CN114561431A - Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion - Google Patents

Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion Download PDF

Info

Publication number
CN114561431A
CN114561431A CN202210062297.9A CN202210062297A CN114561431A CN 114561431 A CN114561431 A CN 114561431A CN 202210062297 A CN202210062297 A CN 202210062297A CN 114561431 A CN114561431 A CN 114561431A
Authority
CN
China
Prior art keywords
physcion
pgmb
ala
leu
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210062297.9A
Other languages
Chinese (zh)
Inventor
乔建军
梁冬梅
陈瑞琦
饶海密
李钰琨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Shaoxing Research Institute Of Tianjin University
Original Assignee
Zhejiang Shaoxing Research Institute Of Tianjin University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Shaoxing Research Institute Of Tianjin University filed Critical Zhejiang Shaoxing Research Institute Of Tianjin University
Priority to CN202210062297.9A priority Critical patent/CN114561431A/en
Publication of CN114561431A publication Critical patent/CN114561431A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007—Methyltransferases (general) (2.1.1.)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion, wherein the amino acid sequence of the oxygen-methyltransferase PgmB is shown as SEQ ID NO. 1. Experiments prove that the oxygen-methyltransferase PgmB can generate physcion by taking emodin as a substrate, reduce the production cost of physcion and lay a foundation for realizing the heterologous biosynthesis of physcion.

