CN114569731B - Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products - Google Patents

Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products Download PDF

Info

Publication number
CN114569731B
CN114569731B CN202210198408.9A CN202210198408A CN114569731B CN 114569731 B CN114569731 B CN 114569731B CN 202210198408 A CN202210198408 A CN 202210198408A CN 114569731 B CN114569731 B CN 114569731B
Authority
CN
China
Prior art keywords
msn
drug
molecular beacon
carrier
dox
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210198408.9A
Other languages
Chinese (zh)
Other versions
CN114569731A (en
Inventor
姜玮
张楠
丁胜勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210198408.9A priority Critical patent/CN114569731B/en
Publication of CN114569731A publication Critical patent/CN114569731A/en
Application granted granted Critical
Publication of CN114569731B publication Critical patent/CN114569731B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02—Inorganic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/0019—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules
    • A61K49/0021—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules the fluorescent group being a small organic molecule
    • A61K49/0041—Xanthene dyes, used in vivo, e.g. administered to a mice, e.g. rhodamines, rose Bengal
    • A61K49/0043—Fluorescein, used in vivo
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
    • A61K49/0052—Small organic molecules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention relates to a molecular beacon modified nano-carrier and application thereof in preparing an anti-tumor product. The molecular beacon in the nano-carrier can be used for silencing, imaging and drug delivery of MDR1mRNA in drug-resistant cancer cells, so as to realize drug-resistant cell targeting and inhibit drug excretion; in addition, hybridization of the molecular beacon in the nano-carrier with MDR1mRNA can realize in-situ imaging of MDR1mRNA; and detachment of the molecular beacon may cause drug release inside the nanocarrier. The nano-carrier has important application prospect in imaging and drug delivery of drug-resistant tumor cells, can obviously inhibit drug resistance of the tumor cells, and enhances the delivery efficiency of chemotherapeutic drugs and the drug-resistant tumor inhibition effect.

