction method and application thereof. The coding sequence of the monooxygenase gene phzO is shown as SEQ ID NO.1, and the DNA sequence of the upstream non-coding region of the monooxygenase gene phzO is shown as SEQ ID NO. 2. The coded amino acid sequence is shown in SEQ ID NO. 3. According to the invention, the pseudomonas aeruginosa LX24 monooxygenase gene phzO gene and the upstream non-coding region thereof are replaced to the endogenous phzO site of pseudomonas aeruginosa GP72AN, so that the yield of 2-hydroxyphenyloxazine is increased by 17%, and the conversion rate is increased by 24%.

Description

Monooxygenase gene phzO, encoded protein, genetic engineering strain, construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a monooxygenase gene phzO, a coding protein, a genetic engineering strain, and a construction method and application thereof.

Background

The 2-hydroxyphenyloxazine has good effects of antagonizing wheat take-all pathogens, sclerotium pathogens and anthrax pathogens, and has good application prospects. In addition, 2-hydroxyphenyloxazine has been shown to be non-toxic to mammals, and the substance is biodegradable by environmental microorganisms in natural conditions for about two weeks, and is a safe and degradable active substance of microbial origin. At present, 2-hydroxyphenyloxazine can be synthesized by chemical and biological methods, but the chemical synthesis yield is low, expensive catalysts and high-temperature reaction conditions are needed, and toxic and harmful substances such as lead oxide, aniline, phenylenediamine and the like are generated, so that the production and application of the 2-hydroxyphenyloxazine are hindered. The process for synthesizing the 2-hydroxyphenyloxazine by the microbial fermentation method is safe and pollution-free, and is an environment-friendly and resource-saving synthesis scheme. However, the potency of the microbial synthesis of 2-hydroxyphenyloxazines is low, which is an important factor for the industrialization of 2-hydroxyphenyloxazines. The low potency of the microbial synthesis of 2-hydroxyphenyloxazine is mainly due to the low conversion efficiency of the key catalytic gene phzO.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a monooxygenase gene phzO, a coding protein, a genetic engineering strain, a construction method and application thereof.

The purpose of the invention is realized by the following scheme:

the first aspect of the invention provides a DNA sequence of a monooxygenase gene phzO and an upstream non-coding region thereof, wherein the coding sequence of the monooxygenase gene phzO is shown as SEQ ID NO.1, and the DNA sequence of the upstream non-coding region of the monooxygenase gene phzO is shown as SEQ ID NO. 2.

Further, the monooxygenase gene phzO is derived from Pseudomonas chlororaphis LX 24.

The second aspect of the present invention provides a protein encoded by the monooxygenase gene phzO of the first aspect, wherein the amino acid sequence of the protein is shown in SEQ ID NO. 3.

In a third aspect, the invention provides a genetically engineered strain carrying the DNA sequence of the monooxygenase gene phzO of the first aspect of the invention and its upstream non-coding region.

Furthermore, the genetic engineering strain is a strain ANOX obtained by replacing an endogenous phzO site capable of producing 2-hydroxyphenyloxazine in pseudomonas chlororaphis GP72AN with a DNA sequence of a monooxygenase gene phzO from pseudomonas chlororaphis LX24 and an upstream non-coding region thereof.

The fourth aspect of the present invention provides a method for constructing a genetically engineered strain according to the third aspect, comprising the steps of:

cloning a DNA sequence of a monooxygenase gene phzO and an upstream non-coding region thereof;

cloning an upstream and downstream homologous arm of a sequence to be replaced, which can produce 2-hydroxyphenyloxazine;

step 3, connecting the DNA sequence of the monooxygenase gene phzO and the upstream non-coding region thereof and the upstream and downstream homologous arms of the sequence to be replaced which can produce 2-hydroxyphenyloxazine to pK18mobsacB plasmid to construct recombinant plasmid, and transforming the recombinant plasmid into the competence of escherichia coli s17 after sequencing verification;

step 4, performing conjugal transfer on the S17-1 strain containing the pK18mobsacB recombinant plasmid and pseudomonas chlororaphis GP72ANON serving as a receptor strain;

step 5, screening mutant strains

Screening single-exchange mutant strains from strains grown after conjugation transfer by adopting a double-resistant plate, culturing the single-exchange mutant strains by using a single-resistant plate screen to screen double-exchange mutant strains, and then carrying out PCR verification on the screened double-exchange mutant strains by using a first primer pair; the sequences of the first primer pair are shown as follows,

the sequence of the upstream primer (F-O) is shown as SEQ ID NO: 4:

5′-TTACAGCCGTAGGGTACCGAGATA-3′

the sequence of the downstream primer (R-O) is shown as SEQ ID NO: 5:

5′-CTATTTGGCGTTGAGCCCCA-3′；

and 6, inoculating the genetic engineering strain with correct PCR verification into an LB liquid culture medium overnight, extracting genome, sequencing and verifying, wherein the correct gene is the genetic engineering strain of the strain into which the genes of the pseudomonas aeruginosa LX24 phzO and the non-coding region are successfully introduced.

