CN114569712A - nCOVsiRNA medicine for delivering shRNA in RBD targeting manner - Google Patents

Abstract

The invention relates to an nCOVsiRNA medicament for delivering shRNA in a RBD targeting manner, and discloses a novel targeted delivery vector RBD derived from a coronavirus receptor binding domain and an anti-variant strain target shRNA derived from a coronavirus conserved gene. Synthesizing shRNA and RBD, respectively connecting the positive and negative chains of the shRNA with the N end of the RBD to form a compound which is used for delivering the shRNA in a RBD targeting manner and has the dual functions of gene medicines and macromolecular vaccines, and mutually synergizing the RBD and the shRNA to generate a plurality of new functions. Wherein the shRNA is a broad-spectrum antiviral drug and an immunologic adjuvant for the synergy of the RBD vaccine; the RBD is used as a targeting delivery carrier so as to avoid the side effect of non-targeting gene therapy, and is a common protein vaccine, the immune generated anti-RBD can neutralize virus and prevent the virus from infecting through ACE2, the compound synthesized by double RBD and shRNA increases molecular weight and structural complexity so as to enhance antigenicity, and the shRNA combined by the RBD is not easily degraded by enzyme, easily passes through a cell membrane and is easily delivered to target cytoplasm.

Description

nCOVsiRNA medicine for delivering shRNA in RBD targeting manner

Technical Field

The invention relates to an nCOVsiRNA medicament for delivering shRNA in a RBD (role-based targeting) targeting manner, belonging to the field of biopharmaceuticals for preventing and treating infectious diseases.

Background

The main structure of the novel coronavirus comprises single-stranded positive-strand nucleic acid (ssRNA), spike protein (S), membrane protein (M), envelope protein (E) and nucleocapsid protein (N), wherein the N-terminus of the S protein is composed of a structural domain (S1-NTD) and a receptor binding domain (S1-RBD), and the novel coronavirus causes infection by binding to host cell receptor ACE2 through its receptor binding domain S1-RBD.

ACE2 is a type I transmembrane glycoprotein, and comprises 805 amino acids including a transmembrane region, an intracellular carboxyl terminal and an extracellular amino terminal, wherein coronavirus is interactively combined with an extracellular catalytic domain of ACE2 through S1-RBD, so that endocytosis and membrane fusion are caused, and the virus enters cells expressing ACE2 or containing ACE2 receptors.

Because the new coronavirus is infected by combining the RBD with ACE2, the existing vaccine is basically developed aiming at the RBD, a plurality of vaccines are used clinically, and medicines such as Redesivir, Locinavir, ritonavir, chloroquine, hydroxychloroquine, hormones, interferon and the like are tried in all countries, although certain effects are achieved, the specific medicines are still lacked at present especially aiming at variant strains.

RNA interference (RNAi), as a highly efficient sequence-specific gene silencing technique, is bringing an unthinkable prospect to disease treatment, and various siRNA drugs have been approved by FDA and are on the market. Small interfering RNA (siRNA) of about 21-23 bp regulates gene expression in a manner of participating in RNA interference (RNAi), specifically degrades target messenger RNA (mRNA) complementary thereto, but at the cellular level and in vivo, gene interference using siRNA overcomes many difficulties: 1) membrane permeability: siRNA has a large amount of negative charges and a large molecular weight (13 KD), and is difficult to pass through cell membranes by itself, and siRNA is transported mainly by chemical modification and some transport carriers; 2) resistance to nuclease degradation: siRNA is composed of a large number of ribonucleic acid molecules, and is easily degraded by external RNA enzyme, if specific chemical modification is not carried out on basic groups or a carrier protection method is adopted when siRNA is designed and a transport carrier is selected, the siRNA is degraded by the RNA enzyme before entering an action site; 3) targeted delivery and vectors: the action site of siRNA is mainly in target cytoplasm, so siRNA is required to be specifically delivered to the target cytoplasm, if a proper targeted delivery carrier cannot be effectively selected and siRNA is released from an endosome to the cytoplasm in time, cellular immune response can be usually activated, and cytokine such as interferon is released, so how to effectively transport and release siRNA to the target cytoplasm is a bottleneck problem influencing RNAi effect, and some siRNA can cause sequence or concentration-dependent nonspecific gene silencing, namely off-target, therefore, when siRNA is designed, targeted delivery, gene inhibition effect and sequence with low off-target effect as far as possible are simultaneously considered.

In the prevention and treatment of COVID-19, if the nCoVsiRNA can be stably and specifically delivered to a target organ, a target tissue, a target cell, positioned in the target cell, crossed a target cell membrane, released to a target cell pulp in sequence by using a proper targeting delivery vector, and has broad-spectrum effect on various variant strains, the COVID-19 targeted gene therapy can be better developed.

Therefore, the invention aims to design and synthesize the nCOVsiRNA drug for RBD targeted delivery of shRNA.

Disclosure of Invention

The invention aims to provide an nCOVsiRNA medicament for delivering shRNA in an RBD targeting manner, and synthesis and application thereof; in nCOVsiRNA drugs, shRNA has dual functions of targeted gene therapy and immune adjuvant, RBD has dual functions of targeted delivery and protein vaccine, and liposome has functions of stabilizing shRNA, cell transfection and immune adjuvant.

The purpose of the invention is implemented by the following technical scheme:

screening for consensus genes: screening out common genes which are not changed along with virus variation from various pathogenic coronavirus recorded in a database and variant strains thereof, wherein the common genes comprise conserved genes, super-conserved genes and/or conserved microsatellites.

Screening siRNA: and (3) pre-selecting a plurality of pairs of siRNA taking the common gene as an interference target from the common gene, so that the siRNA comprises a conserved gene, a super-conserved gene and/or a conserved microsatellite.

Synthesizing siRNA: synthesizing 2 complementary 21-25nt oligonucleotide siRNA and base sequence with spacing function.

Synthesizing shRNA: and further synthesizing the synthesized 2 complementary oligonucleotide polypeptide siRNAs and the base sequences with the spacing function into small hairpin shRNA double chains which are spaced into loop loops by the intermediate base sequences.

Preferred siRNA: and constructing an interference vector by the synthesized shRNA, detecting mRNA expression, protein expression and interference effect of the shRNA, and preferably selecting the siRNA with high silencing efficiency through siRNA design, synthesis, screening, iterative design and verification.

Synthesis of preferred sirnas and shrnas: the synthesis of siRNA, shRNA as described above using preferred siRNA sequences includes chemical modifications to increase stability and avoid off-target.

Synthesis of RBD polypeptide or protein: amino acid sequences located at, but not limited to, 319-510 of the coronavirus S protein, conserved amino acid sequences located at, but not limited to, N439, V483 and Q493, and codon-optimized amino acid sequences were synthesized.

Synthesis of the Compounds: connecting the synthesized shRNA and RBD by using a coupling method such as a disulfide bond, a phosphodiester bond, a dithiophosphate bond, a thioether bond, an oxime bond, an amido bond or a maleimide-sulfhydryl bond and the like to synthesize a compound; or synthesizing the RBD-shRNA-RBD according to the nucleotide sequence of the shRNA and the amino acid sequence of the RBD.

Purification of the compound: purifying the compound by high performance liquid chromatography, reverse high performance liquid chromatography or ion exchange chromatography.

Liposome modification of compounds: preparing a liposome modified compound by adsorbing the liposome with positive charges through the shRNA with negative charges; preparing a PEG internalized liposome modified compound by sulfhydrylation of RBD amino to enable sulfhydryl and maleimide of liposome to form a maleimide-sulfhydryl bond; preparing a liposome-modified compound by forming a urethane bond between the amino terminus of the RBD and a liposome; liposome-modified compounds are prepared by attaching liposome-modified sirnas to RBD or RBD fragments.

Verification of the compound: detecting the antiviral effect of the compound on 2 or more different variant strains at an in vitro cell level, and observing whether the compound has the effect of broad-spectrum anti-variant strains by taking a conserved gene as a target; and (3) detecting whether the compound has RNAi effect of target delivery of shRNA, immune effect of the vaccine and immune enhancement effect in animals.

The invention has the beneficial effects that:

the novel targeted delivery vector RBD derived from a coronavirus receptor binding domain and the broad-spectrum anti-variant strain target shRNA derived from a coronavirus conserved gene are found for the first time, and the RBD and the shRNA are synthesized into a compound for delivering the shRNA in a RBD targeted mode; the synthesized compound enables RBD and shRNA to mutually synergize, and further generates a plurality of new functions.