Description

Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products
Technical Field
The invention belongs to the technical field of anti-tumor nano preparations, and particularly relates to a molecular beacon modified nano carrier and application thereof in preparation of anti-tumor products.
Background
The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.
In chemotherapy, the key to ensuring the effectiveness of chemotherapy is to maintain an effective concentration of chemotherapeutic agents within the cancer cells. Maintaining intracellular drug concentrations is generally limited by two key factors. One is the drug delivery efficiency, which is affected by the water solubility, stability, non-specific delivery and osmotic efficiency of part of the chemotherapeutic drug, inevitably resulting in insufficient drug concentration in cancer cells; another is drug resistance following chemotherapy, which is typically caused by a decrease in intracellular drug accumulation caused by over-expressed ABC transporter proteins, particularly P-glycoprotein (P-gp) encoded by MDR1 mRNA in resistant cancer cells, which has a drug pumping effect. Due to the effects of these two factors, the drug concentration within drug-resistant cancer cells is insufficient to reach the lethal threshold, ultimately leading to limited therapeutic efficacy. Thus, there is an urgent need to develop novel drug delivery systems for effective drug delivery and overcoming drug resistance to ensure effective therapeutic intracellular drug concentrations.
Rapid development of nanomaterials has created opportunities to utilize innovative drug delivery systems to bypass delivery barriers. Mesoporous silicon nanoparticles (Mesoporous silica nanoparticle, MSN) are a porous nanomaterial that has attracted increasing attention in biomedical applications. Owing to the inherent characteristics of large pore volume, adjustable pore diameter, easy surface modification, high cell uptake efficiency, high biocompatibility and the like, MSN has great advantages in preparing nano-carriers with high drug loading capacity and delivery efficiency. Currently, a variety of MSN-based nanocarriers have been reported, for example, the Andre e.nel group has developed a lipid-coated mesoporous silicon nanocarrier for delivering chemotherapeutic drugs to treat pancreatic cancer. These carriers can effectively deliver drugs into cancer cells, but in drug-resistant cancer cells, the drug released by the nanocarriers is still exposed to P-gp and expelled from the cells, reducing the intracellular drug concentration. Thus, how to overcome drug resistance in delivery remains a great challenge. To solve this problem, the designability of MSN surface-rich active sites and functional nucleic acid molecules (such as antisense oligonucleotide, siRNA or aptamer) is utilized to reasonably construct integrated nano-carriers, so that the method has application potential in the aspects of effectively delivering drugs and overcoming drug resistance. At the same time, the ability to visualize intracellular events in real time is another key factor in assessing drug release and gene silencing ability of nanocarriers, but has been rarely explored.
Disclosure of Invention
Based on the technical background, the invention constructs a mesoporous silicon nano-carrier modified by a multifunctional Molecular Beacon (MB) for MDR1mRNA silencing, imaging and drug delivery in drug-resistant cancer cells. The nanocarriers (Dox@MSN-AD-MBs) are constructed by modifying quencher-labeled Anchor DNA (AD) on the MSN surface, encapsulating doxorubicin (Dox) and blocking with FAM-labeled molecular beacons. After uptake by drug-resistant cancer cells, MBs on the nanocarrier surface will hybridize to MDR1mRNA while unhybridizing to AD and shedding from the carrier. This hybridization event can achieve a triple effect: one is silencing MDR1mRNA and down-regulating P-glycoprotein (P-gp) expression levels; restoring FAM fluorescence and imaging MDR1mRNA in situ; thirdly, open the plugged pores and release Dox, resulting in cytotoxicity. qRT-PCR and Western blot results showed that MDR1mRNA and P-gp expression in HepG2/ADR and MCF-7/ADR cells were reduced after co-incubation with MSN-AD-MBs. The fluorescent imaging experiments enabled visualization of intracellular hybridization events of MB and MDR1mRNA and monitoring of MDR1mRNA expression levels. The ability of the nanocarriers to inhibit drug-resistant cancer cells was examined by cytotoxicity assays. Dox@MSN-AD-MBs showed higher inhibition efficacy against HepG2/ADR cells and MCF-7/ADR cells compared to free Dox. The invention provides a new idea for developing a multifunctional nano-carrier, has application potential in inhibiting cancer cell drug resistance, and specifically provides the following technical scheme:
In a first aspect of the present invention, a molecular beacon modified nanocarrier is provided, wherein a main body of the nanocarrier is a porous carrier, a chemotherapeutic drug is loaded in the porous carrier, and a hybridization chain of the molecular beacon and an anchored DNA is modified on the surface of the porous carrier; the molecular beacon is used for plugging the through holes on the surface of the porous carrier, and the anchored DNA is fixed on the surface of the porous carrier through chemical bonds.
Preferably, the porous carrier is mesoporous silicon nano particles (MSN), and is a hollow sphere with through holes on the surface, the chemotherapeutic drugs are loaded in the cavity of the hollow sphere, the particle size of the hollow sphere is 120-150 nm, and the size of the through holes is 2-3 nm.
Further, the mesoporous silicon nanoparticle is synthesized by a sol-gel method, and the specific steps are as follows: slowly adding aqueous solution of Cetyl Trimethyl Ammonium Bromide (CTAB) into alkali liquor, heating to 75-85 ℃, slowly adding Tetraethoxysilane (TEOS) and maintaining the temperature of 75-85 ℃ for reaction for 0.5-3 h, and obtaining white precipitate, namely the mesoporous silicon nano-carrier.
It should be clear that the chemotherapeutic agent is a small molecular chemical entity with anti-tumor activity, and is not limited to the therapeutic mechanism or kind of the agent, and can be applied to the above nano-carrier as long as it can be loaded into the cavity of the porous carrier and released through the through-hole. In one embodiment of the present invention, the chemotherapeutic agent is doxorubicin (Dox). Furthermore, in the mesoporous silicon nano-carrier loaded with the doxorubicin, the doxorubicin is loaded into the cavity of the mesoporous silicon nano-particle through diffusion.
In addition, in the design of the molecular beacon and the anchored DNA hybrid chain according to the first aspect, the molecular beacon has a fluorescent dye modification, the anchored DNA has a quenching group modification, when two nucleotide chains are in a hybrid state, the nanocarrier does not exhibit fluorescence, and when the nanocarrier is taken up by a cell, the molecular beacon has high affinity with a target in the tumor cell, is separated from the surface of the carrier, and performs tumor cell imaging by fluorescence.
Based on the above design, the target of the molecular beacon can be adjusted according to the type of tumor cells and the purpose of drug design, in a preferred mode of the invention, the nano-carrier is applied to the treatment of drug-resistant tumors, the target of the molecular beacon is a drug-resistant related gene, a specific example is MDR1, the aptamer chain has higher affinity with MDR1mRNA, and MDR1mRNA in drug-resistant tumor cells can be silenced and imaged.
Further, the 5 'end of the anchored DNA is connected to the surface of the nano-carrier through a chemical bond, and the 3' end is marked with a quenching group; furthermore, the chemical bond is an amide bond, the 5' end of the anchored DNA is provided with amino modification, and the anchored DNA is connected with the carboxyl on the surface of the nano-carrier through amide condensation; the 5' end of the aptamer chain is provided with a fluorescent group mark; still further, the quenching group is BHQ-1 and the fluorescent group is FAM.
In a specific embodiment of the foregoing preferred embodiment, the sequence of the molecular beacon is as follows:
FAM-AGGTCGGTAAGCTTCAAGATCCATCCCGACCTCGCGAATGATTAGGTCGATAAGCTACAGGAGGCTACATGACCTCGCGAATGATT；
the sequence of the anchor DNA is as follows:
H 2 N-AATCATTCGCG-BHQ1。
the preparation method of the molecular beacon modified nano-carrier in the scheme comprises the following steps: synthesizing mesoporous silicon nano particles by adopting a sol-gel method, and connecting amino groups on the surfaces of the mesoporous silicon nano particles to obtain aminated silicon dioxide (MSN-NH) 2 ) For MSN-NH 2 Carboxylation is carried out to obtain carboxylated mesoporous silicon nano particles (MSN-COOH); modifying the aminated anchor DNA on the surface of MSN-COOH through an amide condensation reaction to generate an anchor DNA modified MSN (MSN-AD); dissolving Dox in a buffer solution, adding MSN-AD and stirring the reaction in a dark environment to load the drug; and continuing to add a molecular beacon into the buffer solution of the MSN-AD after drug loading to react to complete hybridization, thus obtaining the molecular marker modified nano-carrier (Dox@MSN-AD-MBs).
Further, in the preparation method, the manner of connecting amino groups on the surface of the mesoporous silicon particles is as follows: adding 3-aminopropyl triethoxysilane (APTES) into toluene solution of MSN, heating to 110-120 ℃ for reaction for 1-3 h to obtain a solid part, washing the solid part, dispersing the solid part into methanol solution of hydrochloric acid, and refluxing for 14-18 h to obtain the MSN-NH 2 。
Further, in the above preparation method, the para-MSN-NH 2 The carboxylation is carried out in the following manner: MSN-NH 2 Adding the mixture with succinic anhydride into N, N-Dimethylformamide (DMF), and reacting for 7-9 h at room temperature to obtain MSN-COOH.
Further, in the above preparation method, the preparation method of the MSN-AD is as follows: adding 1- (3-dimethylaminopropyl) -3-Ethylcarbodiimide (EDC) and N-hydroxy-thiosuccinimide (Sulfo-NHS) into the suspension of MSN-COOH, reacting for 12-17 min, and activating carboxyl; adding PBS and aminated anchored DNA, and continuing to react for 24 hours to obtain the MSN-AD.
Further, the stirring reaction time in the dark environment is 10-14 h.
Further, in the preparation method, molecular beacons are added into the buffer solution of the MSN-AD after drug loading for reaction for 4-8 hours.
In a second aspect, the invention provides the use of the molecular beacon modified nanocarriers of the first aspect as an anti-tumor active ingredient.