Further, in the step 1, the genome extracted from pseudomonas aeruginosa LX24 is used as a template, PCR is performed using a first primer pair, and the DNA sequence of the monooxygenase gene phzO and the non-coding region thereof is recovered after amplification to obtain the desired length.

Further, in the step 2, taking the genome extracted from pseudomonas aeruginosa GP72AN as a template, performing PCR by using a second primer pair, and recovering after obtaining the expected length through amplification to obtain the upstream homology arm of the sequence to be replaced; taking a genome extracted by pseudomonas aeruginosa GP72AN as a template, carrying out PCR by using a third primer pair, and recovering after amplifying to obtain an expected length to obtain a downstream homology arm of a sequence to be replaced;

the sequences of the second primer pair are shown as follows:

the sequence of the upstream primer (F-1) is shown as SEQ ID NO: 6:

5′-CCGGGGATCCTCTAGACCATGAGCGTGCTGCACAAC-3′

the sequence of the downstream primer (R-1) is shown as SEQ ID NO: 7:

5′-TCGGTACCCTACGGCTGTAACCGGCGATGTTTCCAGCCTT-3′；

the sequences of the third primer pair are shown as follows:

the sequence of the upstream primer (F-2) is shown as SEQ ID NO: 8:

5-TGGGGCTCAACGCCAAATAGACCTGATTGCCGTGTAGGCG-3′

the sequence of the downstream primer (R-2) is shown as SEQ ID NO: 9:

5-GGCCAGTGCCAAGCTTCGTCCGTGGGGAGGAATGTA-3′。

the fifth aspect of the invention provides the use of the monooxygenase gene phzO and the DNA sequence of the upstream non-coding region thereof in the first aspect for improving the yield and the conversion rate of 2-hydroxyphenylazine, wherein the use is to replace the endogenous phzO site capable of producing 2-hydroxyphenylazine in Pseudomonas chlororaphis GP72AN with the monooxygenase gene phzO from Pseudomonas chlororaphis LX24 and the DNA sequence of the upstream non-coding region thereof to obtain a genetically engineered strain ANOX, and the yield and the conversion rate of the 2-hydroxyphenylazine produced by the strain ANOX are both improved.

Furthermore, compared with the yield of 2-hydroxyphenyloxazine in Pseudomonas chlororaphis GP72AN, the yield of the genetic engineering strain ANOX is improved by 17%, and the conversion rate is improved by 24%.

Compared with the prior art, the invention has the following beneficial effects:

(1) according to the invention, the pseudomonas chlororaphis LX24 monooxygenase gene phzO gene and the upstream non-coding region thereof are replaced to the homologous sequence of pseudomonas chlororaphis GP72AN, so that the yield of 2-hydroxyphenyloxazine is improved by 17%, and the conversion rate is improved by 24%.

(2) Aiming at the current situations of low yield and low conversion rate of 2-hydroxyphenyloxazine synthesized by microorganisms, the invention uses the pseudomonas chlororaphis LX24 monooxygenase gene phzO gene and the upstream non-coding region thereof to replace the homologous sequence of pseudomonas chlororaphis GP72AN, thereby providing guidance for improving the yield and the conversion rate of 2-hydroxyphenyloxazine by using a genetic engineering technology in the future and obtaining a microorganism strain with high yield, and having great application value.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 shows the sequencing verification of the successful introduction of phzO and its non-coding region gene;

FIG. 2 is a standard curve for determining phenazine compounds;

FIG. 3 shows the change in the content and conversion of 2-hydroxyphenyloxazine after introduction of phzO and its non-coding region in Pseudomonas chlororaphis LX24 into strain GP72AN (strain ANOX).

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will aid those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any manner. It should be noted that it would be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit of the invention. All falling within the scope of the present invention.

In the previous study results, the production of 2-hydroxyphenyloxazine by Pseudomonas chlororaphis LX24 was 158.6mg/L (J.Agric.food Chem.2021,69,16, 4778-.

For specific information on strain GP72AN and strain GP72ANON (the strain is phzO from which GP72AN is deleted) reference is made to Appl Microbiol Biotechnol (2011)89: 169-177.

The invention provides a DNA sequence of a phenazine-1-carboxylic acid efficient monooxygenase gene phzO and an upstream non-coding region thereof and an amino acid sequence coded by the DNA sequence. The phzO gene and the upstream non-coding region gene sequence thereof replace the homologous sequence of the 2-hydroxyphenyloxazine strain which can be produced by the pseudomonas chlororaphis, so that the conversion rate of the 2-hydroxyphenyloxazine can be improved, and the yield of the 2-hydroxyphenyloxazine is improved.