The siRNA is screened from the coronavirus conservative gene, the super-conservative gene and/or the conservative microsatellite gene which are not or hardly varied with the virus variation, and the shRNA synthesized by the siRNA interferes with a target by the conservative gene which is not varied with the virus variation, so that the siRNA has the targeted gene therapy effect of broad-spectrum anti-variant strains.

Because the main components of the immunologic adjuvant are oligonucleotide and lipid, the siRNA or shRNA which is oligonucleotide in nature has the new application of the immunologic adjuvant for enhancing the immunologic effect of the RBD vaccine.

According to the invention, an RBD and shRNA are connected into a compound according to the special relationship between a ligand RBD and a receptor ACE2, so that the RBD generates a new function of targeted delivery of the shRNA, and the side effect of non-specific delivery of the siRNA/shRNA can be avoided.

The oligonucleotide siRNA or shRNA is negatively charged, fat-soluble, not easy to pass through cell membranes and is easily degraded by nuclease, so that the oligonucleotide is difficult to deliver to target cytoplasm for RNAi.

The protein vaccine is a single RBD molecule generally, the invention synthesizes the compound by 2RBD molecules and 1 shRNA molecule, wherein the molecular weight of the RBD and the shRNA is increased by more than 1 time than that of the original single RBD, the molecular structure is more complex, and therefore, the synthesized compound has the effect of enhancing the antigenicity of the RBD protein.

Besides the functions of slowly releasing shRNA in vivo, prolonging the drug effect, endocytosis into plasma and the like, the liposome can also be used as an immunologic adjuvant to enhance the immunologic effect of RBD protein.

In vitro cell experiments show that the synthesized compound is effective to 2 different variant strains at the same time, which shows that the compound has the function of anti-variant strains by taking a conserved gene as a target; in vivo animal experiments show that the synthesized compound has targeted delivery RNAi effect, vaccine immunity effect and immunity enhancement effect in animal bodies.

Drawings

FIG. 1 is a schematic diagram of the technology for preparing nCoVsiRNA drugs according to the invention.

FIG. 2 is a schematic diagram of the synthesis and use of the present invention.

FIG. 3 is a schematic of a compound synthesized according to the present invention.

Figure 4 is a schematic representation of liposome-modified siRNA of the present invention.

FIG. 5 is a schematic representation of a liposome-modified shRNA of the present invention.

In fig. 1, the ncovisirnas drug targeted for delivery by RBD is finally synthesized by conservative gene screening, broad-spectrum anti-variant strain target siRNA screening with the conservative gene as a target, shRNA synthesis, RBD synthesis.

In fig. 2, 1 is siRNA targeting coronavirus conserved genes as interference targets; 2 is the sense strand of the small hairpin shRNA, which is formed by annealing 2 complementary siRNAs; 3 is a loop formed by spacing base sequences of a spacing positive antisense strand in shRNA; 4 are 2RBD polypeptides which are respectively connected with the positive and negative sense chains of shRNA through N amino groups; 5 is a target cell expressing ACE2 receptor 6, virus 10 enters target cell 5 by binding the C-terminus of its RBD to the extra-cellular N-terminus of ACE2 receptor 6; the RBD of the shRNA is delivered in a RBD targeting manner, the RBD is the same as that of the virus 10, the C end of the RBD4 is combined with the N end outside the cell membrane of the ACE2 receptor 6, the shRNA2 is delivered in a targeting manner to a target cell 5 expressing the ACE2 receptor 6, and the target cell 5 is easy to infect the virus 10 due to the fact that the target cell 5 contains the ACE2 receptor 6; further as shown for target cell 9, its intracellular 7 and 8 represent shRNA and RBD, respectively, that were delivered by targeting of RBD4 and entered the target cytosol through ACE2 receptor 6; then, as shown in the target cell 16, as the shRNA7 shown in the target cell 9 is degraded into the shRNA15 shown in the target cell 16, the viruses 10 and 11 with long-chain RNA are also degraded into small-fragment RNA sequences 14 and inactivated, and the RBD8 originally linked to the shRNA7 is also dissociated into RBD12, thereby stimulating the host to produce the anti-RBD 12 antibody 13.

In FIG. 3, 1 is a loop, 2 is a shRNA formed by two complementary sense and antisense strands, and 3 is two RBD polypeptides (proteins) respectively linked to the sense and antisense strands of the shRNA. The shRNA is protected by the RBD and targeted by the RBD for delivery to ACE2 receptor, and then degrades viral target genes as the RBD passes through ACE2 receptor specifically into the target cytoplasm.

In fig. 4, 1 is siRNA encapsulated by liposome, 2 is liposome layer, 3 is PEG layer, and 4 is RBD. Wherein, the siRNA has RNAi function, the liposome has the functions of protecting the siRNA and causing endocytosis of cells, the PEG enables the siRNA to be slowly released and circulated for a long time, and the RBD has double functions of targeted delivery of the siRNA and the vaccine.

In FIG. 5, 1 is a loop, 2 is a shRNA formed by two complementary sense and antisense strands, and 3 is two RBD polypeptides (proteins) respectively linked to the sense and antisense strands of the shRNA. Liposome layer 4, PEG layer 5, shRNA2 encapsulated by liposome 4. The shRNA plays a role in RNAi, the liposome plays a role in protecting the shRNA and causing endocytosis of cells, the PEG enables the shRNA to be slowly released and to be circulated in a long-acting mode, and the RBD plays a dual role in targeted delivery and vaccine.

Detailed Description

The following detailed description of the embodiments of the present invention with reference to fig. 1, 2,3, 4 and 5 is given by way of example only and should not be taken as limiting the scope of the invention, which is defined by the appended claims.

Design of siRNA targeting at super-conservative gene, conservative gene or conservative microsatellite

1. Design of super-conservative gene, conservative gene and conservative microsatellite

As shown in a technical scheme 1, a whole genome (cDNA) sequence of a beta coronavirus (particularly a novel coronavirus and a variant strain thereof) is downloaded from a Genbank database (http:// www.NCBI.nlm.nih.gov/genome /), and the longest public subsequence is searched in the whole genome sequence to obtain a super-conserved gene or a conserved gene; carrying out sequence comparison on the whole genome downloaded from a Genbank database by using Clustal W software, detecting the similarity between different sequences, and screening a conserved microsatellite sequence; and (3) constructing an amino acid germ-line molecular evolutionary tree for the downloaded coronavirus amino acid sequences by using MEGA6.0 molecular evolution genetic analysis software and an adjacency method (N-J), analyzing the molecular variation characteristics of the amino acid sequences and deducing conserved gene sequences.

The following 3 segments of longest and next-longest super-conserved subsequences (identical subsequences without insertion or deletion) are found, and the length of the super-conserved subsequences is 22-30 bp and is equivalent to the length of small RNA, but the 3 segments of subsequences are not contained in higher organisms, particularly human beings.

The specific sequence is as follows:

SEQ ID NO.1(Subsequence 1)＝ttaatacgacctctctgttggattttgaca(30bp)；

SEQ ID NO.2(Subsequence 2)＝ggttcgcaacttcacaca gagt(22bp)；

SEQ ID NO.3(Subsequence 3)＝caggcgtttgttggttgattaa(22bp)。

the following 3 segments of the longest and the next longest conserved subsequences are found, the length of the 3 segments of the conserved subsequences is 22-30 bp, and is equivalent to the length of small RNA, but the 3 segments of the conserved subsequences are not contained in higher organisms, particularly human beings:

SEQ ID NO.4(Subsequence 1)＝gttttacgacaacgatgttggtttaggaca(30bp)；

SEQ ID NO.5(Subsequence 2)＝ggttcggttgttatatacgata(22bp)；

SEQ ID NO.6(Subsequence 3)＝ggttcagagagtctcctattta(22bp)。

the following 5 conservative microsatellite loci repeated for many times by nucleotide are found, wherein the microsatellites are CTCTCTCT, AGAGAG, AAAAAAAAA, TATATA and CACACACA respectively.

2. General design of siRNA and alignment between common variants thereof

Based on the complete genomic (cDNA) sequences of the genus beta coronavirus (particularly the novel coronavirus and its variant strains) downloaded from the Genbank database (http:// www.NCBI.nlm.nih.gov/genome /) as described above, a number of siRNA candidate sequences having a length of about 19nt were obtained using the shRNA on-line design software (http:// www.ambion.com/techlib/misc/sirnatools. html) from Ambion, and siRNAs were preferred based on the Tm values of RNA binding and the results of specific alignment. For example, according to the present application, the candidate sirnas shown in tables 1-5 are preferably selected from E, M, N, ORF1ab and S genes of NC _045512.2 strain, DELTA variant strain and OMICRON variant strain, wherein the sequences in the table with the bold ital are common siRNA sequences of three strains (such as SEQ ID nos. 9-11 in table 1), that is, although NC _045512.2 strain is variant to DELTA strain and OMICRON strain, conserved sequences (sirnas) which are still unchanged in each strain and theoretically have a targeting interference effect, if the siRNA sequences are targeted to interfere with, the corresponding variant strains can be killed in a broad spectrum.