In the second aspect, the application mode of the antitumor active ingredient includes but is not limited to any one of the following:
(1) Administering the molecular beacon-modified nanocarrier of the first aspect to a subject in need of treatment;
(2) The molecular beacon modified nano-carrier in the first aspect is used for preparing an anti-tumor product;
(3) The molecular beacon modified nano-carrier of the first aspect is used as an anti-tumor model medicament.
In the application of the above aspect (1), the "individual in need of treatment" means an individual in need of treatment for a tumor-associated disease, preferably, a drug-resistant tumor; the "treatment" includes alleviation, inhibition, amelioration, and cure of the disease; in addition, the term "individual" means any animal, preferably a mammal, including mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or primates, and most preferably a human.
In the application of the above (2), the anti-tumor product includes, but is not limited to, anti-tumor drugs, health products with anti-tumor effect, special medical foods, medical instruments applied in the anti-tumor treatment process, and the like.
In the application of the above-mentioned aspect (3), the "antitumor model agent" includes an agent preparation involved in screening an antitumor drug, evaluating the efficacy thereof in an in vivo or in vitro model. Based on the design of the first aspect of the invention, the molecular beacon can hybridize with MDR1 mRNA after being separated from the nano-carrier, and meanwhile, tumor cell in-situ imaging is realized, and the application of the design and the anti-tumor drug model can conveniently observe the drug effect exertion condition through a fluorescence microscope.
In a third aspect of the invention, there is provided a pharmaceutical composition comprising a molecular beacon modified nanocarrier of the first aspect.
Preferably, the pharmaceutical composition comprises other active ingredients and/or pharmaceutically necessary auxiliary materials.
Further, the other active ingredients include, but are not limited to, one or more of antitumor drugs, anti-inflammatory drugs, immunomodulating drugs, analgesic drugs, hemostatic drugs.
In a fourth aspect, the present invention provides a drug-resistant tumor therapeutic agent, wherein the molecular beacon modified nanocarrier of the first aspect is used as an active ingredient.
The beneficial effects of the above technical scheme are:
in one scheme provided by the invention, a molecular beacon containing an MDR1mRNA antisense sequence is used as MSN gate control to construct a multifunctional mesoporous silicon nano-carrier for silencing, imaging and drug delivery of MDR1mRNA in drug-resistant cancer cells. By imaging intracellular MDR1mRNA, the nanocarriers can be used to distinguish drug-resistant cancer cells from non-drug-resistant cancer cells. MB is used as an antisense sequence of MDR1mRNA, can effectively silence MDR1mRNA, inhibit translation of the MDR1mRNA and down regulate expression of P-gp, thereby reducing drug excretion and being used for resisting drug resistance. Dox@MSN-AD-MBs showed significantly enhanced inhibitory potency against HepG2/ADR cells and MCF-7/ADR cells compared to free Dox. IC of free Dox and Dox@MSN-AD-MBs on HepG2/ADR cells 50 IC for MCF-7/ADR cells at 0.47. Mu.M and 1.2. Mu.M, respectively 50 The values were 2.9. Mu.M and 2. Mu.M, respectively>5.0. Mu.M. By integrating cancer marker imaging, gene silencing and drug delivery functions, the nano-carrier provides a new thought for the development of a multifunctional drug delivery system, and has application potential in the diagnosis and treatment of cancer and drug resistance inhibition.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.
FIG. 1 is a schematic illustration of the molecular beacon modified mesoporous silica nanocarrier of the present invention for silencing, imaging and drug delivery of MDR1 mRNA in drug-resistant cancer cells;
FIG. 2 is a diagram showing the feasibility of the non-denaturing PAGE method in example 1;
lane M: a Marker; lane 1: MDR1 mRNA target sequence (500 nM); lane 2: MB (500 nM); lane 3: anchored DNA (500 nM); lane 4: MB (500 nM) + anchored DNA (500 nM); lane 5: anchoring DNA-MB hybrid (500 nM) +MDR1 mRNA target sequence (500 nM);
FIG. 3 is the construction and characterization of MSN-AD-MBs as described in example 1;
(A) TEM image of MSN; (B) Hydrated particle size distribution curves for MSN, MSN-AD and MSN-AD-MBs; (C) BET nitrogen adsorption and desorption profile of MSN; (D) pore size distribution curve of MSN; (E) MSN, MSN-NH 2 Surface Zeta potentials of MSN-COOH, MSN-AD and MSN-AD-MBs; (F) MSN, MSN-NH 2 FT-IR spectra of MSN-COOH and MSN-AD-MBs;
FIG. 4 is a photograph of MSN-COOH (left) and MSN-AD (right) as described in example 1;
FIG. 5 shows the modified amount of MB and the loading result of Dox described in example 1;
(A) Fluorescence signal intensity-concentration linear relationship of FAM labeled MB; (B) fluorescent signal intensity versus concentration linear relationship of Dox; (C) fluorescence emission spectra of the solution before and after modification of FAM-labeled MB; (D) fluorescence emission spectra of the solution before and after Dox loading;
FIG. 6 is a graph showing stability of nanocarriers and Dox in vitro release studies;
(A) MSN-AD-MBs are in a PBS buffer system and a PBS buffer system containing target sequences of glutathione, DNase I and MDR1mRNA, and FAM fluorescence signal recovery rate-time relation diagrams are shown; (B) Dox release rate versus time curves for Dox@MSN-AD-MBs incubated with different concentrations of MDR1 mRNA;
FIG. 7 is a graph showing the relative expression levels of MDR1mRNA in HepG2 cells, hepG2/ADR cells, MCF-7 cells and MCF-7/ADR cells by qRT-PCR as described in example 1;
FIG. 8 is a confocal fluorescence imaging of HepG2 cells, hepG2/ADR cells, MCF-7 cells and MCF-7/ADR cells after MSN-AD-MBs treatment as described in example 1; the scale is 20 μm;
FIG. 9 is a confocal fluorescence imaging photograph of free Dox and Dox@MSN-AD-MBs after treatment of different tumor cells;
wherein (A) is a HepG2/ADR cell; (B) MCF-7/ADR cells; the scale is 20 μm;
FIG. 10 shows the relative expression levels of MDR1 mRNA in tumor cells after treatment of tumor cells with different concentrations of MSN-AD-MBs (in MB concentration) by qRT-PCR;
wherein (A) is a HepG2/ADR cell; (B) MCF-7/ADR cells;
FIG. 11 shows the survival rate of tumor cells after treatment with free Dox and Dox@MSN-AD-MBs (in terms of Dox concentration) by MTT assay;
wherein, (A) is HepG2/ADR cells treated by the medicines with different concentrations; (B) MCF-7/ADR cells treated with the above drugs at different concentrations; (C) HepG2/ADR cells treated with the above drug at the same concentration; (D) MCF-7/ADR cell viability following treatment with the same concentrations of the above drugs; dox concentrations used for HepG2/ADR cells and MCF-7/ADR cells were 1.3. Mu.M and 4.0. Mu.M, respectively.
Detailed Description
It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.
In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.
Example 1
Reagents and apparatus
The nucleic acids used in this example (see Table 1 and Table 2 for specific sequences) were purchased from Bio Inc. (Shanghai, china). Tetraethoxysilane (TEOS) is purchased from national drug group limited (shanghai, china). Fetal Bovine Serum (FBS), cetyltrimethylammonium (CTAB) and succinic anhydride were purchased from soribao biotechnology limited (beijing, china). 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Source leaf Biotechnology Inc. (Shanghai, china). N-hydroxysuccinimide sodium salt (Sulfo-NHS) was purchased from BBI biosciences Inc. (Shanghai, china). 3-aminopropyl-triethoxysilane (APTES) is available from Michelin biosciences Inc. (Beijing, china). Doxorubicin (Dox) was purchased from guangdong warfare pharmaceutical limited (guangdong, china). Glutathione (GSH) was purchased from Shanghai alaa Ding Shenghua technologies limited (beijing, china). DNase I was purchased from NEB beijing corporation (beijing, china). Trypsin, RPMI 1640, DMEM and PBS buffer were purchased from Biological industry limited (israel). Tetramethyl azosin (MTT) was purchased from Sigma-Aldrich chemical Co., ltd. The reagents used in this work were analytically pure, and both aqueous and buffer solutions were prepared using ultrapure water.
TABLE 1 nucleic acid sequences used in this example
Figure BDA0003526729930000081
Note that: the green part of MB represents the MDR1 mRNA recognition sequence, the underlined part represents the stem of the hairpin, and FAM represents the FAM fluorophore label; the underlined part in Ctrl-MB represents the stem of the hairpin; anchoring H in DNA 2 N represents an amino modification and BHQ-1 represents a BHQ-1 quencher label.
TABLE 2 qRT-PCR primer sequences used in this example
Figure BDA0003526729930000082
Transmission Electron Microscope (TEM) images were taken using a JEM2100 microscope (japan). ASAP2020 (USA) was used to plot Brunauer-Emmett-Teller (BET) nitrogen adsorption and desorption isotherms. Dynamic Light Scattering (DLS) and surface Zeta potential data of the nanoparticles were measured using Malvern Nano ZS Analyzer (uk). Fourier transform infrared (FT-IR) spectra were recorded using a Tensor II spectrometer (germany). The fluorescence signal intensity was measured and the fluorescence emission spectrum was collected using an F-7000 Hitachi fluorescence emission spectrometer (Japan). UV-vis absorbance spectra were collected and absorbance was measured using a Hitachi U-2910 spectrometer (Japan). Fluorescence imaging photographs were taken using a Leica TCS SP8 Confocal Laser Scanning Microscope (CLSM) (germany). MTT assay data were measured using a Tecan multimode microplate reader (Switzerland).
Gel electrophoresis experiments
The binding feasibility of Molecular Beacons (MB) to the anchor DNA was verified by polyacrylamide gel electrophoresis (PAGE) and the ability of MB to recognize the MDR1 mRNA target sequence. First, a 12% PAGE gel was prepared, and an acrylamide solution (7.5 mL, 40%), a 5 XTBE buffer (Tris 88mM, boric acid 88mM,EDTA 2.0mM,pH 8.3,5.0mL), N, N, N ', N' -tetramethyl ethylenediamine (18. Mu.L), an ammonium persulfate solution (0.1 g mL) was taken -1 180. Mu.L) and DEPC water (12.5 mL) were mixed together and then made into a gel. After the sample was injected into the gel, it was electrophoresed at a constant current of 25mA in 1 XTBE buffer at 15℃for 1h. After electrophoresis, the gel was removed and stained in SYBR Gold (one ten thousandth) solution for 40min in the absence of light. Finally, the stained gel was placed in a Bio-RAD gel imaging system for imaging.