The phenazine-1-carboxylic acid efficient monooxygenase gene phzO full-length CDS open reading frame sequence is 1476bp, and the detailed sequence is shown in SEQ ID NO. 1. The DNA sequence of the upstream non-coding region of the gene is shown in SEQ ID NO. 2. The amino acid sequence of the monooxygenase is deduced according to the CDS open reading frame sequence, which has 491 amino acid residues in total, and the detailed sequence is shown in a sequence shown in SEQ ID NO. 3.

The sequence of the monooxygenase gene phzO is shown as SEQ ID NO. 1:

atgctagatcttcaaaacaagcgtaaatatctgaaaagtgcagaatccttcaaagcttcactgcgtgatgaccgcactgttatttatcaaggccaagttgttgaggatgtgactacacacttctctacggctggaggcatatcgcaagttgcagaaatctacgaagaacaattcagcggtgaacacgacgacattctgacttacgtacgccccgacggttacctggcctcttctgcctatatgccccctagaaacaaagaagacttggcgtcgcgacgccgcgcaatcacgtacgtctcgcaaaaaacctggggcacccactgccgtaacctggacatgatcgccagcttcaccgtcggcatgatgggatatcggccgacattcaggaaaaaatgccctgagtacgcagaaaacattaccgaataccatgactacgccgagcgcaacagcctgtatttgtctgaggccattgttgatccacagggctatcgggcacgtacccacggcaccgacctcaacctgccgccgcccgatcgtgccgtgatgaggatcaacaagcagaacgccgagggcatctggatcagcggcgtcaaaggcgtgggcacggtagcaccgcagtccaatgaaatatttgttggcagcttgttccccgcagcgcccaacgagtcattctgggcttacgtccctgccgatgcgccgggggtgaagattttttgccgagagattgtctcccagcctcacgccagcgcctatgaccacccgctcatatccaaaggtgaagaagccgaggcgatggtggtattcgataacgtgttcattccacgctggcgaatcatggcggcgaacgtgccggaactggccaacgccggcttcttcagcctgtggacctcatacagccattggtacacgctcgtgcgcctggaaaccaaggctgacctgtatgccggactggccaaggtgatcatggaagtcctgggccttgaggggattccggtggttcgccagcgggtcagcgaaatagtgcagcttgcggaaatactcaaaggcatgtgcatcgcctccatcgaaacggccgagatgtccgaaggcgacatattgctgcctggccccaacgcactggccgccggaagggtttttgccatggagaaattgcctcgggtgctgcatttgctcagagagctgtgcggacagggcttgatcctcaggttcaacgagaaagacttggccaccgacgccgcctttggccagaagttctcctggtttcttgacacgcaaagcgtgggcgccagagagaagaacctgctgatgaatctggtgtgggacgtggctgccagtgagcactccacacgtgcattggtgtttgaagaacagcacgcactcagcgagcccctgctgcgcgataacctggtgctggactacgactatcgcgaaagcacaagcctgatacgccgcatggtggggctcaacgccaaatag

the DNA sequence of the upstream non-coding region of the phzO gene is shown in SEQ ID NO. 2:

ggtaccgagataaatatgctttgaagtgctggctgctccaacttcgaactcattgcgcgaacttcaacacttatgacacccggtcaacatgagaagagtccagatgcgaaagaacgcgtattcgaaataccaaacagagagtccggatcaccaaagtgtgtaacgacattaattcctatctgaatcttatagttgctctagaacgttgtccttgacccagcgatagacatcgggccaaagactacacaaacaaagttagacattactgaggctgctacc

the amino acid sequence of the protein coded by the monooxygenase phzO is shown in SEQ ID NO. 3:

MLDLQNKRKYLKSAESFKASLRDDRTVIYQGQVVEDVTTHFSTAGGISQVAEIYEEQFSGEHDDILTYVRPDGYLASSAYMPPRNKEDLASRRRAITYVSQKTWGTHCRNLDMIASFTVGMMGYRPTFRKKCPEYAENITEYHDYAERNSLYLSEAIVDPQGYRARTHGTDLNLPPPDRAVMRINKQNAEGIWISGVKGVGTVAPQSNEIFVGSLFPAAPNESFWAYVPADAPGVKIFCREIVSQPHASAYDHPLISKGEEAEAMVVFDNVFIPRWRIMAANVPELANAGFFSLWTSYSHWYTLVRLETKADLYAGLAKVIMEVLGLEGIPVVRQRVSEIVQLAEILKGMCIASIETAEMSEGDILLPGPNALAAGRVFAMEKLPRVLHLLRELCGQGLILRFNEKDLATDAAFGQKFSWFLDTQSVGAREKNLLMNLVWDVAASEHSTRALVFEEQHALSEPLLRDNLVLDYDYRESTSLIRRMVGLNAK

the technical solution of the present invention will be further described in detail with reference to the following specific embodiments.