Description

Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion
Technical Field
The invention belongs to the field of enzyme gene engineering and enzyme engineering, and particularly relates to application of oxygen-methyltransferase PgmB (Aspergillus terreus) in catalyzing emodin to generate physcion.
Background
Physcion is an aromatic polyketone compound with anthraquinone as carbon skeleton. Research shows that physcion has bactericidal activity on more than 10 important pathogenic bacteria such as powdery mildew, gray mold, rice blast, rhizoctonia and the like, so that physcion is often used as an agricultural bactericide, and the action mechanism of physcion is to inhibit the oxidation and dehydrogenation of sugar and sugar metabolism intermediate products of the pathogenic bacteria and inhibit the synthesis of protein and nucleic acid, so that the spore germination of the pathogenic bacteria, the growth of hyphae and the formation of haustoria are inhibited, and crops are prevented from being damaged by the pathogenic bacteria to achieve the effect of preventing diseases. As a novel high-efficiency low-toxicity green and environment-friendly botanical pesticide, the physcion has the advantages of fast degradation, low residue, difficult generation of drug resistance, effective promotion of the growth of young shoots and new buds of crops, basically no application and harvesting interval period and the like, and is particularly suitable for being used as a green biological agent for producing organic vegetables.
The existing methods for producing physcion mainly comprise a plant extraction method and an endogenous fungus fermentation method. Physcion is extracted and purified from plants in a complex process, the yield of chemical synthesis is low, most of fungus production strains are difficult to culture, and pathogenicity or yield is low, so that the scale of producing compounds by fermenting original production strains is fundamentally limited. With the development of genome sequencing technology, many synthetic biological strategies developed in model microorganisms have become useful tools for discovery, characterization, production and identification of enzyme functions of polyketides. The new idea of heterogeneously synthesizing plant source natural products in the model microorganism can greatly reduce the production cost of the biopesticides such as physcion and the like, and further promote the popularization and application of the biopesticides. To date, researchers have reconstructed the biosynthetic pathway of emodin in Saccharomyces cerevisiae, but the pathway of physcion has not yet been established.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion.
The technical scheme of the invention is summarized as follows:
the application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion is characterized in that the amino acid sequence of the oxygen-methyltransferase PgmB is shown as SEQ ID NO. 1.
The invention has the advantages that:
experiments prove that the oxygen-methyltransferase PgmB can generate physcion by taking emodin as a substrate, reduce the production cost of physcion and lay a foundation for realizing the heterologous biosynthesis of physcion.
Drawings
FIG. 1 is a DNA agarose gel map of PCR verification of a colony of a transformant of Escherichia coli BL21 containing PgmB gene (the size of a target band is 1283 bp); m: a standard DNA molecular ruler; lane 1: PgmB;
FIG. 2 is a standard curve of physcion;
FIG. 3 is an HPLC profile of a sample solution after bioconversion, wherein:
a is an HPLC (high performance liquid chromatography) spectrum of a sample solution after the biological transformation of PgmB cells;
b is the area of physcion peak detected by HPLC (a: pET-28a empty plasmid control, B: PgmB, c: 10 mu g/mL of physcion standard substance as compound 1 and 25 mu g/mL of physcion standard substance as compound 2.)
Detailed Description
Oxygen-methyltransferase PgmB (Access: ARB 51364.1).
The present invention will be described in further detail with reference to the accompanying drawings and examples.
Example 1 construction of PgmB E.coli BL21 expression Strain
First, an oxygen-methyltransferase PgmB (amino acid sequence SEQ ID NO.1) derived from Aspergillus terreus NIH2624 was subjected to codon optimization for Escherichia coli, gene synthesis, and a pET28a-pgmB recombinant plasmid was constructed.