Synthesis of aminated mesoporous silicon nanoparticles
MSN was synthesized using classical sol-gel methods. The method comprises the following specific steps: CTAB (0.5 g) was dissolved in deionized water (240 mL) and NaOH solution (2.0M, 1.8 mL) was slowly added with stirring. TEOS (4.0 mL) was then slowly added and the reaction was maintained at 80deg.C for 2h, resulting in a white precipitate. After cooling to room temperature, the white precipitate was separated by centrifugation (12000 rpm,6 min), washed with ethanol and water, and dried in an oven. The amino group is attached by post-modification. Specifically, the dried solid (400 mg) was suspended in toluene (40 mL), APTES (80. Mu.L) was added under stirring, and the mixture was heated to 110℃to react for 2 hours to obtain aminated silica. Fixing the above Centrifugally separating and washing with ethanol, dispersing in hydrochloric acid methanol solution (hydrochloric acid 37.4%2.0mL, methanol 160 mL) and refluxing for 16 hr to remove internal CTAB template to obtain aminated mesoporous silicon nanoparticle (MSN-NH) 2 ). Will obtain MSN-NH 2 Washing with ethanol, and drying in an oven for later use.
Preparation of MSN-AD-MBs
Before modifying DNA, MSN-NH 2 Carboxylation is performed. Carboxylation is obtained by the reaction of an anhydride with an amino group. Specifically, MSN-NH 2 (50 mg) and succinic anhydride (500 mg) are added into N, N-dimethylformamide (DMF, 15 mL) to react for 8 hours at room temperature, and carboxylated mesoporous silicon nano particles (MSN-COOH) can be obtained. After centrifugation of MSN-COOH and washing with water, the MES buffer (MES 100mM,pH 6.0,5.0mL) was resuspended for subsequent experiments.
The aminated anchor DNA is modified on the surface of MSN-COOH through amide condensation reaction. A suspension of MSN-COOH (5.0 mg,0.5 mL) was taken, EDC (15.0 mg) and sulfoNHS (25.0 mg) were added thereto with stirring, and the mixture was reacted for 15 minutes to activate the carboxyl group. PBS (1.0 mL, pH 7.4) and the aminated anchor DNA (30. Mu.M, 450. Mu.L) were added and the reaction was continued for 24 hours to give an anchor DNA modified MSN (MSN-AD). MSN-AD was isolated by centrifugation, washed with water and dispersed in PBS buffer.
The preparation of MSN-AD-MBs is performed on the basis of MSN-AD. The above MSN-AD (22. Mu.L) suspension was diluted to 1.0mL with PBS, MB (100. Mu.M, 10. Mu.L) was added with stirring, and the reaction was continued for 6 hours to complete hybridization, to prepare nanocarriers (MSN-AD-MBs). MSN-AD-MBs were isolated by centrifugation and washed with PBS buffer. And combining the supernatant and the washing solution, and calculating the reduction amount of MB in the PBS buffer solution in the modification process by a fluorescence method, namely the MB amount of MSN surface modification.
Preparation of Dox@MSN-AD-MBs
Dox (1.0 mg) was dissolved in PBS buffer (1.0 mL), MSN-AD (200. Mu.L) was added under stirring, and after stirring in a dark environment for 12h to fully load Dox, MB (100. Mu.M, 45. Mu.L) was added. And continuing the reaction for 6 hours to obtain the drug-loaded nano-carrier (Dox@MSN-AD-MBs). The reaction was stopped, and the prepared Dox@MSN-AD-MBs were separated by centrifugation, washed with PBS buffer, and suspended in PBS buffer (1.0 mL) for use. The carrying capacity of the Dox is calculated by a fluorescence method, and the reduction amount of the Dox before and after loading is the Dox amount loaded in the MSN.
Dox in vitro release investigation
In vitro release studies of Dox were performed by semi-permeable membrane pocket diffusion. To verify the specificity of the drug-loaded nanocarriers to release Dox, the present example mixes MDR1 mRNA target sequences at different concentrations (0, 1.0, 2.0 and 4.0. Mu.M) with Dox@MSN-AD-MBs and oscillates at a speed of 100rpm for 24h at 37 ℃. During shaking, samples were taken at predetermined time points (0.5, 1, 2, 3, 4, 5, 6.5, 8, 12 and 24 h), 0.1mL each time, and the supernatant was quantitatively analyzed for Dox after centrifugation. PBS buffer (0.1 mL) was added after each sample to ensure that the total volume remained unchanged. Dox is quantified by fluorescence. Specifically, the fluorescence signal intensities of the Dox solutions with different concentrations are measured first, a standard curve of the fluorescence signal intensities and the Dox concentrations is drawn, and then the Dox concentrations are quantified according to the standard curve.
Stability investigation of nano-carrier
In order to examine the stability of the nanocarriers, in this example, MSN-AD-MBs were combined with MDR1mRNA target sequence (100 nM), GSH (15 mM), DNase I (3.5 mU mL) -1 ) Co-incubation. Samples were taken at predetermined time points (10, 20, 30, 40, 50 and 60 min), and fluorescence signal intensities of FAM groups were measured after centrifugation. Fluorescence recovery of FAM was calculated after quantification of FAM and compared to the blank.
Cell and cell culture
HepG2 cells were purchased from the national academy of sciences, hepG2/ADR cells were purchased from the Aiyan biotechnology company, and MCF-7 cells and MCF-7/ADR cells were provided by the university of Shandong, university of chemical and materials sciences, liu Zhenzhen doctor and the university of Shandong, qilu medical college of medicine, han Xiuzhen, respectively, teaching friends. HepG2 cells and HepG2/ADR cells were cultured in DMEM medium containing 10% fetal bovine serum and 1.0% antibiotics, and MCF-7 cells and MCF-7/ADR cells were cultured in RPMI 1640 medium containing 10% FBS and 1.0% antibiotics. All cells were at 37℃and contained 5.0% CO 2 Is cultured in an incubator of (a).
Cell fluorescence imaging experiment
HepG2 cells, hepG2/ADR cells, MCF-7 cells and MCF-7/ADR cells were inoculated into confocal dishes and incubated for 24 hours, and then MSN-AD-MBs (50. Mu.g mL) were added thereto -1 150 μl) of fresh medium, and after an additional incubation period of 4 hours, imaging was performed under a fluorescence microscope.
Intracellular Dox accumulation assay
HepG2/ADR and MCF-7/ADR cells were inoculated into confocal dishes, respectively, and after incubation for 24h, the medium was discarded. The cells were then washed with PBS buffer and divided into two groups, which were incubated with medium containing free Dox and Dox@MSN-AD-MBs (each containing 1.0. Mu.M Dox) for 4h, respectively, and imaged under a fluorescence microscope.
MDR1 mRNA expression level analysis
The relative expression levels of MDR1 mRNA in different cells were analyzed by qRT-PCR. HepG2 cells, MCF-7 cells, hepG2/ADR cells and MCF-7/ADR cells were inoculated into six-well plates, and after culturing with different concentrations of MSN-AD-MBs (containing 0, 50, 100 and 200nM MBs) for 48 hours (HepG 2 cells and MCF-7 cells were cultured with medium), total RNA of the cells was extracted with Trizol reagent, respectively. GAPDH was selected as an internal control for qRT-PCR experiments with a cycling program of 95℃for 3min and 60℃for 30s (45 cycles). Through 2 -ΔΔCt The relative expression level of MDR1 mRNA was calculated by the method.
Western blot analysis
HepG2/ADR cells and MCF-7/ADR cells were inoculated into six well plates, incubated with different concentrations of MSN-AD-MBs (containing 0, 50, 100 and 200nM MB) for 48h, and then washed 3 times with warm physiological saline to remove the culture. Next, RIPA lysis buffer containing protease and phosphatase inhibitor was added to extract total protein of the cells. Adding the extracted protein into protein sample loading buffer solution, heating to 100deg.C for 5min to denature the protein, packaging, and storing in-20deg.C refrigerator to avoid repeated freezing and thawing. The expression level of P-glycoprotein (P-gp) was characterized according to the Western blot analysis protocol. The method comprises the following specific steps:
Firstly, 8.0% of separating glue and 4.0% of laminating glue are prepared, and the method comprises the following steps: deionized water (7.05 mL), tris-HCl buffer (1.5M,pH 8.8,3.75mL), sodium dodecyl sulfate solution (10%, 150. Mu.L), acrylamide solution (30%, 4.95 mL), N, N, N ', N' -tetramethyl ethylenediamine (30. Mu.L), ammonium persulfate solution (0.1 g mL) was taken -1 75 μl) was mixed to prepare a separator, and after the above mixed solution was added to a glass plate, 0.1% sodium dodecyl sulfate solution was carefully added to ensure the flatness of the adhesive surface. Standing for 1h, removing 0.1% sodium dodecyl sulfate solution, and preparing the laminating adhesive. Deionized water (5.4 mL), tris-HCl buffer (1.5M,pH 6.8,2.5mL), sodium dodecyl sulfate solution (10%, 100. Mu.L), acrylamide solution (30%, 2.0 mL), N, N, N ', N' -tetramethyl ethylenediamine (20. Mu.L), ammonium persulfate solution (0.1 g mL) -1 50 μl) was mixed to prepare a separating gel. Pouring the gel into a glass plate, inserting a comb, standing for 1h, and finishing gel preparation.
Then, the total protein extract (30. Mu.g per lane) was added thereto and subjected to electrophoresis. And after the blue band of the loading buffer solution enters the separation gel, the voltage is increased to 120V, the electrophoresis is continued until the blue band completely runs out, and the electrophoresis is finished. After the electrophoresis was completed, the proteins were transferred onto PVDF membrane (Millipore Immobilon-P,0.45 μm) in a transfer buffer. After the transfer was completed, the PVDF membrane was placed in 5% skim milk dissolved in TBST buffer (10mM Tris,150mM NaCl,0.05%Tween-20, pH 7.2-7.5) and incubated with gentle shaking at room temperature for 1h to block non-specific protein binding sites on the membrane. After washing the PVDF membrane 3 times with TBST buffer, the PVDF membrane at the corresponding protein position was cleaved and placed in the corresponding primary antibody incubation solution, respectively, and incubated overnight at 4 ℃. The next day, PVDF membranes were washed 3 times with TBST and incubated with horseradish peroxide-labeled secondary antibodies for 2h at room temperature with gentle shaking.
Finally, after washing 3 times with TBST, PVDF films were placed in an imager for imaging.
Cytotoxicity investigation