TABLE 1 siRNA candidate sequences of E genes of novel coronavirus NC-045512.2 strain, DELTA strain and OMICRON strain

TABLE 2 siRNA candidate sequences of M genes of novel coronavirus strains NC _045512.2, DELTA and OMICRON strains

TABLE 3 siRNA candidate sequences of N genes of novel coronavirus strains NC-045512.2, DELTA and OMICRON strains

TABLE 4 siRNA candidate sequences of ORF1ab genes of novel coronavirus NC-045512.2 strain, DELTA strain and OMICRON strain

TABLE 5 siRNA candidate sequences of the S genes of novel coronavirus strains NC-045512.2, DELTA and OMICRON strains

3. Screening siRNA targeting a super-conserved gene, a conserved gene or a conserved microsatellite

And comparing the gene sequences of the designed super-conserved gene, the conserved gene and the conserved microsatellite with the siRNA conventionally screened by utilizing Clustal W software or other software, detecting the similarity between different sequences, and designing a plurality of pairs of siRNA (siRNA with the super-conserved gene, the conserved gene or the conserved microsatellite as a target) which are not only the super-conserved gene, the conserved gene or the conserved microsatellite but also RNAi target sites.

(1) siRNAs targeting the super-conserved genes and conserved microsatellites (S1/S2):

SEQ ID NO.1(Subsequence 1)＝ttaatacgacctctctgttggattttgaca(30bp)；

SEQ ID NO.2(Subsequence 2)＝ggttcgcaacttcacaca gagt(22bp)；

(2) siRNAs targeting conserved genes and conserved microsatellites (S3/S4):

SEQ ID NO.5(Subsequence 3)＝ggttcggttgttatatacgata(22bp)；

SEQ ID NO.6(Subsequence 4)＝ggttcagagagtctcctattta(22bp)。

through the design, the siRNA of the theoretical anti-coronavirus variant strain which takes the super-conservative gene, the conservative gene or the conservative microsatellite as an interference target is obtained and named as siRNA 1/2/3/4.

Second, verifying the function of siRNA targeting at a super-conserved gene, a conserved gene or a conserved microsatellite

1. Synthesis of siRNA/shRNA

shRNA templates capable of expressing hairpin structures are designed according to the polyclonal enzyme cutting sites of the pSilencer4.1.CMV. neo interference vector, each template consists of two mostly complementary single-stranded DNAs with 55bp, and after annealing and complementation, a DNA double strand with sticky ends of BamH I and Hind III cutting sites can be formed for connection with the linearized pSilencer4.1.CMV. neo. Then, according to the designed siRNA and shRNA template, the siRNA/shRNA is synthesized by entrusted companies, and the sequence of the synthesized siRNA/shRNA is as follows:

SEQ ID NO.1(Subsequence 1)＝TTAATACGACCTCTCTGTTGGATTTTGACA(30bp)；

SEQ ID NO.2(Subsequence 2)＝GGTTCGCAACTTCACACA GAGT(22bp)；

SEQ ID NO.5(Subsequence 3)＝GGTTCGGTTGTTATATACGATA(22bp)；

SEQ ID NO.6(Subsequence 4)＝GGTTCAGAGAGTCTCCTATTTA(22bp)。

2. construction of shRNA expression vector

And respectively connecting and identifying the synthesized shRNA with a linearized interference vector pSilencer4.1.CMV. neo, constructing shRNA expression plasmid, and transforming DH5a to obtain the shRNA expression vector.

3. Effect identification of shRNA expression (interference) vector

And (3) constructing a fluorescent label vector according to the synthesized siRNA/shRNA sequence, and co-transfecting 293T cells with shRNA expression plasmids respectively to identify or amplify shRNA by PCR. The conventional method is as follows:

designing shRNA primers: referring to online primer design software, an upstream primer and a downstream primer are designed, an initial code is added to the 5 'end of the upstream primer, and a homology arm for homologous recombination with a vector is added to the 5' end of the primers in order to clone an amplification product into pEGFP-N1.

Amplification of shRNA gene: and carrying out gene amplification, product recovery and purification according to a gene amplification reaction system and reaction conditions provided by the Shanghai biological reagent kit to obtain an amplification product.

Linearization of pEGFP-N1: recovering DH5a strain containing pEGFP-N1 plasmid, extracting plasmid according to kit, determining concentration, performing enzyme digestion, identifying by 0.8% agarose gel electrophoresis and recovering linearized vector.

The amplified shRNA was ligated with a fluorescent tag vector (pEGFP-N1): ligation was performed using a homologous recombination kit from the Kingsler company and the ligation was allowed to stand at-20 ℃ for future use or immediately transformed.

And (3) identifying the effect of the shRNA interference vector: respectively co-transfecting 293T cells with an interference vector (pSilencer-shRNA1/2/3/4) and a fluorescent tag vector (pEGFP-shRNA1/2/3/4), wherein the mass ratio of the interference vector to the tag vector is 1:2, setting a control at the same time, observing the fusion expression of the GFP protein in the cells 48h after transfection, and evaluating the interference effect according to the fluorescence intensity:

flow cytometry detection: in order to quantitatively analyze the interference effect of different interference vectors, the proportion of the fluorescent protein expressing cells in the total cell number is analyzed by flow cytometry detection.

Westernbolt assay: cell collection and lysis: cells were lysed with RIPA. SDS-PAGE protein electrophoresis: SDS-PAGE gel is prepared, and a sample is added into 2xSDS buffer solution with the same volume, boiled for 5min, ice-bathed for 2min, 12000Xg and 10 min. And thirdly, detecting Western blot: and observing the result after membrane transfer, blocking, primary antibody binding, washing, secondary antibody binding and color development.

RT-PCR detection of mRNA: detecting the relative expression quantity of the gene in the transfected cell by adopting a relative fluorescence quantitative RT-PCR method, converting the copy number of the target gene and the B-actin internal reference gene by CT value according to a standard curve, correcting the relative expression quantity of virus gene mRNA (the copy number of the target gene/the copy number of the B-actin) by the B-actin internal reference gene, and quantitatively evaluating the interference effect.

4. Obtaining siRNA/shRNA with high silencing efficiency

Through the design, synthesis, screening, iterative design, synthesis and verification, the siRNA/shRNA which takes the super-conservative gene, the conservative gene or the conservative microsatellite as a target is obtained:

SEQ ID NO.1(Subsequence 1(shRNA1))＝TTAATACGACCTCTCTGTTGGATTTTGACA；

SEQ ID NO.2(Subsequence 2(shRNA2))＝GGTTCGCAACTTCACACA GAGT；

SEQ ID NO.5(Subsequence 3(shRNA3))＝GGTTCGGTTGTTATATACGATA。

thirdly, synthesizing shRNA taking super-conservative gene, conservative gene or conservative microsatellite as target

According to the shRNA1/2/3 which takes the selected super-conservative gene, the conservative gene or the conservative microsatellite as targets, the biological company is entrusted, each shRNA synthesizes 2 complementary oligonucleotide polypeptide siRNAs with the length of 19-25nt and synthesizes base sequences with the length of 9nt for playing a role of separation, then the synthesized siRNA and the base sequences are connected into small hairpin shRNA double chains with the middle base sequences separated into loop rings, and each single chain of the synthesized shRNA double chains can be respectively connected with RBD polypeptide or protein.

For example, SEQ ID NO.1(shRNA1), SEQ ID NO.2(shRNA2) and SEQ ID NO.5 (shRNA3) were synthesized into 5'-ttaatacgacctctctgttggattttgacattcaagagatgtcaaatccaacagagaggtcgtattaa-3' (SEQ ID NO.42), 5'-ggttcgcaacttcacacagagtttcaagagaactctgtgtgaagttgcgaacc-3' (SEQ ID NO.43) and 5'-ggtt cggt tgtta tatac gata TTCAAGAGA tatc gtata taaca accg aacc-3' (SEQ ID NO.44), respectively, wherein "TTCAAGAGAGAGA" is a loop, the left and right sides thereof are complementary positive and negative sense strands, respectively, and SEQ ID NO. 42-44 can synthesize shRNA1, shRNA2 and shRNA3, respectively. Similarly, a high silencing efficiency siRNA is further preferred from tables 1-5, and an shRNA is synthesized and then linked to an RBD protein or a polypeptide thereof at the 3 'and/or 5' thereof.