Secondly, preparing escherichia coli BL21 competence, and the operation steps are as follows:
(1) taking out Escherichia coli BL21 glycerobacteria from a refrigerator at-80 ℃, placing the glycerol bacteria on ice to slowly melt, sucking a proper amount of bacteria liquid, inoculating the bacteria liquid to an LB solid plate, carrying out three-zone streaking, and placing the streaked bacteria liquid in an incubator at 37 ℃ for 12h until a single colony grows out.
(2) Fresh single colonies were picked up and cultured in 10mL LB liquid medium, placed on a shaker at 37 ℃ and cultured at 220rpm for about 12h to logarithmic phase.
(3) Transfer to 50mL LB liquid medium at 1% inoculum size. Measuring OD once per hour at 37 deg.C and 220rpm for 2.5-3h, when OD is reached600Stopping cultivation when the culture medium is equal to 0.4-0.6And (5) nourishing.
(4) Placing the bacterial liquid on ice for 5min, subpackaging in a sterilized and precooled 50mL centrifuge tube, carrying out ice bath for 30min, centrifuging at 4 ℃ and 5000rpm for 5min, and discarding the supernatant.
(5) Adding 5mL of precooled 10% glycerol aqueous solution into each tube of thalli, slowly resuspending the thalli on ice, centrifuging at 4 ℃ and 5000rpm for 5min, discarding the supernatant, repeating the step for 3 times, and discarding the supernatant.
(6) Adding 200 μ L10% glycerol aqueous solution into each tube, mixing the bacteria, suspending the cells in glycerol aqueous solution, subpackaging into 1.5mL EP tubes, storing at-80 deg.C and 100 μ L each tube to obtain Escherichia coli BL21 competent cells.
Thirdly, the pET28a-pgmB recombinant plasmid is transformed into escherichia coli BL21 competence by an electrical transformation method, and the operation steps are as follows:
(1) the prepared Escherichia coli BL21 was taken out from a freezer at-80 ℃ and thawed on ice, while a sterile electric shock cup was placed on ice for precooling.
(2) Turning on the electric rotating instrument, adjusting to Manual mode, adjusting voltage to 2.5Kv, and preheating for 5 min.
(3) Sucking 5 μ L of pET28a-pgmB recombinant plasmid into 100 μ L of Escherichia coli BL21 competence, mixing gently to obtain a mixed solution, standing on ice for 10min, transferring into a precooled electric shock cup, blowing and sucking slowly to make the mixed solution enter between electrodes of the electric rotating cup, and covering.
(4) The cuvette was pushed into the electrical converter and the parameters of the shock were about 3.5ms per pulse.
(5) 1mL of LB liquid medium was quickly added to the cuvette, gently pipetted, and transferred to a 1.5mL centrifuge tube, and incubated at 37 ℃ for recovery at 180rpm for 45 min.
(6) Centrifuging at 5000rpm for 2min, discarding the supernatant, leaving 100. mu.L of the resuspended broth, and spreading the broth on LB solid medium containing 25. mu.g/mL kanamycin resistance using a spreading rod. The incubator was inverted at 37 ℃ for overnight culture.
Screening of single colony containing target transformant
The solid medium obtained in step three (6) of this example was removed, and 10 single colonies were randomly selected and mixed well with 10. mu.LddH2And (4) in O. mu.L of the mixture was mixed with 100. mu.L of LB liquid medium and incubated at 37 ℃ with shaking at 220 rpm. And carrying out colony PCR reaction by using the residual 3 mu L as a PCR template and using SEQ ID NO.2 and SEQ ID NO.3 as upstream and downstream primers, carrying out agarose gel electrophoresis on a PCR product, and screening a single colony containing a target transformant. Wherein the reaction system is 10 mu L and comprises ddH2O1.0. mu.L, 2 XTaq DNA Master Mix (1mL) 5.0. mu.L, primer shown in SEQ ID NO.2 (10. mu.M) 0.5. mu.L, primer shown in SEQ ID NO.3 (10. mu.M) 0.5. mu.L, bacterial fluid 3.0. mu.L, primer sequences as follows:
primer Y-PgmB-F: 5'CCGTTAGTCCACTGGAAGGTC 3' (SEQ ID NO.2)
Primer Y-PgmB-R: 5'GCTGAGCTGAATCTCCAGAATG 3' (SEQ ID NO.3)
The correct transformants were inoculated into LB liquid medium containing 50. mu.g/mL ampicillin, cultured at 37 ℃ and 220rpm for 12 hours, and stored at-80 ℃ in 30% by volume of an aqueous glycerol solution.