First, hepG2/ADR cells and MCF-7/ADR cells were seeded in 96-well plates, and after incubation for 24 hours, the medium was discarded. By using solutions containing different concentrations of freeDox, MSN-AD-MBs and Dox@MSN-AD-MBs (Dox concentration of HepG2/ADR cells is 0.1, 0.5, 1.0, 1.25 and 1.5. Mu.M, and Dox concentration of MCF-7/ADR cells is 0.1, 1.0, 2.0, 3.0 and 5.0. Mu.M) were incubated for 48h with fresh medium in which the addition of MSN-AD-MBs was consistent with that of Dox@MSN-AD-MBs. After discarding the medium, the cells were washed with PBS and MTT solution (0.5 mg mL) was added to each well -1 100 μl). After an additional 4h incubation, the supernatant was removed and DMSO (100 μl per well) was added. To solubilize the formazan produced. After shaking for 5min, absorbance values at 570nm were measured for each well with an enzyme-labeled instrument. Cell viability (%) was calculated using the following formula:
Figure BDA0003526729930000131
wherein A is sample ，A control And A blank Representative of absorbance of samples, controls and blanks.
To further verify the role of MB in enhancing the inhibition efficiency against drug-resistant cancer cells, the present example treated HepG2/ADR cells and MCF-7/ADR cells with nanocarriers loaded with MB and ctrl MB (MB containing 8 MDR1 mRNA mismatched bases), respectively, and examined the cell viability. The pretreatment method of the cells was the same as that of the cytotoxicity investigation method described above, and after washing the cells with PBS buffer, hepG2/ADR cells and MCF-7/ADR cells were incubated for 48 hours in a medium containing the same concentrations of free Dox, dox@MSN-AD-ctrl MBs and Dox@MSN-AD-MBs (Dox concentration of HepG2/ADR cells was 1.3. Mu.M and Dox concentration of MCF-7/ADR cells was 4.0. Mu.M), and after the same treatment, the OD value of each well at 570nm was measured with an enzyme-labeled instrument. Cell viability was calculated as above.
Design principle of multi-functional molecular beacon modified mesoporous silicon nano-carrier for silencing, imaging and drug delivery of MDR1mRNA in drug-resistant cancer cells
The principle of the multifunctional Molecular Beacon (MB) modified mesoporous silicon nano-carrier for silencing, imaging and drug delivery of MDR1mRNA in drug-resistant cancer cells is shown in figure 1. First, small molecule chemotherapeutic drug Dox is loaded into carboxylated mesoporous silicon nanoparticle (MSN-COOH) cavities by diffusion to form Dox-loaded MSN-COOH (dox@msn-COOH). Then, the Dox@MSN-AD was constructed by modifying an amino group and a quencher (BHQ-1) double-labeled Anchor DNA (AD) on the surface of the Dox@MSN-COOH by amide condensation. On this basis, FAM-labeled MB is connected through base complementation pairing to prepare a drug-loaded nano-carrier (Dox@MSN-AD-MBs). MB is responsible for recognizing MDR1mRNA and blocking MSN. When Dox@MSN-AD-MBs are taken up by drug-resistant cancer cells, the surface MB is hybridized with MDR1mRNA, is unhybridized with AD and falls off from the carrier. Hybridization events of MB with MDR1mRNA have a triple effect: first, hybridization of MB with MDR1mRNA can be used to inhibit drug resistance by silencing MDR1mRNA and down-regulating P-gp expression levels; second, hybridization events of MB with MDR1mRNA can keep FAM fluorophore away from BHQ-1 quencher, restoring fluorescence for in situ imaging of MDR1mRNA; finally, the MB is far away from the MSN, so that the MSN hole is opened, dox is released, and cytotoxicity is exerted. The multifunctional MB modified mesoporous silicon nano-carrier constructed in the chapter has two advantages in cancer marker sensing and drug delivery. First, by loading Dox and modifying MB, the nanocarriers combine imaging and drug delivery functions of MDR1mRNA in drug-resistant cancer cells, helping to inhibit cancer cells while analyzing cancer marker expression information in situ in real time; secondly, through integrating MB with MDR1mRNA silencing effect, the expression level of MDR1mRNA and P-gp is down-regulated by the nano-carrier, so that drug resistance of drug-resistant cancer cells to drugs is inhibited, and the delivery efficiency of chemotherapeutic drugs and the inhibition efficiency of the drug-resistant cancer cells are effectively enhanced.
Characterization by gel electrophoresis
Non-denaturing PAGE was used to verify the feasibility of hybridization of MB to the anchor DNA and the binding capacity of MB to the MDR1 mRNA target sequence. Lanes 1-3 represent the MDR1 mRNA target sequence band, MB band and anchor DNA band, respectively, as shown in FIG. 2. After mixing the anchor DNA and MB, a clear band appears in lane 4, which moves slower than the MB alone (lane 2) and the anchor DNA (lane 3), as the anchor DNA hybridizes with the MB, indicating that the anchor DNA hybridizes with the MB. Lane 5 shows the result of electrophoresis after mixing the anchored DNA-MB hybrid with the MDR1 mRNA target sequence, where the anchored DNA-MB hybrid band (lane 4) is absent, indicating that the MDR1 mRNA target sequence competes for binding to MB in the presence of the MDR1 mRNA target sequence to form an MDR1 mRNA-MB hybrid; an anchor DNA band (lane 3) appears at the same time, indicating that binding of MDR1 mRNA to MB can dissociate MB from the anchor DNA. The PAGE results show that the interaction between the designed nucleic acid sequences meets the design requirements.
Construction and characterization of MSN-AD-MBs
TEM images (FIG. 3A) show that the synthesized MSN is a porous spherical particle with an average particle size of about 138.4nm. The average hydrated particle size of MSN was further determined by DLS to be about 146.9nm (fig. 3B), slightly larger than that observed under electron microscopy, since the particle size measured by DLS method is that of hydrated ions formed after the nanoparticles were solvated in aqueous solution, and the number would be slightly larger than that of MSN directly observed under TEM. Research shows that MSN with the particle size of 135-200nm has less cytotoxicity and is easy to be taken up by cells, and has advantages in biomedical application. In addition, the present example performed a BET nitrogen adsorption and desorption test, and the BET adsorption and desorption isotherm of MSN (fig. 3C) was an IV-type isotherm, indicating that MSN had a mesoporous structure, and the average pore diameter thereof was further calculated to be 2.3nm (fig. 3D).
Next, this example characterizes the preparation process of the nanocarriers. The average hydrated particle sizes of MSN, MSN-AD and MSN-AD-MBs were determined by the DLS method, respectively. As shown, the average hydrated particle sizes of MSN-AD (155.5 nm) and MSN-AD-MBs (163.2 nm) were both larger than MSN, which also indicates successful modification of the anchor DNA and MB. To further demonstrate this, the present example determines the surface Zeta potential values of structures that occur during the preparation of MSN-AD-MBs (FIG. 3E). MSN presents negative potential due to abundant silicon hydroxyl on the surface; MSN-NH because the amino group is easy to bind with proton 2 The surface Zeata potential of (2) exhibits a positive potential; after carboxylation and DNA modification, the Zeta potential values of the MSN-COOH and MSN-AD-MBs surfaces are negative due to electronegativity of carboxyl and nucleic acid. The above-described changes in Zeta potential values provide evidence for the success of carboxylation and DNA modification. Next, the present embodiment is directed to MSN-NH 2 FT-IR was performed with MSN-COOH and MSN-AD-MBs. As shown in FIG. 3F, MSN-NH 2 The FT-IR spectrum of (3) was found to be 1503cm -1 Is discharged fromThe present absorption peak is a bending vibration peak of N-H bond and is a characteristic absorption peak of amino, which confirms the existence of the amino; an amide bond characteristic absorption peak (1556 cm) -1 N-H vibration peak) and carboxyl characteristic absorption peak (1720 cm) -1 Carbonyl telescopic peak in carboxyl), indicating successful attachment of carboxyl; in the spectral diagram of MSN-AD-MBs, 1720cm -1 The peak disappeared and only the residual amide bond characteristic absorption peak (1557 cm -1 ) This is because the carboxyl groups form amide bonds with the amino groups, further demonstrating the successful preparation of MSN-AD-MBs.
In addition, this example takes photographs of MSN-COOH and MSN-AD, respectively, after modification of the anchor DNA on MSN-COOH. As shown in FIG. 4, the colors of MSN-COOH and MSN-AD were white and pink, respectively, the color of BHQ-1 labeled anchor DNA, and this change in color intuitively demonstrated successful modification of anchor DNA.
Modification amount of MB and loading amount of Dox
The MB modification and Dox loading were calculated using the deweighting method. First, FAM-labeled MB and Dox standard curves were plotted, respectively. As shown in FIG. 5A, FAM fluorescence signal intensity (F FAM ) With MB concentration (C) MBs ) Has good linear relation, and the linear equation is F FAM ＝29.2C MBs +45.1(R 2 =0.999); in the volume of 0.1-20 mug mL -1 In the concentration range, the intensity of the Dox fluorescence signal (F Dox ) Concentration of Dox (C) Dox ) In good linear relationship (FIG. 5B), the linear equation is F Dox ＝10.9C Dox -1.18(R 2 =0.997). Fluorescence signal intensities of MB before and after modification and Dox before and after loading were then measured (fig. 5C and 5D), respectively, and the concentrations of MB and Dox were converted from the working curves. The MB reduction before and after modification and the Dox reduction before and after loading are respectively the MB modification amount and the Dox loading amount which are 4.2 mu mol g -1 And 100.9mg g -1 。
Stability of nanocarriers and Dox in vitro Release investigation
Since intracellular enzymes and reducing substances often cause nonspecific degradation or destruction of nanocarriers, thereby generating imaging false positive signals or nonspecific release of drugs, this example examined the stability of MSN-AD-MBs in different environments. The MSN-AD-MBs were incubated with PBS buffer containing DNase I and GSH, simulating the intracellular, intracellular enzyme and reducing environments, respectively, and FAM fluorescence signal recovery was measured and the stability of the vector was assessed by comparison with positive samples (incubation with medium containing MDR1 mRNA target sequences). As shown in FIG. 6A, after the MSN-AD-MBs are incubated with PBS buffer and PBS buffer containing DNase I and GSH for 60min, the recovery rate of fluorescence signals of the MSN-AD-MBs is not remarkably different from that of negative samples, and is remarkably lower than that of positive samples under the same incubation condition, so that the MSN-AD-MBs have better tolerance to intracellular enzymes and reducing substances, and the carrier has good stability. This is because the steric hindrance of MSN effectively impedes degradation of MSN surface modified nucleic acids by interfering substances in the environment, such as nucleases, thereby ensuring the structural integrity and stability of the nanocarrier.