Design and synthesis of targeted delivery vector RBD

The synthesized RBD has dual functions of a targeting delivery carrier and a recombinant protein vaccine. Because coronaviruses cause infection by the specific binding of the RBD to the ACE2 receptor, which is a ligand-receptor relationship with ACE2, drugs can be targeted by the RBD to virally infected cells and into the cytosol. In addition, the prior art generally designs RBD protein vaccines by the characteristic that viruses are infected by combining RBD and ACE2, so that the synthesized RBD is a targeting delivery carrier and a protein vaccine.

1. Amino acid sequence and synthetic design of RBD: the gene sequence of S protein of SARS-CoV, MERS and SARS-CoV-2 is collected according to global shared avian influenza database (GISAID) and GenBank database, and amino acid phylogenetic tree analysis or sequence homology analysis is carried out to determine the conserved amino acid sequence sites N439, V483 and Q493 which can be combined with human ACE2 receptor in RBD and are not easy to be mutated. In addition, according to the characteristics that SARS CoV S protein consists of 1255 amino acids, can be enzymolyzed into an S1 receptor binding Region (RBD) and an S2 membrane fusion region, the RBD is positioned at 319 to 510 th amino acids (AA319-510) of the S protein, the RBD is combined with the N end outside the cell membrane of ACE2 through the C end, the RBD can independently enter target cells through ACE2, the removal of N-linked glycosylation of the RBD S protein does not influence the function of the RBD S protein, 3N-glycosylation residues (N331, N343 and N360) are arranged in SARS-CoV-2RBD (aa.331-550), tryptophan, histidine, ornithine, lysine and arginine which form a peptide chain have a plurality of N, and the like, the synthesis of the RBD can be designed, and the RBD is connected with liposome or shRNA.

2. Synthesis of RBD: the synthesis of polypeptides with amino acids is generally carried out by dehydration condensation of two amino acids to form a peptide bond, and linking a plurality of amino acid residues with a peptide bond to form a polypeptide. The company can be entrusted with the automated synthesis of amino acid sequences located at 319-510 of the S protein, conserved amino acid sequences located at N439, V483 and Q493 which bind to ACE2 but are not subject to variation, and codon-optimized amino acid sequences using a polypeptide synthesizer. The basic method is to add amino acids one by one according to the amino acid sequence of the polypeptide to be synthesized, to extend the peptide chain from the C-terminal to the N-terminal residue step by step, requiring that each amino acid residue be condensed in a form of one end protection and the other end activation, and after each cycle of peptide chain extension, removing the temporary protecting group on the amino group until the entire amino acid sequence of the target polypeptide is condensed. The reaction principle of the solid-phase synthesis of polypeptides commonly used at present is that amino acids are continuously added into a closed explosion-proof glass reactor from a C terminal-carboxyl terminal to an N terminal-amino terminal according to a known sequence, and a synthesis reaction is carried out to finally obtain the polypeptides. The method mainly comprises the following steps: protection: removing the protecting group of the amino group by using an alkaline solvent; activation and crosslinking: activating the carboxyl of the next amino acid to crosslink the activated monomer carboxyl with the free amino group to form a peptide bond, and repeatedly cycling the two reactions until the polypeptide synthesis is completed.

Fifthly, synthesizing compound by shRNA and RBD

The compound synthesized by shRNA and RBD is a targeted medicament and a vaccine because the shRNA is a gene therapy medicament and the RBD has the functions of a protein vaccine and targeted delivery of the shRNA.

1. Designing RBD-shRNA-RBD: as shown in FIG. 2 and FIG. 3, according to SEQ ID NO. 1-2, SEQ ID NO.5, SEQ ID NO. 7-39, SEQ ID NO. 42-44 and RBD sequence (SEQ ID NO.45), one end of sense strand and antisense strand of siRNA using virus conserved gene as an interference target is connected with loop (5 '-TTCAAGAGAGA-3'), and the other end is connected with glycosylation site connected with RBD S protein N respectively to form "RBD-siRNA sense strand-loop-siRNA antisense strand-RBD". Wherein the two complementary positive and antisense strands would form a duplex but the two polypeptide RBDs would not form a duplex, so is a hairpin-like linker shRNA with the two polypeptide RBDs and a loop. Because the RBD can be combined with a virus receptor ACE2 through the C end and enter target cell pulp through ACE2, and the combination of polypeptide and siRNA can increase the permeability, stability and interference effect of siRNA, the design enables the RBD to have the functions of targeted delivery, cell penetrating peptide, protein antigen and competitive receptor, not only can stably and effectively deliver CoVsiRNA to the target cell pulp of virus infection for targeted interference, but also can stimulate the organism to generate immune antibody as recombinant protein by itself, and can compete with virus to combine with the target cell receptor ACE2 so as to inhibit the virus infection.

2. And (3) synthesis of RBD-shRNA-RBD: according to SEQ ID NO. 42-45, the company can be entrusted with adopting a conventional synthesis method of polypeptide and oligonucleotide to couple the polypeptide and oligonucleotide into a conjugate in the forms of an oxime bond, an amido bond, a thioether bond, a disulfide bond, a phosphoryl bond, a hydrazone bond, an ureide bond, a phosphodiester bond, a dithiophosphate bond, a maleimide-sulfhydryl bond and the like, wherein the conjugate comprises a sense chain (5' end and 3' end) or an antisense chain (3' end) of the polypeptide and oligonucleotide, and the polypeptide-oligonucleotide conjugate (POCs) is synthesized by carrying out non-covalent or covalent crosslinking through a firmer covalent bond, a looser ionic bond, a hydrophobic bond or a carboxyhydrazone bond with a spacer arm. The most common method for synthesizing POCs at present is a covalent cross-linking-liquid phase fragment synthesis method, which is widely applied to synthesizing various POCs and mainly comprises the following steps: separately synthesizing the polypeptide and the oligonucleotide on a solid phase matrix, and simultaneously stripping the two synthesized products from the solid phase matrix, wherein the stripped polypeptide and oligonucleotide are coupled through a reactive group in a solution. The synthetic POCs mainly comprise: (ii) maleimide-thiol coupling: modifying maleimide on the polypeptide or oligonucleotide, modifying sulfydryl on another monomer, and then adding the two monomers into the same solution to react to obtain POCs; disulfide bond or thioether bond coupling: wherein, the thioether bond coupling comprises two types of reactions of a sulfhydryl nucleophilic substitution halogenated acetamide on a halide and a sulfhydryl Michael addition to maleimide; disulfide bond coupling can be achieved by directly oxidizing two sulfydryl groups, or activating the sulfydryl groups by an activating agent such as bipyridyl disulfide and the like, and then coupling the sulfydryl groups with another oligomer containing the sulfydryl groups, wherein a conjugate of siRNA and polypeptide is synthesized by common disulfide bonds; ③ oxime bond coupling: the method has the advantages that the method does not need various protection processes and can be completed in one step, and is used for synthesizing a peptide-oligonucleotide-peptide product, and the specific method is that aldehyde groups are introduced into 5 'and 3' of the oligonucleotide and then reacted with hydroxylamine modified polypeptide to obtain the peptide-oligonucleotide-peptide, and the obtained yield is high, and the bifunctional oligonucleotide and the polypeptide can obtain high yield under the condition of a weak acid without any protection strategy and cross-linking agent in one step; amide bond coupling: directly reacting oligomer containing activated carboxylic acid or thioester with another polymer modified with amino to obtain a product; hydrazone bond coupling: hydrazine groups are introduced to the polypeptide, then a citric acid buffer solution with the pH value of 3-5 is added, and then the reaction is carried out with the oligonucleotide modified with the acetyl aldehyde groups, so that the POCs connected by hydrazone bonds can be obtained.

3. And (3) purifying the RBD-shRNA-RBD: chromatographic methods have been one of the most commonly used methods for purifying and analyzing polypeptides and oligonucleotide conjugates. According to the complexity of the conjugate, different chromatographic methods are selected for separation, and the main methods are High Performance Liquid Chromatography (HPLC), reverse phase high performance liquid chromatography (RP-HPLC), ion exchange chromatography (IEC, usually anion exchange chromatography), or two or more of the methods are used in series according to operation instructions.