(1) Cultivation of the Strain

The DNA sequence of the monooxygenase gene phzO to be cloned in the experiment and the upstream non-coding region comes from Pseudomonas chlororaphis LX24, and the strain to be replaced is Pseudomonas chlororaphis GP72 AN. Pseudomonas chlororaphis LX24 and GP72AN were removed from a refrigerator stored at-80 ℃ and activated once (28 ℃ C., 14h) on LB (LB medium, 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride) plates, and one single colony on the plate was picked up and cultured overnight in 5mL of LB liquid medium. The centrifuged cells were used to extract genomic DNA.

(2) Genomic DNA extraction

Genomic DNA of Pseudomonas chlororaphis LX24 and GP72AN was extracted using a bacterial genomic DNA extraction kit (DP302) (kit from Tiangen Biochemical technology Co., Ltd.).

(3) DNA sequence cloning of monooxygenase gene phzO and its upstream non-coding region

Using genome extracted from Pseudomonas chlororaphis LX24 as template, and using first primer

F-O(SEQ ID NO.4)：5′-ttacagccgtagggtaccgagata-3′

R-O(SEQ ID NO.5)：5′-ctatttggcgttgagcccca-3′

Carrying out PCR, wherein the PCR reaction system is as follows: 2 × PrimeSTAR Max Premix, 25.0 μ L; F-O, 2.0 μ L; R-O, 2.0 μ L; LX24 genomic solution, 0.5 μ L; ddH₂O, 20.5. mu.L. The PCR amplification program is 98 ℃ for 1 minute; 20 seconds at 98 ℃; 60 ℃ for 10 seconds; 72 ℃, 60 seconds (30 cycles of amplification); 72 ℃ for 10 minutes. After the expected length is obtained by amplification, the DNA sequence of the monooxygenase gene phzO and the non-coding region thereof is obtained by recovery.

(4) Cloning of homology arms of sequences to be replaced

Genome extracted from Pseudomonas chlororaphis GP72AN is taken as a template, and a primer is utilized

F-1(SEQ ID NO.6)：5′-ccggggatcctctagaccatgagcgtgctgcacaac-3′

R-1(SEQ ID NO.7)：5′-tcggtaccctacggctgtaaccggcgatgtttccagcctt-3′

Carrying out PCR, wherein the PCR reaction system is as follows: 2 × PrimeSTAR Max Premix, 25.0 μ L; f-1, 2.0 μ L; r-1, 2.0 μ L; GP72AN genomic solution, 0.5 μ L; ddH₂O, 20.5. mu.L. The PCR amplification program is 98 ℃ for 1 minute; 20 seconds at 98 ℃; at 58 ℃ for 10 seconds; 72 ℃, 20 seconds (30 cycles of amplification); 72 ℃ for 10 minutes. And recovering after the amplification is carried out to obtain the upstream homology arm of the sequence to be replaced.

F-2(SEQ ID NO.8)：5-tggggctcaacgccaaatagacctgattgccgtgtaggcg-3′

R-2(SEQ ID NO.9)：5-ggccagtgccaagcttcgtccgtggggaggaatgta-3′

Carrying out PCR, wherein the PCR reaction system is as follows: 2 × PrimeSTAR Max Premix, 25.0 μ L; f-2, 2.0 μ L; r-2, 2.0 mu L; GP72AN genomic solution, 0.5 μ L; ddH₂O, 20.5. mu.L. The PCR amplification program is 98 ℃ for 1 minute; 20 seconds at 98 ℃; at 58 ℃ for 10 seconds; 72 ℃, 20 seconds (30 cycles of amplification); 72 ℃ for 10 minutes. And recovering after the amplification is carried out to obtain the downstream homology arm of the sequence to be replaced.

(5) Construction and verification of replacement plasmid (phzO and its upstream non-coding region DNA and Pseudomonas chlororaphis GP72AN upstream and downstream homology arms are integrated into recombinant plasmid)

The PCR product of the obtained pseudomonas chlororaphis LX24 monooxygenase gene phzO and the DNA of the upstream non-coding region thereof is connected with the upstream and downstream homology arms of pseudomonas chlororaphis GP72AN on a pK18mobsacB plasmid. The pK18mobsacB plasmid enzyme cutting system is as follows: pK18mobsacB plasmid 41. mu.L, 10 XCutsmart Buffer, 5. mu.L; XbaI, 2 ul; HindIII, 2. mu.L. The connecting system is as follows: pK18mobsacB restriction enzyme product, 2. mu.L; upstream homology arm, 2 μ L; downstream homology arm, 2 μ L; 2 mu L of DNA sequence of the single oxygenase gene phzO and the upstream non-coding region; infusion ligase, 2. mu.L.