The in vitro release of Dox@MSN-AD-MBs was examined using a semipermeable membrane pouch method, the principle of which is that a semipermeable membrane pouch allows Dox but not MSN. By testing the intensity of the Dox fluorescent signal at different time points and converting it into Dox concentration according to a standard curve, the present example plots the Dox release rate versus time curve incubated with different concentrations of MDR1 mRNA target sequences. As shown in fig. 6B, the release rate of Dox was 12.6% in 24h in the absence of MDR1 mRNA, significantly lower than in the presence of the MDR1 mRNA target sequence. The rate of Dox release at the same time point increases with increasing concentration of the MDR1 mRNA target sequence. After 24h incubation with 4. Mu.M MDR1 mRNA target sequence, the Dox release rate reached 83.2%. These data indicate that nanocarriers are capable of releasing the carried drug Dox in response to MDR1 mRNA target sequence, the release rate of Dox increasing with increasing concentration of MDR1 mRNA target sequence, consistent with the design principles.
Cell fluorescence imaging study
To verify the feasibility of MSN-AD-MBs for intracellular MDR1 mRNA imaging, two groups of cell lines with significantly different MDR1 mRNA expression levels were selected for fluorescence imaging experiments, namely HepG2 cells (human liver cancer cell line) and HepG2/ADR cells (human Dox-resistant liver cancer cell line), MCF-7 cells (human breast cancer cell) and MCF-7/ADR cells (human Dox-resistant breast cancer cell line), respectively. First, the present example examined the relative expression levels of MDR1 mRNA in two groups of cells by qRT-PCR. As shown in FIG. 7, the qRT-PCR results showed that the relative expression level of MDR1 mRNA in the drug-resistant cell lines HepG2/ADR cells and MCF-7/ADR cells was significantly higher than that in the non-drug-resistant cell lines HepG2 cells and MCF-7 cells, consistent with the literature report.
Then, this example examined the use of nanocarriers for imaging intracellular MDR1 mRNA using fluorescence imaging. As shown in FIG. 8, after 4h incubation with MSN-AD-MBs, drug-resistant cells HepG2/ADR cells and MCF-7/ADR cells showed strong FAM fluorescence signals under Confocal Laser Scanning Microscopy (CLSM) significantly higher than non-drug-resistant cell lines HepG2 cells and MCF-7 cells treated in the same manner. The fluorescence imaging results are consistent with qRT-PCR detection results, which show that MSN-AD-MBs can image MDR1 mRNA in living cells and can be used for distinguishing drug-resistant cancer cells from non-drug-resistant cancer cells. The reason is that after the nanocarrier is taken up by the cell, MB is detached from the nanocarrier under the action of MDR1 mRNA, and fluorescence is restored away from the quenching group, thereby indicating MDR1 mRNA.
As mentioned in the introduction, over-expression of P-gp in drug-resistant cancer cells is one of the major obstacles leading to insufficient accumulation of intracellular drugs. In theory, after uptake of Dox@MSN-AD-MBs by drug-resistant cancer cells, the expression level of P-gp in the cells is down-regulated due to the silencing effect of MB on MDR1 mRNA, which can reduce the efflux of Dox and increase the accumulation of Dox in the cells. To demonstrate this, the present example examined the accumulation of Dox in drug resistant cancer cells incubated with medium containing free Dox and dox@msn-AD-MBs by fluorescence imaging experiments and compared to blank cells without Dox. As shown in fig. 9, no fluorescence of Dox was observed in the control cells, indicating that the cells themselves did not produce interfering signals. Dox fluorescent signals in Dox@MSN-AD-MBs treated HepG2/ADR cells (FIG. 9A) are significantly stronger than those of free Dox treated HepG2/ADR cells at the same concentration, indicating that drug-loaded nanocarriers can effectively enhance the accumulation of Dox in drug-resistant cancer cells, consistent with experimental principles. Similarly, dox@MSN-AD-MBs treated MCF-7/ADR cells (FIG. 9B) were significantly stronger than free Dox treated MCF-7/ADR cells at the same concentration, further demonstrating the conclusion. The above results indicate that nanocarriers have potential applications in improving drug delivery efficiency.
MDR1mRNA silencing investigation
Studies have shown that antisense oligonucleotides can silence the expression of the corresponding mRNA by hybridizing to the mRNA, inhibiting the translation process, provided that they are efficiently delivered into the cell. The nanocarriers presented in the present invention incorporate MBs comprising an antisense sequence to MDR1mRNA, therefore, this example assumes that the nanocarriers can be used to silence MDR1mRNA and down-regulate P-gp expression. To verify this, the relative expression levels of MDR1mRNA and P-gp in HepG2/ADR cells and MCF-7/ADR cells before and after MSN-AD-MBs treatment were determined by qRT-PCR and Western blot, respectively. As shown in FIGS. 10A and 10B, after 48h incubation with MSN-AD-MBs, the relative expression level of MDR1mRNA in HepG2/ADR cells and MCF-7/ADR cells was decreased, and the decrease degree was enhanced with increasing MSN-AD-MBs concentration, showing a concentration-dependent relationship. Western blot experiments showed that after 48h incubation with MSN-AD-MBs, the expression level of P-gp in HepG2/ADR cells and MCF-7/ADR cells also decreased, and the degree of decrease also increased with increasing MSN-AD-MBs concentration (FIGS. 10C and 10D). The qRT-PCR and Western blot experiment results show that MSN-AD-MBs can effectively silence MDR1mRNA in drug-resistant cancer cells and correspondingly down regulate the expression level of P-gp, and the nano-carrier has application potential in the aspect of drug resistance of anti-cancer cells according to hypothesis.
Cytotoxicity of cells
To examine the ability of Dox@MSN-AD-MBs to resist drug resistance and enhance the inhibition efficacy of cancer cells, the present example measured the survival rates of HepG2/ADR cells and MCF-7/ADR cells treated under different conditions by MTT method to examine the cytotoxicity of nanocarriers to drug-resistant cells. On the basis of this, the present example calculates the half-maximal inhibitory concentration of Dox (Half maximal inhibitory concentration, IC 50 ) To evaluate the efficacy of Dox in inhibiting drug-resistant cancer cells in different delivery modes. First, the cell viability of HepG2/ADR cells and MCF-7/ADR cells after 24h incubation with different concentrations of MSN-AD-MBs, free Dox and Dox@MSN-AD-MBs was determined in this example (FIGS. 11A and 11B).Wherein, the survival rate of the HepG2/ADR cells and the MCF-7/ADR cells treated by the MSN-AD-MBs is higher than 90%, which indicates that the nano-carrier has good safety. At the same Dox concentration, the cell viability of both Dox@MSN-AD-MBs treated HepG2/ADR cells and MCF-7/ADR cells was significantly lower than that of the same concentration of free Dox treated allogeneic cells. At a Dox concentration of 1.5. Mu.M and 5.0. Mu.M, respectively, the cell viability of the Dox@MSN-AD-MBs treated HepG2/ADR cells and MCF-7/ADR cells was 40.6% and 73.1% lower than that of the free Dox treated HepG2/ADR cells and MCF-7/ADR cells, respectively. Calculated, dox@MSN-AD-MBs and free Dox versus HepG2/ADR cells IC 50 IC for MCF-7/ADR cells at 0.47. Mu.M and 1.2. Mu.M, respectively 50 The values were 2.9. Mu.M and 2. Mu.M, respectively>5.0. Mu.M. The results show that the Dox@MSN-AD-MBs show higher inhibition efficacy on HepG2/ADR cells and MCF-7/ADR cells under the same Dox concentration, which indicates that the nanocarriers can effectively enhance the inhibition efficacy of the drug on drug-resistant cancer cells. The reason why the nano-carrier enhances the efficacy of the drug for inhibiting the drug-resistant cancer cells is that the nano-carrier down regulates the expression level of P-gp by silencing MDR1mRNA, thereby reducing the efflux effect of the drug-resistant cancer cells on the Dox and increasing the concentration of the Dox in the cells.
Finally, to further verify the effect of MB containing the MDR1mRNA antisense sequence against drug-resistant cancers, this example designed ctrl MB containing 8 MDR1mRNA mismatched bases as a control, and measured the cell viability of HepG2/ADR cells and MCF-7/ADR cells incubated with medium containing free Dox, dox@MSN-AD-ctrl MBs and Dox@MSN-AD-MBs (Dox concentrations for HepG2/ADR cells and MCF-7/ADR cells of 1.3. Mu.M and 4.0. Mu.M, respectively). As shown in FIG. 11C, the Dox@MSN-AD-MBs treated HepG2/ADR cells showed significantly lower cell viability than the free Dox treated and Dox@MSN-AD-ctrl MBs treated HepG2/ADR cells at the same concentration, indicating that the nanocarriers were resistant to drug resistance only when MB containing the MDR1mRNA antisense sequence was present, enhancing the cancer cell inhibition efficacy of the chemotherapeutic drug. Interestingly, the cell viability of the Dox@MSN-AD-ctrl MBs treated HepG2/ADR cells was higher than that of the free Dox treated HepG2/ADR cells, probably because the Dox@MSN-AD-ctrl MBs did not have the effect of silencing MDR1mRNA not only against drug resistance, but also prevented drug release from the nanocarriers, further reducing the intracellular concentration of Dox. Similar results were also found in MCF-7/ADR cells under the same treatment conditions (FIG. 11D), again demonstrating that the vector inhibits resistance and enhances drug inhibition efficacy only when MB containing the MDR1mRNA antisense sequence is present. The cytotoxicity test results prove that MB containing MDR1mRNA antisense sequence is necessary for inhibiting drug resistance, and the design principle is consistent.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> university of Shandong
<120> a molecular beacon modified nanocarrier and application thereof in preparing anti-tumor products
<130> 2010
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213> artificial sequence
<400> 1
cgcgaggtcg ggatggatct tgaa 24
<210> 2
<211> 38
<212> DNA
<213> artificial sequence
<400> 2
aggtcggtaa gcttcaagat ccatcccgac ctcgcgaa 38
<210> 3
<211> 48
<212> DNA
<213> artificial sequence
<400> 3
tgattaggtc gataagctac aggaggctac atgacctcgc gaatgatt 48
<210> 4
<211> 11
<212> DNA
<213> artificial sequence
<400> 4
aatcattcgc g 11
<210> 5
<211> 21
<212> DNA
<213> artificial sequence
<400> 5
taatgcgaca ggagataggc t 21
<210> 6
<211> 25
<212> DNA
<213> artificial sequence
<400> 6
ccacgtgtaa atcctactat aaacc 25
<210> 7
<211> 21
<212> DNA
<213> artificial sequence
<400> 7
tgggtgtgaa ccatgagaag t 21
<210> 8
<211> 21
<212> DNA
<213> artificial sequence
<400> 8
tgagtccttc cacgatacca a 21