Through the screening and synthesis of the shRNA and the synthesis of the compound and the RBD, the corresponding compound RBD-shRNA1/2/3-RBD of SEQ ID NO. 42-45 is obtained, including but not limited to RBD-shRNA1-RBD, RBD-shRNA2-RBD, RBD-shRNA3-RBD, RBD-siRNA and S-siRNA.

Modification of liposome of compound

As shown in fig. 4 to 5, liposome (Lip) modification for stable transport of shRNA includes methods of adsorbing a positively charged liposome with a negatively charged shRNA, forming a thiol-maleimide bond between a thiol group and a liposome by thiolation of an RBD amino group, or forming a urethane bond between an RBD amino terminal and a liposome. For example, the extract is encapsulated by liposome DOTAP/Chol, DC-Chol/DOPE or Lip to obtain RBD-shRNA1/Lip-RBD, RBD-shRNA2/Lip-RBD, RBD-shRNA3/Lip-RBD (abbreviated as RBD respectively)₂-shRNA1/Lip、RBD₂shRNA2/Lip and RBD₂shRNA3/Lip), RBD-siRNA/Lip and S-siRNA/Lip.

Example 1: preparation of liposome modified compound from liposome DOTAP/Chol

(1) Synthesis of RBD-shRNA-RBD

The RBD-shRNA-RBD compound synthesized by shRNA and RBD in the application is adopted.

(2) Preparation of lipid solution

DOTAP (MW 698.5): 10mg/ml, DOTAP [ N- (2, 3-dioleoyloxy-1-propyl) trimethylammoniumsulphonate was weighed accurately: 100mg of N-1- (2,3-di-oleoyloxy) propyl) -N, N, N-trimeth ylammoniethyl sulfate powder was put in a 10ml volumetric flask and chloroform solution was added to the marked line.

Chol (MW ═ 386): 5mg/ml, Chol [ cholesterol: cholesterol powder 50mg, was added to a 10ml volumetric flask and chloroform solution was added to the mark.

m-PEG₂₀₀₀-DSPE (MW 2787): 10mg/ml, m-PEG is weighed₂₀₀₀10mg of DSPE (methoxylated polyethylene glycol distearoylphosphatidylethanolamine: Methoxy-polyethylene glycol-distearoylphosphatidylethanolamine) powder was added to one ml of DEPC water, and after vortexing, sonication was carried out for 1min to completely dissolve the DSPE powder.

Mal-PEG₂₀₀₀-DSPE (MW 2941.6): 10mg/ml, and accurately weighing Mal-PEG2000-DSPE (Maleimide derivitized polyethylene)Ethylene glycol-distaroyl phosphatyl-ethanolamine: maleimidoylated polyethylene glycol distearoyl phosphatidyl ethanolamine) powder 10mg, 1ml of DEPC water was added, and after vortexing, sonication was performed for 1min to dissolve.

(3) Preparation of Liposome DOTAP/Chol (thin film hydration method)

The liposome DOTAP/Chol is prepared by a thin-film hydration method (Lipid-film method), the Lipid concentration is 10mM, and the main steps are as follows: according to the preparation of 1ml liposome DOTAP/Chol, chloroform solution of two lipids DOTAP and Chol is respectively taken, and the ratio of DOTAP: chol ═ 1: adding 1 (M: M) into a 500ml Erlenmeyer flask, and adding 3-4 ml of chloroform solution; vacuum rotary evaporation is carried out for 45-60 min at 37 ℃ to form a uniform lipid film, and trace chloroform is blown out by high-purity nitrogen; adding 1ml DEPC water, shaking, and washing lipid film from bottle wall to obtain lipid suspension; after the liposome is fully hydrated, ultrasonic lmin is sequentially extruded by polycarbonate membranes of 400 nm, 200nm, 80nm and 50nm for 10-20 times respectively to obtain the liposome DOTAP/Chol.

(4) Sulfhydrylation of RBD-shRNA-RBD

2-IT (Traut' S reagent) is a common reagent for protein sulfhydrylation, which can be performed at the site of N-linked glycosylation of RBD S protein, as follows: taking RBD-shRNA-RBD and 2-IT (Traut' S reagent, 2-iminothiolane-HCl), uniformly mixing (the molar ratio of the 2-IT to the RBD-shRNA-RBD is 200: 1), and reacting for 2h at room temperature; removing excessive 2-IT by dialysis, adding sufficient dialysate (1 XPBS, 5mM EDTA, pH 7.4) each time, storing at 4 deg.C, dialyzing overnight, carefully magnetically stirring at low speed, and changing the dialysate for 2 times in 6-8 hr; the protein concentration and the degree of thiolation of the thiolated antibody were measured by the BCA method and the Ellman method, respectively.

(5) Preparation of liposome modified compound from liposome DOTAP/Chol

(A) Preparation by using negatively charged siRNA/shRNA to adsorb positively charged liposome

Taking 120 mu l of DOTAP/Chol liposome (10mM), adding 20 mu 1 RBD-shRNA-RBD (about 2 mu g/mu 1, 40 mu g), adding 11 mu l of DEPC water, and standing at room temperature for 10min to obtain the liposome-coated RBD-shRNA-RBD compound.

② taking siRNA90 mu 1(24 mu g, 20mM), shRNA90 mu 1(24 mu g, 10mM) and/or RBD-shRNA-RBD100 mu 1 (about 10mu g/mu 1, 200 mu g), adding DEPC water 57.6 mu 1, standing at room temperature for 10min, adding 600 mu l DOTAP/Chol liposome (50 mM) to obtain liposome-encapsulated siRNA, shRNA and/or RBD-shRNA-RBD complex.

And thirdly, equivalently mixing the liposome compound prepared in the step one with the siRNA, shRNA and/or RBD-shRNA-RBD liposome compound prepared in the step two to obtain the RBD modified liposome containing the free siRNA/shRNA to wrap the RBD-shRNA/siRNA-RBD compound.

(B) Prepared by the cross-linking reaction of sulfhydryl in RBD and maleimide in PEG

In order to prolong the circulation time and the targeting specificity of the liposome, PEGylation and further RBD targeting modification are carried out on various liposomes prepared in the step (A), and the PEGylation and RBD-ligand liposome modified compound is obtained.

Taking 6.36 mul, 9.53 mul and 12.7 mul of 10mg/ml MAL-DSPE-PEG, respectively inserting into the liposome compound RBD-shRNA/siRNA-RBD prepared in the step (A) (mixing the two, respectively), incubating in water bath at 50 ℃ for 10min, standing at room temperature for 10min, then adding about 200 mug of the thiolated RBD-shRNA-RBD to make the sulfhydryl on the thiolated amino group in the RBD and maleimide in the MAL-DSPE-PEG generate cross-linking reaction to respectively obtain the PEGylated liposome compound RBD-shRNA/RBD of 5mo 1% PEG, 7.5 mo 1% PEG and 10mo 1% PEG modified by the RBD, namely the compound is PEGylated liposome compound RBD-shRNA/RBD which is formed by electrostatically adsorbing and wrapping siRNA, and/or RBD-RBD by liposome DOTAP/Chol, and wrapping the outer layer of siRNA, by the MAL-DSPE-PEG, and finally, connecting the RBD-shRNA-RBD by using MAL-DSPE-PEG, wherein the RBD plays roles in targeted delivery, protein antigen and siRNA/shRNA stabilization, and the liposome and the PEG play roles in protecting the siRNA/shRNA, slowly releasing the siRNA/shRNA/RBD, and transfecting the siRNA/shRNA or vaccine adjuvant to the intracellular.

Example 2: preparation of liposome modified compounds from Liposomal

When the pH value is more than 8, the amino terminal of RBD reacts with pNP-PEG-DPPE (PEG-PE) to form a stable urethane bond conjugate, and the stable urethane bond conjugate is directionally and quantitatively inserted into an outer membrane of the liposome to prepare the liposome modified compound. This example prepares liposome-modified compounds with RBD fragments and siRNA for RBD-targeted delivery of siRNA (RBD-siRNA).

(1) Synthesis of RBD

And synthesizing the RBD or the fragment thereof by adopting the RBD synthesis method.