The results show that: the selected transformant has a single band at 1283bp, and the obtained transformant is a positive clone, namely the PgmB escherichia coli BL21 expression strain.
Control strain: pET28a was used in place of pET28a-pgmB in this example, and as in this example, the expression strain prepared was the control strain.
Example 2 Induction of expression strains
Inducing PgmB escherichia coli BL21 expression strain to express PgmB by IPTG, and the specific steps are as follows:
(1) activating the strain: the PgmB Escherichia coli BL21 expression strain obtained in example 1 was taken out at-80 ℃ in a refrigerator, placed on ice to be slowly melted, an appropriate amount of the strain liquid was taken out and inoculated on an LB solid plate containing 25. mu.g/mL kanamycin to streak the three regions, and placed in an incubator at 37 ℃ for about 12 hours until a single colony grew out. Fresh single colonies were picked and inoculated into LB liquid medium containing 50. mu.g/mL kanamycin to culture at 37 ℃ overnight at 220rpm for 12 hours.
(2) Transferring: inoculating overnight cultured strain liquid into LB liquid medium with 25. mu.g/mL kanamycin final concentration according to the inoculation amount of 1% volume fraction, and shake-culturing at 37 ℃ and 220rpm to OD600＝0.4-0.6。
(3) IPTG induction: adding IPTG inducer with final concentration of 0.5mM, and inducing and expressing at 16 deg.C for 20h (expressing oxygen-methyltransferase PgmB, the amino acid sequence of which is shown in SEQ ID NO.1) to obtain the induced PgmB escherichia coli BL21 expression strain.
Induction of the control strains obtained in example 1 the induced control strains were obtained in the same manner as in the respective steps of this example.
Example 3 bioconversion
(1) And (3) collecting thalli: centrifuging the induced PgmB escherichia coli BL21 expression strain bacterial liquid at 4 ℃ and 4000rpm for 10min, and removing the supernatant;
(2) the collected cells were washed with pre-cooled equal volume of LB medium without antibiotics, washed twice, centrifuged at 4000rpm for 10min at 4 ℃ and the supernatant removed. Resuspending in 20mL LB liquid culture medium, adding 25 μ g/mL kanamycin to the culture medium in advance, taking 1mL bacterial liquid to perform in vivo enzyme activity reaction, adding emodin with 1mM final concentration as a reaction substrate (providing methyl donor by large intestine endogenous SAM (S-adenosine-L-methionine)), and performing shake culture at 200rpm for 12h at 25 ℃.
The induced PgmB E.coli BL21 expression strain of this example was replaced with the induced control strain, and the biotransformation was carried out as in this example.
Example 4 detection of product by high Performance liquid chromatography
1. Preparation of sample solution
Adding methanol with the same volume as the two fermentation liquors obtained in the example 3 for extraction respectively, carrying out ultrasonic treatment for 30min, centrifuging at 8000rpm for 10min, taking the supernatant, passing through a 0.22 mu m organic microporous filter membrane, transferring to a small liquid phase bottle for liquid phase detection. The reaction product was identified by HPLC analysis.
2, preparation of standard solution:
2.1 accurately weighing the physcion standard substance, adding methanol to prepare physcion standard substance solutions with the concentrations of 1, 2.5, 10, 20 and 25 mu g/mL respectively, and filtering the solutions through a 0.22 mu m organic microporous filter membrane to a liquid phase small bottle; the physcion is slightly soluble in methanol, and can be dissolved by adding a small amount of chloroform and then diluting to constant volume by using methanol.
2.2 accurately weighing emodin and physcion standard substance, adding methanol, and preparing into mixed standard substance solution containing emodin standard substance with final concentration of 10 μ g/mL and physcion standard substance with final concentration of 25 μ g/mL.
3. Detection of the product by high performance liquid chromatography
Detecting sample solution, physcion standard substance solution and mixed standard substance solution by high performance liquid chromatography
Detection conditions of the high performance liquid chromatography are as follows:
a chromatographic column: hypurity C18(250 mm. times.4.6 mm, 5 μm); sample introduction amount: 10 mu L of the solution; mobile phase: methanol-0.1% phosphoric acid in water (75: 25); flow rate: 1.0mL/min, detection wavelength: 254 nm.
4. Data processing:
4.1 establishing an Physcion standard curve
Using the 5 physcion standard solutions with different concentrations obtained in the step 2.1, injecting samples for 3 times, and injecting 10 mu L of sample for each time. Recording the peak area value of physcion and taking the average value of the 3 peak areas. A standard curve was plotted by linear regression with the control concentration (μ g/mL) as abscissa (x) and the corresponding peak area as ordinate (y), and is represented by y ═ ax + b, as shown in fig. 2. Substituting the peak area value of the sample solution into the standard curve to obtain the yield of the physcion.
4.2 the detection result of the mixed standard solution shows that the peak emergence times of emodin and physcion are respectively 15.8min and 33.2min, the result of the sample solution shows that compared with a control group, physcion is detected in the retention time of 33.0min by PgmB escherichia coli BL21 expression strain biotransformation reaction, which shows that PgmB has catalysis effect on emodin, the detection of fermentation liquor is carried out for three times, the average value is taken, the physcion peak area of the cell sap biotransformation sample solution is 27214, and the concentration is 18.87 mug/mL.
The above description is only a preferred embodiment of the present invention, and any improvements or modifications made by the contents of the present specification and the accompanying drawings, or applied directly or indirectly to other related technical fields, should be considered as within the protection scope of the present invention.
Sequence listing
<110> Zhejiang Shaoxing research institute of Tianjin university
<120> application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 442
<212> PRT
<213> Aspergillus terreus (Aspergillus terreus)
<400> 1
Met Thr Pro Tyr Ser Ser Ala Ala Asp Leu Gly Ser Thr Val Ser Pro
1 5 10 15
Leu Glu Gly Leu Ser Ser Val Ile Thr Lys Asn Thr Ser Ile Val Ser
20 25 30
Gln Tyr Leu Gln Ala Asn Asn Leu Pro Gln Pro Ser Pro Glu Ala Asn
35 40 45
Gly Pro Val Val Val Leu Pro Ser Asp Ala Pro Gln Asp Val Gln Gln
50 55 60
Ala Arg Gln Gln Leu Ile Ala Ala Ser Leu Glu Ile Phe Gln Leu Ala
65 70 75 80
Ile Gly Pro Ser Glu Phe Leu Pro His Leu Ala Thr Asn Phe Gln Tyr
85 90 95
Ile Ser Cys Leu Thr Trp Leu Ala His Tyr Asp Ile Phe His Leu Val
100 105 110
Pro Arg Asp Lys Asn Ile Ser Tyr Ala Asp Leu Ala Arg Ala Thr Gly
115 120 125
Val Pro Glu Gln Arg Leu Lys Ser Ile Leu Arg Met Ala Met Thr Ser
130 135 140
Ser Leu Phe Arg Glu His Pro Asn Gly Thr Asp Val Gly His Ser Ala
145 150 155 160
Val Ser Ala Leu Leu Ala Ser Asp Asp Asp Ala Tyr Ser Tyr Ala Thr
165 170 175
Tyr Met Cys Ser Lys Thr Ala Pro Met Ala Met Ser Met Thr Glu Ala
180 185 190
His Lys Arg Trp Gly Ala Ser Thr Arg Thr Asn Glu Thr Ala Tyr Asn
195 200 205
Val Ala Phe Asn Thr Glu Leu Pro Leu Phe Asp Asp Leu Ala Gln Asn
210 215 220
Lys Ala Arg Met Gly Glu Phe Ala Arg Tyr Met Arg Ser Val Arg Ser
225 230 235 240
Ser Glu Thr Val Ala Leu Lys His Leu Val Ser Gly Val Asp Trp Glu
245 250 255
Ser Ile Pro Ala Gly Gly Met Leu Val Asp Val Gly Gly Ser Thr Gly
260 265 270
Gly Ala Ala Ile Ala Leu Ala Gln Ala Tyr Pro His Ile Arg Phe Thr
275 280 285
Ile Gln Asp Leu Pro Glu Asn Val Glu Thr Gly Glu Lys Ala Ala Ala
290 295 300
Ala Ser Leu Pro Ala Asp Ile Ala Ser Arg Leu Thr Phe Gln Ala His
305 310 315 320
Asp Phe Thr Leu Pro Gln Pro Val Arg Ala Ala Asp Ala Tyr Leu Leu
325 330 335
Arg Met Ile Leu His Asp Trp Pro Asp Glu Gln Ala Val Lys Ile Leu
340 345 350
Arg Asn Ile Val Thr Ala Met Glu Glu Thr Lys Ser Arg Leu Phe Ile
355 360 365
Met Asp Thr Val Leu Pro Lys Pro Gly Ser Val Pro Val Ser Val Glu
370 375 380
Arg Ile Ala Arg Ala Arg Asp Leu Thr Met Ile Gln Ser Phe Asn Ser
385 390 395 400
Lys Glu Arg Glu Leu Asp Glu Trp Lys Glu Leu Ile Thr Ala Ala Asp
405 410 415
Pro Arg Leu Gln Leu Ile Ala Val Thr Gln Pro Leu Gly Ser Ala Met
420 425 430
Ser Ile Leu Glu Ile Gln Leu Ser Ala Lys
435 440
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccgttagtcc actggaaggt c 21
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctgagctga atctccagaa tg 22

Claims (1)

1. The application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion is characterized in that the amino acid sequence of the oxygen-methyltransferase PgmB is shown as SEQ ID NO. 1.
CN202210062297.9A 2022-01-19 2022-01-19 Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion Pending CN114561431A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210062297.9A CN114561431A (en) 2022-01-19 2022-01-19 Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210062297.9A CN114561431A (en) 2022-01-19 2022-01-19 Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion

Publications (1)

Publication Number Publication Date
CN114561431A true CN114561431A (en) 2022-05-31

Family

ID=81711843

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210062297.9A Pending CN114561431A (en) 2022-01-19 2022-01-19 Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion

Country Status (1)

Country Link
CN (1) CN114561431A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373125A (en) * 2020-02-25 2021-09-10 中国科学院天津工业生物技术研究所 flavone-O-methyltransferase and its application in synthesis of wogonin, isowogonin and thuja flavone
CN113736804A (en) * 2021-07-09 2021-12-03 上海辰山植物园 Scutellaria baicalensis flavone methoxytransferase gene and recombinant vector and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373125A (en) * 2020-02-25 2021-09-10 中国科学院天津工业生物技术研究所 flavone-O-methyltransferase and its application in synthesis of wogonin, isowogonin and thuja flavone
CN113736804A (en) * 2021-07-09 2021-12-03 上海辰山植物园 Scutellaria baicalensis flavone methoxytransferase gene and recombinant vector and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
饶海密: "酿酒酵母中大黄素甲醚生物合成途径的重构", 《万方学位论文数据库》, pages 9 *

Similar Documents

Publication Publication Date Title
CN110527646B (en) Tropical bacillus WZZ018 and application thereof
CN107502585A (en) One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid
CN106497857B (en) One plant can be with the bacillus licheniformis engineering bacteria of high yield Polyurethane-epoxy resin
CN115197172B (en) Sesterterpene compound, synthetic gene cluster and synthetic method thereof
CN109266675A (en) A kind of Bacillus subtilis genes engineering bacteria producing lipopeptid and its construction method and application
US11732279B2 (en) Method AMD strains for reducing byproduct fumaric acid in fermentation process of L-malic acid and use thereof
CN113930347A (en) Trichoderma viride engineering bacterium capable of synthesizing melatonin as well as construction method and application thereof
CN113897325B (en) Recombinant escherichia coli for producing salidroside as well as construction method and application thereof
CN110343709A (en) A kind of arctic nocardia lasso trick peptide gene cluster and its cloning and expression method
CN110079468A (en) A method of enhancing Candida glycerolgenesis 2 phenylethyl alcohol tolerance
CN114774297B (en) Recombinant saccharomyces cerevisiae for producing T-juniper alcohol and application thereof
CN112409492B (en) Borneol camphor monoterpene synthase CcTPS1 and related biological materials and application thereof
CN110669713A (en) Genetically engineered bacterium for synthesizing D-limonene and construction method and application thereof
CN114934062B (en) Engineering bacterium for efficiently expressing D-psicose 3-epimerase and application
CN114561431A (en) Application of oxygen-methyltransferase PgmB in catalyzing emodin to generate physcion
CN113265391B (en) Linalool synthase CcLS and coding gene and application thereof
CN113355366B (en) Method for preparing 2-phenethyl alcohol by multi-enzyme cascade
CN115927147A (en) Method for improving antioxidant activity of lactococcus lactis and application thereof
CN113265390B (en) Ocimum synthase CcOS and coding gene and application thereof
CN112553230B (en) High-yield IAA trichoderma viride engineering strain and construction method and application thereof
CN113444737B (en) Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoid
CN111139207B (en) Brevibacillus brevis gene recombinant strain and preparation method and application thereof
CN109576287B (en) CrpMApplication of gene in improving DHA stress tolerance of Gluconobacter strains
CN114438004B (en) Saccharopolyspora erythraea engineering strain with doubled pII gene, and construction method and application thereof
CN114875003B (en) Mutant of short-chain dehydrogenase, coding gene obtaining method and application of mutant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20220531