Claims (12)

1. The molecular beacon modified nano-carrier is characterized in that the main body of the nano-carrier is a porous carrier, a chemotherapeutic drug is loaded in the porous carrier, and the surface of the porous carrier is modified with a molecular beacon and a hybridization chain of anchored DNA; the molecular beacon is used for plugging the through holes on the surface of the porous carrier, and the anchored DNA is fixed on the surface of the porous carrier through chemical bonds;
the porous carrier is mesoporous silicon nano particles, and is a hollow sphere with through holes on the surface, the chemotherapeutic drugs are loaded in the cavity of the hollow sphere, the particle size of the hollow sphere is 120-150 nm, and the size of the through holes is 2-3 nm;
The chemotherapeutic drug is doxorubicin;
in the mesoporous silicon nano-carrier loaded with the doxorubicin, the doxorubicin is loaded into a cavity of the mesoporous silicon nano-particle through diffusion;
the molecular beacon MDR1 mRNA has higher affinity and can silence MDR1 mRNA in drug-resistant tumor cells;
the 5 'end of the anchored DNA is connected to the surface of the nano-carrier through a chemical bond, and the 3' end is marked with a quenching group;
the chemical bond is an amide bond, the 5' end of the anchored DNA is provided with amino modification, and the anchored DNA is connected with the carboxyl on the surface of the nano-carrier through amide condensation; the 5' end of the molecular beacon is provided with a fluorescent group mark;
the quenching group is BHQ-1, and the fluorescent group is FAM;
the sequence of the molecular beacon is as follows:
FAM-AGGTCGGTAAGCTTCAAGATCCATCCCGACCTCGCGAATGATTAG GTCGATAAGCTACAGGAGGCTACATGACCTCGCGAATGATT；
the sequence of the anchor DNA is as follows:
H 2 N-AATCATTCGCG-BHQ1。
2. the molecular beacon modified nano-carrier of claim 1, wherein the mesoporous silica nanoparticles are synthesized by a sol-gel method, and the method comprises the following steps: slowly adding the aqueous solution of hexadecyl trimethyl ammonium bromide into alkali liquor, heating to 75-85 ℃, slowly adding tetraethoxysilane, and maintaining the temperature of 75-85 ℃ for reaction for 0.5-3 h to obtain white precipitate, namely the mesoporous silicon nano particles.
3. The molecular beacon modified nanocarrier of any of claims 1-2, wherein the molecular beacon modified nanocarrier is prepared by a method comprising: mesoporous synthesis by sol-gel methodSilicon nano particles, amino groups are connected on the surfaces of the mesoporous silicon nano particles to obtain aminated silicon dioxide, and MSN-NH is prepared 2 Carboxylation is carried out to obtain carboxylated mesoporous silicon nano particles; modifying the aminated anchoring DNA on the surface of the MSN-COOH through an amide condensation reaction to generate an anchoring DNA modified MSN; dissolving Dox in a buffer solution, adding MSN-AD and stirring the reaction in a dark environment to load the drug; and continuing to add molecular beacons into the buffer solution of the MSN-AD after drug loading to react to finish hybridization, thus obtaining the molecular marker modified nano-carrier.
4. The molecular beacon modified nanocarrier of claim 3, wherein in the preparation method, the amino groups are attached to the surface of the mesoporous silicon nanoparticle in the following manner: adding 3-aminopropyl triethoxysilane into toluene solution of MSN, heating to 110-120 ℃ for reaction for 1-3 h to obtain a solid part, washing the solid part, dispersing the solid part into methanol solution of hydrochloric acid, and refluxing for 14-18 h to obtain MSN-NH 2 ；
In the preparation method, the para-MSN-NH 2 The carboxylation is carried out in the following manner: MSN-NH 2 Adding the mixture with succinic anhydride into N, N-dimethylformamide, and reacting for 7-9 hours at room temperature to obtain MSN-COOH;
in the preparation method, the MSN-AD is prepared by the following steps: adding 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide and N-hydroxysulfosuccinimide into the suspension of MSN-COOH, reacting for 12-17 min, and activating carboxyl; adding PBS and aminated anchored DNA, and continuing to react for 24 hours to generate MSN-AD;
the stirring reaction time in the dark environment is 10-14 h;
in the preparation method, molecular beacons are added into a buffer solution of MSN-AD after drug loading for reaction for 4-8 hours.
5. Use of the molecular beacon modified nanocarriers of any of claims 1-4 in the preparation of an anti-tumor product.
6. The use of molecular beacon modified nanocarriers of claim 5 as an anti-tumor active ingredient, wherein the anti-tumor product is an anti-tumor active ingredient.
7. The use of molecular beacon modified nanocarriers of claim 5 as an anti-tumor active ingredient, wherein the anti-tumor product is an anti-tumor drug.
8. The use of molecular beacon modified nanocarriers of claim 5 as an anti-tumor active ingredient, wherein the anti-tumor product is a medical device for use in an anti-tumor therapeutic procedure.
9. A pharmaceutical composition comprising the molecular beacon modified nanocarrier of any of claims 1-4.
10. Pharmaceutical composition according to claim 9, wherein the pharmaceutical composition comprises other active ingredients and/or pharmaceutically necessary excipients.
11. The pharmaceutical composition of claim 10,
the other active ingredients include, but are not limited to, one or more of antitumor drugs, anti-inflammatory drugs, immunomodulating drugs, analgesic drugs, hemostatic drugs.
12. A drug-resistant tumor therapeutic agent, characterized in that the molecular beacon-modified nanocarrier of any one of claims 1 to 4 is used as an active ingredient in the drug.
CN202210198408.9A 2022-03-01 2022-03-01 Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products Active CN114569731B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210198408.9A CN114569731B (en) 2022-03-01 2022-03-01 Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210198408.9A CN114569731B (en) 2022-03-01 2022-03-01 Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products