The ligation product is transformed into Escherichia coli DH5 alpha, colony PCR is carried out by using primers F1 and R2 to screen positive clones with amplified bands, and a PCR reaction system is as follows: 2 × taq mix, 12.5 μ L; f-1, 1.0 μ L; r-2, 1.0 μ L; ddH2O, 10.5. mu.L. PCR amplification program is 94 ℃,5 minutes; 20 sec at 98 ℃, 58 ℃, 10 sec, 72 ℃, 120 sec (30 cycles of amplification); 72 ℃ for 10 minutes. The PCR product was sent to Shanghai Senno Biotech Co., Ltd for sequencing. It was then transformed into the prepared calcium-competent E.coli s17 (prepared using conventional calcium-competent preparation methods).

(6) And (4) jointing and transferring.

The S17-1 strain containing pK18mobsacB recombinant plasmid verified by PCR, namely a donor strain, is subjected to conjugal transfer with Pseudomonas chlororaphis GP72ANON (the strain is PhzO with GP72AN knockout endogenous) serving as a recipient strain. The method comprises the following specific steps: the S17-1 strain containing pK18mobsacB recombinant plasmid, i.e., donor strain and GP72ANON as recipient strain were activated in LB solid medium for 24h, and single clones were selected and inoculated in 5mL LB medium (50 mg/L kanamycin was added to the culture strain S17-1), S17-1 was cultured at 37 ℃ and 180rpm overnight, and GP72 was cultured at 28 ℃ and 180rpm overnight, respectively. 1-2mL of the bacterial solution was taken, centrifuged at 5000rpm for 5min, the supernatant was discarded and the cells were washed three times with 1mL of LB medium without antibiotics. Two kinds of bacterial liquids were mixed at a bacterial ratio of S17-1: GP72 was mixed at a ratio of about 1: 3. The mixed bacterial suspension is centrifuged at 5000rpm for 5min, the supernatant is discarded and resuspended in 200. mu.L LB medium, spread on solid LB medium without antibiotics, and cultured at 28 ℃ for 36h to allow conjugation transfer.

(7) Single crossover mutants (integration of the recombinant plasmid into the chromosome) were selected. The strain grown after the conjugative transfer was spread on a solid LB plate containing both 50mg/L kanamycin and 100mg/L ampicillin, and allowed to stand at 28 ℃ for 2 to 4 days until a single colony was grown.

(8) Double crossover mutants were selected (LX 24 monooxygenase gene phzO integrated with its upstream non-coding region DNA into P.chlororaphis GP72 ANON).

The single colonies on the double antibody plates were picked up and dissolved in 1ml of liquid LB, diluted in a gradient and spread onto LB solid plates containing 15% sucrose. Selecting a sucrose plate with 15 percent of proper number of grown monoclonals, picking the monoclonals by using a sterilized toothpick, correspondingly pointing on an LB (Luria Lou) antibiotic-free solid plate and an LB (Kan) solid plate, picking single colonies which cannot grow on the LB (Kan) solid plate but on the LB antibiotic-free solid plate, verifying by using a primer PCR, and adopting a PCR reaction system as follows: 2 × taq mix, 12.5 μ L; f-1, 1.0 μ L; r-2, 1.0 μ L; ddH2O, 10.5. mu.L. PCR amplification program is 94 ℃,5 minutes; 20 seconds at 98 ℃; at 58 ℃ for 10 seconds; 72 ℃, 120 seconds (30 cycles of amplification); 72 ℃ for 10 minutes.

(9) And successfully introducing the pseudomonas chlororaphis LX24 phzO and a strain verification of a non-coding region gene thereof.

The correct strain was inoculated into LB liquid medium overnight for PCR verification, and the genome sequencing was verified. The verification results are shown in FIG. 1, and the results show that phzO and the non-coding region gene thereof are successfully introduced, and the strain is named as ANOX.

(10) Fermentation experiments of strain ANOX.

Strain GP72AN and strain ANOX were removed from storage in a refrigerator at-80 ℃ in KB (King's B medium, 20g/L tryptone, 18.92g/L glycerol, 0.514g/LK₂HPO₄And 0.732g/LMgSO₄) The plates were activated twice (28 ℃, 14h), and a single colony on the plate was picked and activated in 5mL KB liquid medium as seed broth, followed by fermentation in liquid KB medium at 28 ℃ for 72h in 250mL triple baffled Erlenmeyer flasks (28 ℃, 200rpm) filled with 60mLKB liquid medium.

(11) Determination of 2-Hydroxyphenazine

(a) And (4) processing a sample. Taking 400 mu L of bacterial liquid, adding 10 mu L of hydrochloric acid to acidify until the pH value is less than or equal to 2.0, adding 3.6mL of ethyl acetate, oscillating for 5min, centrifuging, taking 400 mu L of supernatant, placing the supernatant in a fume hood overnight, dissolving a sample with 1 mLHPLC-grade acetonitrile the next day, filtering with a 0.22 mu m filter membrane, placing the obtained sample in a refrigerator for refrigeration at 4 ℃, and using the sample for HPLC (high performance liquid chromatography) to detect the content of 2-hydroxyphenyloxazine.

(b) And (5) HPLC detection. The column was a reverse C18 column (Agilent Technologies,5 μm,4.6 x 250 mm); the mobile phase is methanol: 5mM ammonium acetate solution ═ 1: 1; the elution conditions were: methanol at 0-5 min: 5mM NH₄Ac 20: 80(v/v), methanol at 5-25 min: 5mM NH₄Ac is 50: methanol at 50, 25-30 min: 5mM NH₄Ac-20: 80. the flow rate was 1ml/min, the detection wavelength was 252nm, and the column temperature was 30 ℃. The retention times of the three samples of PCA, 2-OH-PCA and 2-OH-PHZ in the chromatographic column were 9.1min, 13.3min and 21.7min, respectively. A standard curve (fig. 2) was prepared for the determination of phenazine compounds using PCA standards from shanghai agrel, with sample concentrations proportional to the peak areas detected by HPLC.

(c) As shown in FIG. 3, after phzO and its upstream non-coding region in strain GP72AN were replaced with the corresponding sequence LX24, the yield of 2-hydroxyphenyloxazine was increased from 212.8mg/L to 249.41mg/L, and the conversion rate was increased from 19.4% to 24.0%, thereby achieving the improvement of the yield and the conversion rate of 2-hydroxyphenyloxazine.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention. The embodiments and features of the embodiments of the present application may be combined with each other arbitrarily without conflict.

Sequence listing

<110> Shanghai university of transportation

<120> monooxygenase gene phzO, encoded protein, genetic engineering strain, construction method and application thereof

<130> KAG48260

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> Pseudomonas chlororaphisLX24 (Pseudomonas chlororaphisLX24)

<400> 1

atgctagatc ttcaaaacaa gcgtaaatat ctgaaaagtg cagaatcctt caaagcttca 60

ctgcgtgatg accgcactgt tatttatcaa ggccaagttg ttgaggatgt gactacacac 120

ttctctacgg ctggaggcat atcgcaagtt gcagaaatct acgaagaaca attcagcggt 180

gaacacgacg acattctgac ttacgtacgc cccgacggtt acctggcctc ttctgcctat 240

atgcccccta gaaacaaaga agacttggcg tcgcgacgcc gcgcaatcac gtacgtctcg 300

caaaaaacct ggggcaccca ctgccgtaac ctggacatga tcgccagctt caccgtcggc 360

atgatgggat atcggccgac attcaggaaa aaatgccctg agtacgcaga aaacattacc 420

gaataccatg actacgccga gcgcaacagc ctgtatttgt ctgaggccat tgttgatcca 480

cagggctatc gggcacgtac ccacggcacc gacctcaacc tgccgccgcc cgatcgtgcc 540

gtgatgagga tcaacaagca gaacgccgag ggcatctgga tcagcggcgt caaaggcgtg 600

ggcacggtag caccgcagtc caatgaaata tttgttggca gcttgttccc cgcagcgccc 660

aacgagtcat tctgggctta cgtccctgcc gatgcgccgg gggtgaagat tttttgccga 720

gagattgtct cccagcctca cgccagcgcc tatgaccacc cgctcatatc caaaggtgaa 780

gaagccgagg cgatggtggt attcgataac gtgttcattc cacgctggcg aatcatggcg 840

gcgaacgtgc cggaactggc caacgccggc ttcttcagcc tgtggacctc atacagccat 900

tggtacacgc tcgtgcgcct ggaaaccaag gctgacctgt atgccggact ggccaaggtg 960

atcatggaag tcctgggcct tgaggggatt ccggtggttc gccagcgggt cagcgaaata 1020

gtgcagcttg cggaaatact caaaggcatg tgcatcgcct ccatcgaaac ggccgagatg 1080

tccgaaggcg acatattgct gcctggcccc aacgcactgg ccgccggaag ggtttttgcc 1140

atggagaaat tgcctcgggt gctgcatttg ctcagagagc tgtgcggaca gggcttgatc 1200

ctcaggttca acgagaaaga cttggccacc gacgccgcct ttggccagaa gttctcctgg 1260

tttcttgaca cgcaaagcgt gggcgccaga gagaagaacc tgctgatgaa tctggtgtgg 1320

gacgtggctg ccagtgagca ctccacacgt gcattggtgt ttgaagaaca gcacgcactc 1380

agcgagcccc tgctgcgcga taacctggtg ctggactacg actatcgcga aagcacaagc 1440

ctgatacgcc gcatggtggg gctcaacgcc aaatag 1476

<210> 2

<211> 279

<212> DNA

<213> Pseudomonas chlororaphisLX24 (Pseudomonas chlororaphisLX24)

<400> 2

ggtaccgaga taaatatgct ttgaagtgct ggctgctcca acttcgaact cattgcgcga 60

acttcaacac ttatgacacc cggtcaacat gagaagagtc cagatgcgaa agaacgcgta 120

ttcgaaatac caaacagaga gtccggatca ccaaagtgtg taacgacatt aattcctatc 180

tgaatcttat agttgctcta gaacgttgtc cttgacccag cgatagacat cgggccaaag 240

actacacaaa caaagttaga cattactgag gctgctacc 279

<210> 3

<211> 491

<212> PRT

<213> Pseudomonas chlororaphis LX24(Pseudomonas chlororaphis LX24)

<400> 3

Met Leu Asp Leu Gln Asn Lys Arg Lys Tyr Leu Lys Ser Ala Glu Ser

1 5 10 15

Phe Lys Ala Ser Leu Arg Asp Asp Arg Thr Val Ile Tyr Gln Gly Gln

20 25 30

Val Val Glu Asp Val Thr Thr His Phe Ser Thr Ala Gly Gly Ile Ser

35 40 45

Gln Val Ala Glu Ile Tyr Glu Glu Gln Phe Ser Gly Glu His Asp Asp

50 55 60

Ile Leu Thr Tyr Val Arg Pro Asp Gly Tyr Leu Ala Ser Ser Ala Tyr

65 70 75 80

Met Pro Pro Arg Asn Lys Glu Asp Leu Ala Ser Arg Arg Arg Ala Ile

85 90 95

Thr Tyr Val Ser Gln Lys Thr Trp Gly Thr His Cys Arg Asn Leu Asp

100 105 110

Met Ile Ala Ser Phe Thr Val Gly Met Met Gly Tyr Arg Pro Thr Phe

115 120 125

Arg Lys Lys Cys Pro Glu Tyr Ala Glu Asn Ile Thr Glu Tyr His Asp

130 135 140

Tyr Ala Glu Arg Asn Ser Leu Tyr Leu Ser Glu Ala Ile Val Asp Pro

145 150 155 160

Gln Gly Tyr Arg Ala Arg Thr His Gly Thr Asp Leu Asn Leu Pro Pro

165 170 175

Pro Asp Arg Ala Val Met Arg Ile Asn Lys Gln Asn Ala Glu Gly Ile

180 185 190

Trp Ile Ser Gly Val Lys Gly Val Gly Thr Val Ala Pro Gln Ser Asn

195 200 205

Glu Ile Phe Val Gly Ser Leu Phe Pro Ala Ala Pro Asn Glu Ser Phe

210 215 220

Trp Ala Tyr Val Pro Ala Asp Ala Pro Gly Val Lys Ile Phe Cys Arg

225 230 235 240

Glu Ile Val Ser Gln Pro His Ala Ser Ala Tyr Asp His Pro Leu Ile

245 250 255

Ser Lys Gly Glu Glu Ala Glu Ala Met Val Val Phe Asp Asn Val Phe

260 265 270

Ile Pro Arg Trp Arg Ile Met Ala Ala Asn Val Pro Glu Leu Ala Asn

275 280 285

Ala Gly Phe Phe Ser Leu Trp Thr Ser Tyr Ser His Trp Tyr Thr Leu

290 295 300

Val Arg Leu Glu Thr Lys Ala Asp Leu Tyr Ala Gly Leu Ala Lys Val

305 310 315 320

Ile Met Glu Val Leu Gly Leu Glu Gly Ile Pro Val Val Arg Gln Arg

325 330 335

Val Ser Glu Ile Val Gln Leu Ala Glu Ile Leu Lys Gly Met Cys Ile

340 345 350

Ala Ser Ile Glu Thr Ala Glu Met Ser Glu Gly Asp Ile Leu Leu Pro

355 360 365

Gly Pro Asn Ala Leu Ala Ala Gly Arg Val Phe Ala Met Glu Lys Leu

370 375 380

Pro Arg Val Leu His Leu Leu Arg Glu Leu Cys Gly Gln Gly Leu Ile

385 390 395 400

Leu Arg Phe Asn Glu Lys Asp Leu Ala Thr Asp Ala Ala Phe Gly Gln

405 410 415

Lys Phe Ser Trp Phe Leu Asp Thr Gln Ser Val Gly Ala Arg Glu Lys

420 425 430

Asn Leu Leu Met Asn Leu Val Trp Asp Val Ala Ala Ser Glu His Ser

435 440 445

Thr Arg Ala Leu Val Phe Glu Glu Gln His Ala Leu Ser Glu Pro Leu

450 455 460

Leu Arg Asp Asn Leu Val Leu Asp Tyr Asp Tyr Arg Glu Ser Thr Ser

465 470 475 480

Leu Ile Arg Arg Met Val Gly Leu Asn Ala Lys

485 490

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttacagccgt agggtaccga gata 24

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctatttggcg ttgagcccca 20

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccggggatcc tctagaccat gagcgtgctg cacaac 36

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcggtaccct acggctgtaa ccggcgatgt ttccagcctt 40

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tggggctcaa cgccaaatag acctgattgc cgtgtaggcg 40

<210> 9

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggccagtgcc aagcttcgtc cgtggggagg aatgta 36

Claims

1. A DNA sequence of a monooxygenase gene phzO and an upstream non-coding region thereof is characterized in that a coding sequence of the monooxygenase gene phzO is shown as SEQ ID NO.1, and a DNA sequence of the upstream non-coding region of the monooxygenase gene phzO is shown as SEQ ID NO. 2.

2. The DNA sequence of the monooxygenase gene phzO and its upstream non-coding region of claim 1, wherein said monooxygenase gene phzO is from Pseudomonas chlororaphis LX 24.

3. The protein coded by the monooxygenase gene phzO is characterized in that the coding sequence of the monooxygenase gene phzO is shown as SEQ ID NO.1, and the amino acid sequence of the protein is shown as SEQ ID NO. 3.

4. A genetically engineered strain carrying the monooxygenase gene phzO of claim 1 and its upstream non-coding region DNA sequences.

5. The genetically engineered strain of claim 4, wherein the genetically engineered strain is strain ANOX obtained by replacing an endogenous phzO site capable of producing 2-hydroxyphenyloxazine in Pseudomonas chlororaphis GP72AN with a DNA sequence derived from the monooxygenase gene phzO of Pseudomonas chlororaphis LX24 and an upstream non-coding region thereof.

6. A method for constructing the genetically engineered strain of claim 5, comprising the steps of:

step 5, screening mutant strains

F-O：5′-TTACAGCCGTAGGGTACCGAGATA-3′

R-O：5′-CTATTTGGCGTTGAGCCCCA-3′；

and 6, inoculating the genetic engineering strain verified to be correct by the PCR into an LB liquid culture medium for overnight, extracting genome, sequencing and verifying, wherein the verified strain is the genetic engineering strain of the strain into which the pseudomonas chlororaphis LX24 phzO and the non-coding region gene thereof are successfully introduced.

7. The method for constructing a genetically engineered strain according to claim 6, wherein in step 1, the genome extracted from Pseudomonas chlororaphis LX24 is used as a template, PCR is performed by using a first primer pair, and a DNA sequence of the monooxygenase gene phzO and the non-coding region thereof is obtained by recovering after amplification to a desired length.

8. The method for constructing the genetic engineering strain according to claim 6, wherein in the step 2, the genome extracted from Pseudomonas chlororaphis GP72AN is used as a template, PCR is carried out by using a second primer pair, and an upstream homology arm of a sequence to be replaced is obtained by recovering after an expected length is obtained by amplification; taking a genome extracted by pseudomonas aeruginosa GP72AN as a template, carrying out PCR by using a third primer pair, and recovering after amplifying to obtain an expected length to obtain a downstream homology arm of a sequence to be replaced;

the sequences of the second primer pair are shown as follows:

F-1：5′-CCGGGGATCCTCTAGACCATGAGCGTGCTGCACAAC-3′

R-1：5′-TCGGTACCCTACGGCTGTAACCGGCGATGTTTCCAGCCTT-3′；

the sequences of the third primer pair are shown as follows:

F-2：5-TGGGGCTCAACGCCAAATAGACCTGATTGCCGTGTAGGCG-3′

R-2：5-GGCCAGTGCCAAGCTTCGTCCGTGGGGAGGAATGTA-3′。

9. use of the DNA sequence of the monooxygenase gene phzO and its upstream non-coding region according to claim 1 for increasing the production and conversion of 2-hydroxyphenyloxazine, wherein the use is characterized in that the DNA sequence of the monooxygenase gene phzO and its upstream non-coding region from Pseudomonas chlororaphis LX24 is used to replace the endogenous phzO site of Pseudomonas chlororaphis GP72AN, which is capable of producing 2-hydroxyphenyloxazine, to obtain the genetically engineered strain ANOX, which is capable of increasing the production and conversion of 2-hydroxyphenyloxazine.

10. The use of the monooxygenase gene phzO and its upstream DNA sequence from noncoding regions for increasing the production and conversion of 2-hydroxyphenyloxazine as claimed in claim 9, wherein the genetic engineering strain ANOX is increased by 17% and the conversion by 24% compared with the 2-hydroxyphenyloxazine production in Pseudomonas chlororaphis GP72 AN.