(2) Synthesis of pNP-PEG-DPPE

10mL of a 20mg/mL DPPE (dipalmitoylethanolamine) chloroform solution was taken, and placed in a 50mL round-bottomed flask, 0.65mL of Triethylamine (TEA) was added dropwise to obtain about 4.0g of 200mg/mL (pNP)₂-PEG₃₄₀₀Adding (polyethylene glycol 3400 bis-p-nitrophenylcarbonate) chloroform solution into the mixed solution, blowing nitrogen, sealing, keeping away from light, magnetically stirring overnight at room temperature, evaporating the solvent to dryness under reduced pressure, removing residual chloroform in vacuum, adding 100mL of 0.01mol/L HCl aqueous solution, and performing ultrasonic treatment to form transparent micelle solution. 0.01mol/L HCI aqueous solution as eluent, and separating with CL-4B Sepharose to remove unreacted (pNP)₂-PEG₃₄₀₀And released pNP, collecting the eluate containing pNP-PEG-DPPE micelles, freeze-drying, and qualitatively and quantitatively determining pNP-PEG-DPPE by TLC, HPLC, MS and NMR.

(3) Synthesis of RBD-PEG-DPPE: dissolving 100mg of pNP-PEG-DPPE in 10mL of chloroform, placing the solution in a 50mL flask, removing the chloroform by reduced pressure on a rotary evaporator to form a lipid membrane, removing residual chloroform by vacuum, dissolving 25mg of RBD in 0.01mol/L of HCl 4mL, adding the solution to the flask with the lipid membrane coated on the inner wall, incubating the solution at room temperature for 30min, and shaking gently to fully disperse the lipid membrane. To the suspension, 20mL of 10 μm/L (pH 9.0) Tris buffer was added, mixed well, protected with nitrogen, and incubated overnight at 4 ℃. Putting the sample into a dialysis bag with molecular mass of 5kD, dialyzing in 10mmol/L (pH 7.4) Tris buffer solution for about 4h, dialyzing with deionized water at 4 ℃ for 24h, taking out the solution in the bag, freeze-drying, and storing in a refrigerator at-20 ℃.

(4) Synthesis of RBD-siRNA/liposomal: mixing ePC (yolk phospholipid), Ch (cholesterol), and PEG₂₀₀₀-DSPE (distearoylethanolamine polyethylene glycol 2000) and DOTAP (dioleoyltrimethylammonium propane) in chloroform in a molar ratio (60:34:3.0:3.0) and, if necessary, labeling the lipid membrane, adding Rho-PE in an amount of 0.1% by weight based on the total lipid to the mixture, removing chloroform under reduced pressure,a lipid film is formed. An amount of siRNA that completely neutralizes the positive charge of DOTAP is dissolved in the DEPC-treated ultrapure water. And hydrating the phospholipid membrane with siRNA-containing water solution in a water bath at 50 ℃ for 30min to form siRNA-encapsulated liposome. Liposomes having uniform particle sizes were prepared by passing the primarily formed liposomes through 0.4 μm and 0.1 μm polycarbonate nuclear pore membranes (Whatman)10 times, respectively, using a manual extrusion apparatus (Avanti Polar Lipids). Dissolving an appropriate amount of RBD-PEG-DPPE in methanol, placing in a flask, drying with nitrogen to form a membrane, adding the prepared liposome suspension, and performing warm bath in water bath at 37 ℃ for 2h to ensure that RBD-PEG-DPPE is directionally inserted into the outer membrane of the liposome. Wherein the molar ratio of RBD in the liposome to total lipid is generally 0.5-1. O% (which can be adjusted as appropriate). The characteristics of the RBD modified polyethylene glycol modified liposome carrying siRNA are examined by dynamic laser scattering, a frozen etching electron microscope and nucleic acid electrophoresis.

Seventhly, verification of Compound (nCOVsiRNA)

1. In vitro verification of broad-spectrum antiviral effect with conserved gene as target

(1) Preparation of virus liquid

The virus strain was added to DMEM medium (10% FBS) containing Vero E6 cells grown to 30% confluence at 36 ℃ with 5% CO₂Culturing for 5-7 days in an incubator until cytopathic effect (CPE) appears, separating virus, and preparing 10 percent of culture solution³～10⁵TCID₅₀The virus solution is prepared for use. Accordingly, virus solutions of two variant strains B.1.617.1 and B.1.617.2 of the new coronavirus are respectively prepared and used for verifying whether the compound is simultaneously effective on 2 or more variant viruses containing the same conservative gene so as to prove whether the shRNA has a broad-spectrum antiviral effect by taking the conservative gene as a target.

(2) Co-culture of Compound (nCOVsiRNA) with Virus

The expression of the compound RBD-shRNA1/2/3-RBD is renamed to be RBD₂shRNA1/2/3, setting up the effect of test compounds against B.1.617.1 and B.1.617.2, respectively, in experimental and control groups. Each group was inoculated with 8 well plates, 2X 10 wells per well⁵Vero-E6 cells, 2mL DMEM (10% FBS), 36 ℃, 5% CO₂CulturingWhen the culture was carried out in the chamber to 30% confluency (after 24 hours), the culture medium was changed and the test compound, B.1.617.1 and B.1.617.2 strains of virus were added.

Wherein the experimental group comprises RBD₂Group of-shRNA 1 (0.1nmol RBD)₂shRNA1+0.6ml virus solution), RBD₂Group of-shRNA 2 (0.1nmol RBD)₂shRNA2+0.6ml virus solution), RBD₂Group of-shRNA 3 (0.1nmol RBD)₂shRNA3+0.6ml of virus solution), RBD-siRNA group (0.1nmol RBD-siRNA +0.6ml of virus solution); the control group included: naked shRNA1 group (0.1nmol naked shRNA1+0.6ml of virus solution), naked shRNA2 group (0.1nmol naked shRNA2+0.6ml of virus solution), naked shRNA3 group (0.1nmol naked shRNA3+0.6ml of virus solution), naked siRNA group (0.1nmol naked siRNA +0.6ml of virus solution), RBD control group (0.1nmol RBD +0.6ml of virus solution), positive control group (0.6ml of virus solution), and negative control group (0.6ml of DMEM culture solution) (tables 1-6).

After further incubation for 1 hour, 24 hours and 72 hours, the supernatants of each group were diluted 1:4, 1:12, 1:36, 1:108, 1:324, 1:972, 1:2916 and 1:8748 times and subjected to RT-PCR.

(3) Real-time fluorescent RT-PCR detection of viral RNA of each group

Viral nucleic acid extraction and nucleic acid (ORF1ab/N) detection were performed according to the kit instructions.

(4) Results of viral RNA detection

Detection results of B.1.617.1 strains: as shown in Table 1, after the cells of each group were cultured for 1 hour, the detection results of the viral RNA of the negative control group were negative, the detection results of the RNA of the positive control group had a titer of 1:36, and the detection results of the RNA of the other groups had a titer of 1: 12. As shown in Table 2, after each group of cells are cultured for 24 hours, the virus RNA detection result of the negative control group is still negative, the RNA detection result titer of the positive control group is 1:2916, the RNA detection result titer of the 4 control groups is 1: 972-1: 2916, and the RNA detection result titer of the experimental group is 1: 36-1: 108, which is obviously lower than that of the control group (p is less than 0.01). As shown in Table 3, after the cells of each group are cultured for 72 hours, the detection result of the virus RNA of the negative control group is still negative, the RNA detection result titer of the positive control group is more than 1:8748, the RNA detection result titer of the control group is more than 1: 2916-1: 8748, and the RNA detection result titer of the experimental group is 1: 108-1: 324, which is obviously lower than that of the control group (p is less than 0.01).

Tables 1-3 show that the experimental group has obvious effect of resisting B.1.617.1 strain, and shows that the shRNA or siRNA connected with the RBD can be delivered into target cells for RNA interference, while the shRNA or siRNA not connected with the RBD can not enter the target cells and can not play the role of RNA interference, and in addition, the RBD also has certain antiviral effect.

Table 1 test results (+/-) for viral RNA RT-PCR in 1-hour incubation of Compounds with B.1.617.1 Strain

Table 2 results of RT-PCR detection of viral RNA in a 24-hour culture broth after the Co-culture of the Compounds with B.1.617.1 Strain (+/-)

Table 3 results of RT-PCR detection of viral RNA in the culture broth after the compounds were co-cultured with B.1.617.1 Strain for 72 hours (+/-)

Detection results of B.1.617.2 strains: as shown in Table 4, after the cells of each group are cultured for 1h, the detection result of the viral RNA of the negative control group is negative, the titer of the detection result of the RNA of the positive control group is 1:36, and the titers of the detection results of the RNA of other groups are 1: 12-1: 36. as shown in Table 5, after each group of cells are cultured for 24h, the virus RNA detection result of the negative control group is still negative, the RNA detection result titer of the positive control group is 1:2916, the RNA detection result of 3 groups in the RNA detection result of the 4 control groups is 1:2916, and the RNA detection result titer of the 4 experimental groups is 1: 108-1: 324 which is obviously lower than that of the control group (p is less than 0.01). As shown in Table 6, after 72h of cell culture, the test result of the viral RNA in the negative control group is still negative, the titer of the RNA in the positive control group is more than 1:8748, the titer of 3 groups in the RNA test result of the 4 control groups (naked) is 1:8748 or more, the titer of 1 group in the RNA test result of the 4 experimental groups is 1:972, the titer of 3 groups is 1:324, and the difference is still obvious compared with the control group (p is less than 0.01).

Tables 4-6 show that the experimental group has obvious effect of resisting B.1.617.2 strain, and that the shRNA or siRNA connected with the RBD can be delivered into target cells for RNA interference, and the shRNA or siRNA not connected with the RBD can not enter the target cells so as not to play the role of RNA interference.

Tables 1-6 show that the experimental group has the effect of resisting B.1.617.1 and B.1.617.2 at the same time, and the compound (shRNA) with the conserved gene as the interference target in the experimental group has the effect of resisting a variant strain in a broad spectrum.

Table 4 results of RT-PCR detection of viral RNA in 1-hour culture Medium of the Compounds and B.1.617.2 Strain

Table 5 results of RT-PCR detection of viral RNA in 24-hour culture Medium by Co-culturing the Compounds with B.1.617.2 Strain (+/-)

Table 6 results of RT-PCR detection of viral RNA in the culture broth after 72 hours of coculture of the Compounds with B.1.617.2 Strain

2. Verification of targeted delivery and immune function of RBD in vivo in animals

(1) Animal grouping and vaccination

Animal grouping: selecting SPF female BALB/c mice of 6-8 weeks old and about 40 g, and randomly dividing into RBDs₂shRNA1/Lip group (Vaccination with RBD)₂shRNA1/Lip + B.1.617.2 strain), RBD-siRNA1/Lip group (inoculated with RBD-siRNA1/Lip + B.1.617.2 strain), RBD group (inoculated with RBD + B.1.617.2 strain), shRNA1/Lip group (inoculated with shRNA1/Lip + B.1.617.2 strain), shRNA1 group (inoculated with shRNA1+ B.1.617.2 strain), positive control group (inoculated with B.1.617.2 strain + physiological saline) and negative control group (inoculated with physiological saline only).

Animal inoculation: nasal spray inoculation 40. mu.l titer 10⁵/mlTCID₅₀The negative control group was inoculated with 40. mu.l of physiological saline by nasal spray. Anesthetizing by intraperitoneal injection of 5% chloral hydrate solution, and respectively adding 0.1nmol of RBD₂the-shRNA/Lip, RBD-siRNA/Lip, RBD, shRNA1/Lip and shRNA1 were slowly injected into mouse trachea, tissues were repositioned, 10 mice were sacrificed each group on day 7 after infection for virus detection, and the other 10 mice were used for antibody observation.

(2) Infection in half cell number (TCID)₅₀) Percentage of (2) detection of viruses

Preparing 10% homogenate of lung tissue of killed mice, centrifuging 100pl, diluting the supernatant by 10 times, inoculating the diluted supernatant into a 96-well plate with VeroE6 monolayer growth, inoculating 30 μ l of the diluted supernatant into each well, inoculating 4 wells of the diluted supernatant into each well, shaking the diluted supernatant gently, adsorbing lh at 37 ℃, washing the diluted supernatant with Hank's solution, adding culture solution, culturing the diluted supernatant in a 37 ℃ C02 incubator, observing cytopathic effect (CPE), and calculating half infection (TCID) of VeroE6 cells of each group respectively₅₀) The larger the percentage, the more the virus content, see tables 7-13.

TABLE 7 RBD₂Percentage of lung homogenate of shRNA1/Lip group mice in VeroE6 half the infection

TABLE 8 percentage of VeroE6 infection by lung homogenate of RBD-siRNA1/Lip group mice

TABLE 9 percentage of VeroE6 infection in lung homogenate of RBD group mice

TABLE 10 percentage of lung homogenate of shRNA1/Lip group mice that caused half the infection of VeroE6

TABLE 11 percentage of lung homogenate of shRNA1 group mice that caused half the infection of VeroE6

TABLE 12 percentage of VeroE6 infection in lung homogenates of positive control mice

TABLE 13 percentage of VeroE6 infection in lung homogenates of mice in the negative control group

(3) Effect of RBD Targeted delivery

From tables 7 to 13, it can be seen thatThe percentage of VeroE6 half infected amount caused by lung homogenate of each group of mice is RBD₂20.0% of shRNA1/Lip group, 27.5% of RBD-siRNA1/Lip group, 87.5% of RBD group, 82.5% of shRNA1/Lip group, 95.0% of shRNA1 group, 95.0% of positive control group and 2.5% of negative control group. Because RNAi mainly occurs in cytoplasm, shRNA1 in shRNA1 group is extremely easy to degrade by nuclease and not easy to pass through cell membrane, so that RNAi effect is hardly achieved; although shRNA1 of the shRNA1/Lip group is protected by Lip and is not easily degraded by nuclease and can pass through a cell membrane, the effect of RNAi is poor because the shRNA is not capable of specifically entering target cells, the percentage of the half infection amount of VeroE6 reaches 82.5 percent, and the difference is not significant compared with a positive control group (p is more than 0.05); and RBD₂shRNA1/siRNA1 in shRNA1/Lip group and RBD-siRNA1/Lip group is delivered to target cytoplasm in an RBD targeting manner, so that RNAi effect is good, and RBD is good₂The percentage of VeroE6 half infection amount of the-shRNA 1/Lip group and the RBD-siRNA1/Lip group are respectively different from those of the shRNA1/Lip group in significance (both are p < 0.05).

(4) Immune function assay of Compound (nCOVsiRNA)

Collection of RBD ₂10 mouse venous blood at 1, 2, 4 and 6 weeks after inoculation of-shRNA 1/Lip group and RBD group, separating serum, storing at-20 ℃ for later use, and detecting SARS-CoV-2 specific antibodies IgG and IgM by ELISA according to the kit instructions. The results are shown in Table 14.

TABLE 14 RBD₂Comparison of results of serum-specific antibody detection of 10 mice each in the shRNA1/Lip group and the RBD group

From Table 14, RBD₂The IgM, IgG and IgM + IgG detection cases of the shRNA1/Lip group were 21, 20 and 16, respectively, which were more than 8, 8 and 5, respectively, of the RBD group. Because of RBD₂The compound of the-shRNA 1/Lip group is synthesized by 2 molecules of RBD, 1 molecule of shRNA and Lip, has larger molecular weight and more complex molecular structure than the single molecule of RBD of the RBD group, and shRNA and Lip have the function of immunologic adjuvant, so the compound has stronger antigenicity and is easier to generate anti-immune adjuvantA body.

Sequence listing

<110> Tanzhou Biotech Ltd

<120> nCOVsiRNA medicine for delivering shRNA in RBD targeting manner

<141> 2021-12-31

<150> 2021113298837

<151> 2021-11-11

<160> 45

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA/RNA

<213> Unknown

<400> 1

ttaatacgac ctctctgttg gattttgaca 30

<210> 2

<211> 22

<212> DNA/RNA

<213> Unknown

<400> 2

ggttcgcaac ttcacacaga gt 22

<210> 3

<211> 22

<212> DNA/RNA

<213> Unknown

<400> 3

caggcgtttg ttggttgatt aa 22

<210> 4

<211> 30

<212> DNA/RNA

<213> Unknown

<400> 4

gttttacgac aacgatgttg gtttaggaca 30

<210> 5

<211> 22

<212> DNA/RNA

<213> Unknown

<400> 5

ggttcggttg ttatatacga ta 22

<210> 6

<211> 22

<212> DNA/RNA

<213> Unknown

<400> 6

ggttcagaga gtctcctatt ta 22

<210> 7

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 7

ggaagagaca gguacguuaa u 21

<210> 8

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 8

gaagagacag guacguuaau a 21

<210> 9

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 9

gguacguuaa uaguuaauag c 21

<210> 10

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 10

gugguauucu ugcuaguuac a 21

<210> 11

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 11

guuaauaguu aauagcguac u 21

<210> 12

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 12

ggaagagaua gguacguuaa u 21

<210> 13

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 13

gaagagauag guacguuaau a 21

<210> 14

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 14

gcugcuguuu acagaauaaa u 21

<210> 15

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 15

cgguacuauu accguugaag a 21

<210> 16

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 16

gguggaauug cuaucgcaau g 21

<210> 17

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 17

ggauuugucu ucuacaauuu g 21

<210> 18

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 18

cgaacgcuuu cuuauuacaa a 21

<210> 19

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 19

cacuguugcu acaucacgaa c 21

<210> 20

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 20

ccuaguaaua gguuuccuau u 21

<210> 21

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 21

gguuccaacg guacuauuac c 21

<210> 22

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 22

cgguacuauu accguugaag a 21

<210> 23

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 23

cguagucgca acaguucaag a 21

<210> 24

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 24

ggaugauuuc uccaaacaau u 21

<210> 25

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 25

gguggacccu cagauucaac u 21

<210> 26

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 26

ggcuacuacc gaagagcuac c 21

<210> 27

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 27

caagauggua uuucuacuac c 21

<210> 28

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 28

ggacgaagau gacaauuuaa u 21

<210> 29

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 29

gguguuguuu guacagaaau u 21

<210> 30

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 30

ccucaguguu gacacuaaau u 21

<210> 31

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 31

gcuuaugugu caaccuauac u 21

<210> 32

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 32

gguugaagca guuaauuaaa g 21

<210> 33

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 33

cgauauuacg cacaacuaau g 21

<210> 34

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 34

ggauguuaac ugcacagaag u 21

<210> 35

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 35

gauuguuuag gaagucuaau c 21

<210> 36

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 36

gcaacugugu ugcugauuau u 21

<210> 37

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 37

gucucuaguc aguguguuaa u 21

<210> 38

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 38

cuacuaaugu uguuauuaaa g 21

<210> 39

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 39

gguguucuua cugagucuaa c 21

<210> 40

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 40

ggguguuaac ugcacagaag u 21

<210> 41

<211> 21

<212> DNA/RNA

<213> Unknown

<400> 41

gguauagauu guuuaggaag u 21

<210> 42

<211> 68

<212> DNA/RNA

<213> Unknown

<400> 42

ttaatacgac ctctctgttg gattttgaca ttcaagagat gtcaaatcca acagagaggt 60

cgtattaa 68

<210> 43

<211> 53

<212> DNA/RNA

<213> Unknown

<400> 43

ggttcgcaac ttcacacaga gtttcaagag aactctgtgt gaagttgcga acc 53

<210> 44

<211> 53

<212> DNA/RNA

<213> Unknown

<400> 44

ggttcggttg ttatatacga tattcaagag atatcgtata taacaaccga acc 53

<210> 45

<211> 765

<212> DNA/RNA

<213> Unknown

<400> 45

atgaatatta caaacttgtg cccttttggt gaagttttta acgccaccag atttgcatct 60

gtttatgctt ggaacaggaa gagaatcagc aactgtgttg ctgattattc tgtcctatat 120

aattccgcat cattttccac ttttaagtgt tatggagtgt ctcctactaa attaaatgat 180

ctctgcttta ctaatgtcta tgcagattca tttgtaatta gaggtgatga agtcagacaa 240

atcgctccag ggcaaactgg aaagattgct gattataatt ataaattacc agatgatttt 300

acaggctgcg ttatagcttg gaattctaac aatcttgatt ctaaggttgg tggtaattat 360

aattacctgt atagattgtt taggaagtct aatctcaaac cttttgagag agatatttca 420

actgaaatct atcaggccgg tagcacacct tgtaatggtg ttgaaggttt taattgttac 480

tttcctttac aatcatatgg tttccaaccc actaatggtg ttggttacca accatacaga 540

gtagtagtac tttcttttga acttctacat gcaccagcaa ctgtttgtgg acctaaaaag 600

tctactaatt tggttaaaaa caaatgtgtc aatttcaact tcaatggttt aacaggcaca 660

ggtgttctta ctgagtctaa caaaaagttt ctgcctttcc aacaatttgg cagagacatt 720

gctgacacta ctgatgctgt ccgtgatcca cagacacttg agtaa 765

Claims (10)

1. The nCOVsiRNA medicine for the targeted delivery of the shRNA by the RBD is characterized in that a compound for the targeted delivery of the shRNA by the RBD is synthesized, the compound for the targeted delivery of the anti-variation target shRNA to ACE2 is formed by respectively synthesizing the coronavirus shRNA taking a conserved gene as a target and the coronavirus RBD taking ACE2 as a receptor and respectively connecting the synthesized RBD to positive and negative sense chains of the synthesized shRNA, and then the compound is modified by liposome to mutually enhance the components, wherein the targeted delivery of the RBD ensures that the shRNA can play a specific role in the ACE2 expression cells, the RBD is also a protein antigen, 2 RBDs connected by the shRNA are higher in antigenicity due to the change of the molecular structure and molecular weight, the permeability and the nuclease resistance stability of a cell membrane are increased due to the change of the molecular structure and the molecular weight, and the shRNA and the liposome are also used as an immunologic adjuvant for enhancing the effect of an RBD vaccine.

2. The nCOVsiRNA drug for RBD-targeted delivery of shRNA according to claim 1, wherein the conserved gene as a target is siRNA for synthesizing shRNA selected from the group consisting of consensus genes of various pathogenic coronaviruses and variant strains thereof recorded in databases, and the synthesized shRNA is targeted to interfere with the consensus genes, thereby acting as a broad-spectrum anti-variant strain; the common genes include, but are not limited to, super-conserved genes, and/or genes spliced by conserved microsatellites.

3. The nCOVsiRNA drug for RBD-targeted delivery of shRNA according to claims 1 and 2, wherein the synthetic shRNA comprises but is not limited to first synthesizing 2 complementary oligonucleotide polypeptide siRNAs of about 21-25nt and synthesizing a spacer base sequence, then linking the synthesized siRNAs and the base sequence into a small hairpin shRNA duplex separated by an intermediate base sequence into a loop, and then linking the RBD polypeptides on each single strand of the shRNA duplex.

4. The nCOVsiRNA drug for RBD-targeted delivery of an shRNA according to claims 1 and 2, wherein the conserved gene is targeted at siRNA sequences comprising but not limited to SEQ ID No. 1-41; the siRNA sequence taking the super-conservative gene, the conservative gene or the conservative microsatellite as a target comprises but is not limited to SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 5; the conserved gene comprises but is not limited to a gene sequence shared by NC-045512.2 strain, DELTA variant strain and/or OMICRON variant strain, and the siRNA sequence comprises but is not limited to SEQ ID NO. 9-11, SEQ ID NO. 16-20, SEQ ID NO.23, SEQ ID NO. 26-27, SEQ ID NO. 31-33, SEQ ID NO.35 or SEQ ID NO. 37-39.

5. The nCOVsiRNA drug for RBD-targeted delivery of shRNA as claimed in claim 1, wherein the synthetic RBD includes but is not limited to amino acid sequence 319-510 of synthetic S protein, conserved amino acid sequences of N439, V483 and Q493 sites capable of binding to ACE2 but not subject to variation, and codon optimized amino acid sequence.

6. The nCOVsiRNA drug for targeted delivery of shRNA as claimed in claim 1, wherein the RBD, in addition to playing an important role in targeted delivery of shRNA and as a recombinant protein vaccine, can compete with the virus for the ACE2 receptor, thus having the effect of preventing the virus from entering target cells through ACE2 and causing infection.

7. The nCOVsiRNA drug for RBD-targeted delivery of shRNA according to claim 1, wherein the adjuvant effect of the liposome further comprises protection against long-acting, slow release and endocytosis of shRNA and RBD.

8. The nCOVsiRNA drug for RBD-targeted delivery of shRNA according to claim 1, wherein the linking or synthesis comprises, but is not limited to, linking the glycosylated N amino group of the RBD to the 3' end of the antisense strand, the 5' end or the 3' end of the sense strand of the shRNA and comprises, but is not limited to, linking by chemical or covalent coupling of disulfide bonds, phosphodiester bonds, dithiophosphate bonds, thioether bonds, oxime bonds, amide bonds, maleimide-sulfhydryl bonds.

9. The nCOVsiRNA drug for RBD-targeted delivery of shRNA according to claim 1, wherein the nCOVsiRNA drug comprises but not limited to RBD-siRNA and S-siRNA as conjugates formed by connecting RBD polypeptide or S protein polypeptide and siRNA, and liposome modified complexes RBD-siRNA/Lip and S-siRNA/Lip thereof.

10. The nCOVsiRNA drug according to claim 1 for RBD-targeted delivery of shRNA, wherein the compound RBD-shRNA-RBD is obtained, including but not limited to the compounds targeting SEQ ID No. 1-39.

Images