Publications (2)

Publication Number Publication Date
CN114569731A CN114569731A (en) 2022-06-03
CN114569731B true CN114569731B (en) 2023-05-05

Family

ID=81771116

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210198408.9A Active CN114569731B (en) 2022-03-01 2022-03-01 Molecular beacon modified nano-carrier and application thereof in preparation of anti-tumor products

Country Status (1)

Country Link
CN (1) CN114569731B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1637151A (en) * 2003-08-28 2005-07-13 维里德克斯有限责任公司 Colorectal cancer prognostics

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPR446701A0 (en) * 2001-04-18 2001-05-17 Gene Stream Pty Ltd Transgenic mammals for pharmacological and toxicological studies
CN105112540B (en) * 2015-09-17 2019-03-05 山东大学 A kind of active method of detection dnmt rna based on strand displacement amplification and DNAzyme amplification
CN105861686A (en) * 2016-05-06 2016-08-17 上海交通大学 Kit for testing clozapine application effect based on rs2032582 and application method of kit
CN112708621B (en) * 2021-01-08 2022-09-02 山东大学 Sequentially-lighted multicolor DNA tetrahedral nanoprobe SLMN and preparation method and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1637151A (en) * 2003-08-28 2005-07-13 维里德克斯有限责任公司 Colorectal cancer prognostics

Also Published As

Publication number Publication date
CN114569731A (en) 2022-06-03

Similar Documents

Publication Publication Date Title
CN101652126B (en) Multistage delivery of active agents
Rosenholm et al. Towards multifunctional, targeted drug delivery systems using mesoporous silica nanoparticles–opportunities & challenges
Kumar et al. Evaluation of neuropeptide loaded trimethyl chitosan nanoparticles for nose to brain delivery
Smith et al. Aptamer-displaying peptide amphiphile micelles as a cell-targeted delivery vehicle of peptide cargoes
Lin et al. Mesoporous silica nanoparticles for the improved anticancer efficacy of cis-platin
Fang et al. Application of mesoporous silica nanoparticles in intracellular delivery of molecules and proteins
Rabiee et al. Aptamer hybrid nanocomplexes as targeting components for antibiotic/gene delivery systems and diagnostics: a review
Wang et al. MnO2-DNAzyme-photosensitizer nanocomposite with AIE characteristic for cell imaging and photodynamic-gene therapy
Yu et al. Poly (N-isopropylacrylamide)-gated Fe3O4/SiO2 core shell nanoparticles with expanded mesoporous structures for the temperature triggered release of lysozyme
Khatami et al. Targeted delivery system using silica nanoparticles coated with chitosan and AS1411 for combination therapy of doxorubicin and antimiR-21
Xu et al. Multifunctional drug carriers comprised of mesoporous silica nanoparticles and polyamidoamine dendrimers based on layer-by-layer assembly
US20070036867A1 (en) Controlled and Sustained Gene Transfer Mediated by Thiol-Modified Polymers
Wang et al. Smart multifunctional core–shell nanospheres with drug and gene co-loaded for enhancing the therapeutic effect in a rat intracranial tumor model
Chen et al. Mesoporous silica nanoparticles capped with fluorescence-conjugated cyclodextrin for pH-activated controlled drug delivery and imaging
CN109549933A (en) A kind of nano-carrier and the preparation method and application thereof of pH response
US9051583B2 (en) Modified silica shell particles, and methods of making and using the same
Bai et al. Upconversion luminescence tracking of gene delivery via multifunctional nanocapsules
Latorre et al. Glutathione-triggered drug release from nanostructures
Wu et al. Co-delivery of antineoplastic and protein drugs by chitosan nanocapsules for a collaborative tumor treatment
CN102127586A (en) Magnetic fluorescent bifunctional nano biological probe and preparation method thereof
WO2022257855A1 (en) H-bn/mos2 nanoprobe capable of achieving targeted photothermal and chemical synergistic therapy, preparation method therefor, and application thereof
Jin et al. Pollen-like silica nanoparticles as a nanocarrier for tumor targeted and pH-responsive drug delivery
Chen et al. Bioinspired affinity DNA polymers on nanoparticles for drug sequestration and detoxification
Chen et al. A dual-targeting nanocarrier based on modified chitosan micelles for tumor imaging and therapy
Ding et al. In vitro investigation of methylene blue-bearing, electrostatically assembled aptamer–silica nanocomposites as potential photodynamic therapeutics

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant