CN114561395A - Soluble expression and high-efficiency purification method of fusion-tag-free rhIL-11 and mutant thereof - Google Patents
Soluble expression and high-efficiency purification method of fusion-tag-free rhIL-11 and mutant thereof Download PDFInfo
- Publication number
- CN114561395A CN114561395A CN202210328547.9A CN202210328547A CN114561395A CN 114561395 A CN114561395 A CN 114561395A CN 202210328547 A CN202210328547 A CN 202210328547A CN 114561395 A CN114561395 A CN 114561395A
- Authority
- CN
- China
- Prior art keywords
- rhil
- fusion tag
- temperature
- expression
- free
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5431—IL-11
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to the technical field of gene recombination, and discloses a soluble expression and efficient purification method of fusion tag-free rhIL-11 and mutants thereof, wherein the gene for expressing the fusion tag-free rhIL-11 is obtained by carrying out codon escherichia coli preference optimization on humanized IL-11, and the fusion tag-free rhIL-11 mutants are derived by carrying out mutation of specific amino acid sites on the basis of the rhIL-11. The rhIL-11 or the mutant thereof without any fusion tag can be expressed in the prokaryotic system escherichia coli cells in a soluble form with high yield, the subsequent downstream treatment does not need the fusion tag cutting step, and the denaturation and renaturation procedures of the inclusion body are not involved, the culture process is simple and has extremely low cost, the expression period of the rhIL-11 or the mutant thereof is short, the downstream purification step is simple, the prepared rhIL-11 or the mutant thereof has a correct protein structure, and the in vitro activity of the prepared rhIL-11 or the mutant thereof is kept good.
Description
Technical Field
The invention relates to the technical field of gene recombination, in particular to a soluble expression and efficient purification method of rhIL-11 and a mutant thereof without a fusion tag.
Background
Human interleukin-11 (hIL-11) is one of the important cytokines in the human body, and natural human interleukin-11 consists of 178 amino acids, contains proline and leucine with high proportion, does not contain cysteine, has no glycosylation sites, has a theoretical molecular weight of about 19kDa, and has a theoretical isoelectric point of 11.16. IL-11 can cooperate with various cytokines in human body to exert physiological action, jointly stimulate the growth of human erythrocyte, megakaryocyte and other precursor cells, induce the maturation of megakaryocyte and promote the generation of platelet. rhIL-11 produced by Genetic Institute corporation (oprelkin,
) FDA approval for the treatment of cancer patients as early as 1997 can treat regenerative thrombocytopenia due to radiotherapy, chemotherapy. The Genetic Institute company produced rhIL-11 containing 177 amino acids, which lacks the N-terminal proline as compared with natural human IL-11, although one amino acid is less, the biological activities in vivo and in vitro are not significantly different from those of natural-structure IL-11. The results of studies on rhIL-11, which contains proline (Pro, 12.4%) and leucine (Leu, 23.0%) at a high ratio, show that rhIL-11 is expressed in Escherichia coli as almost non-structural and non-active Inclusion Body (IBS), and then active rhIL-11 can be obtained through the steps of inclusion body denaturation and protein renaturation (Highminbi et al, J. biomedical engineering, 2012, 29(3): 530-.
In order to solve the problem that rhIL-11 is expressed in a prokaryotic system in the form of an inactive and unstructured inclusion body due to strong hydrophobicity, Genetic Institute company applies for a patent (US5760189, US5646016) for soluble expression of rhIL-11 protein through a prokaryotic system, which solves the problems, but the complex production process greatly increases the production and clinical use costs, and simultaneously causes great difficulty in the downstream process development. Nam-Hai Truong et al report a method for soluble expression of rhIL-11 in an escherichia coli system by a SUMO fusion mode, and although the method for preparing rhIL-11 by expression of the SUMO fusion mode avoids the expression of rhIL-11 in escherichia coli in an inactive and unstructured inclusion body form, the same complicated purification, enzyme digestion and re-purification steps bring great inconvenience to downstream process development. In order to solve the complicated process of enzyme digestion to remove fusion protein or denaturation and renaturation of inclusion body in the rhIL-11 production process, Qui-Lim Chooa et al reported a method for high-efficiency soluble expression of rhIL-11 by Pichia pastoris (Qui-Lim Chooa et al protein Express purification.2018 Jun; 146: 69-77), but the method still needs to collect aggregates and then carry out denaturation and renaturation operations again. Therefore, the problems of long culture period, high culture cost and inevitable denaturation and renaturation steps in subsequent downstream preparation procedures still exist when the recombinant rhIL-11 protein is expressed by a yeast expression system.
In addition, the purification of rhIL-11 is still one of the problems in the preparation process. After obtaining the Trx-rhIL-11 fusion protein, the Genetic Institute company still needs to perform purification after enterokinase cleavage. The patent CN200610068871.2 reports Trx-rhIL-11 fusion protein, which is obtained by cutting with hydroxylamine to release rhIL-11, and purifying with anion, cation and gel filtration chromatography to obtain rhIL-11. The successful purification of rhIL-11 by the method is based on the fact that the protein components of the enzyme-digested system are relatively simple. The aim of successfully realizing the fine purification by the purification method of the Qui-Lim Chooa and the like is still to ensure that protein components in a system needing to be purified are single at the beginning, and the reason is that rhIL-11 is secreted and expressed by yeast, so that the interference of intracellular complex proteins of the yeast on the purification process can be avoided. One of the difficulties in obtaining recombinant proteins by intracellular soluble expression of E.coli is the purification of the recombinant proteins. The protein components of the supernatant after the escherichia coli is crushed are extremely complex, and the purification difficulty is extremely high.
In order to solve the purification problem after recombinant protein expression by escherichia coli, a common method is to fuse and express the recombinant protein and an affinity purification Tag (such as a histidine Tag, a His-Tag), such as a high-rise citizen, etc., the His-Tag is fused at the end of an amino acid sequence of rhIL-11, and purification is performed by metal chelate chromatography (Ni-sepharose), so that the purification step of the rhIL-11 can be simplified, or the His-Tag fusion expression is co-expressed at the end of a fusion-promoting fusion protein (such as SUMO, Trx, etc.) and a target recombinant protein. For example, His-Tag is fused at the tail end of SUMO by Nam-Hai Truong and the like, and the His-SUMO is fused and expressed with rhIL-11, so that the step of purifying the fusion protein from the escherichia coli bacteria breaking supernatant is greatly simplified, and the affinity purification Tag is removed when the fusion Tag is removed by enzyme digestion. However, the introduction of affinity purification tags also adds to the downstream processing steps and increases the production cost.
Disclosure of Invention
Based on the above problems, the present invention provides a soluble expression and high-efficiency purification method of fusion tag-free rhIL-11 and its mutant, aiming at the defects of the prior art and the above mentioned difficult problems, the present invention provides a fusion tag-free rhIL-11 or its mutant which can be expressed in soluble form in the prokaryotic system Escherichia coli cells in high yield, the subsequent downstream processing does not need the fusion tag cutting step, and also does not relate to the denaturation and renaturation process of the inclusion body, the culture process is simple and has extremely low cost, the expression cycle of the rhIL-11 or its mutant is short, the downstream purification step is simple, the prepared rhIL-11 or its mutant protein has correct structure, and the in vitro activity thereof is kept good.
In order to solve the technical problems, the invention provides the following technical scheme:
the rhIL-11 without the fusion tag and the mutant thereof express the gene sequence of the rhIL-11 without the fusion tag as shown in SEQ ID NO: 1, the gene of the rhIL-11 expressing the fusion-free tag is obtained by carrying out codon Escherichia coli preference optimization on human IL-11(UniProtKB-P20809, with or without reserving N-terminal proline (Pro)); the rhIL-11 mutant without fusion tag is derived by mutation of specific amino acid site on the basis of rhIL-11 (one or a plurality of amino acid substitutions are carried out at any site in the rhIL-11 sequence), and the gene sequence of the rhIL-11 is specifically as follows:
GGTCCTCCTCCTGGTCCGCCTCGTGTTAGTCCGGATCCGCGTGCAGAACTGGATAGCACCGTTCTGCTGACCCGTAGCCTGCTGGCAGATACCCGTCAGCTGGCAGCACAGCTGCGTGATAAATTTCCGGCAGATGGTGATCATAATCTGGATAGCCTGCCGACACTGGCAATGAGCGCAGGCGCACTGGGTGCACTGCAGCTGCCTGGTGTTCTGACCCGTCTGCGTGCCGATCTGCTGAGCTATCTGCGTCATGTTCAGTGGCTGCGTCGTGCCGGTGGTAGCAGCCTGAAAACCCTGGAACCGGAACTGGGCACCCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAACTGCTGATGAGCCGTCTGGCACTGCCGCAGCCTCCGCCTGATCCTCCGGCACCGCCTCTGGCACCTCCGAGCAGTGCATGGGGTGGTATTCGTGCAGCACATGCAATTTTAGGTGGTCTGCATCTGACCCTGGATTGGGCAGTTCGTGGTCTGCTGCTGCTGAAAACACGTCTG。
furthermore, the mutant of the rhIL-11 without the fusion tag is rIL-11m, and the gene sequence of the rIL-11m is shown in SEQ ID NO: 2; rIL-11m is the structural equivalent of rhIL-11, namely, on the premise of not changing the main body space structure (namely, four-helix bundle, alpha-helix arranged in up-up-down-down) of the rhIL-11, one or more amino acid substitutions, deletions or insertions are carried out on any site in the primary structure amino acid sequence of the rhIL-11; the gene sequence of rIL-11m is specifically as follows:
GGTCCTCCTCCTGGTCCGCCTCGTGTTAGTCCGGATCCGCGTGCAGAACTGGATTGCACCGTTCTGCTGACCCGTAGCCTGCTGGCAGATACCCGTCAGCTGGCAGCACAGCTGCGTGATAAATTTCCGGCAGATGGTGATCATAATCTGGATAGCCTGCCGACACTGGCAATGAGCGCAGGCGCACTGGGTGCACTGCAGCTGCCTGGTGTTCTGACCCGTCTGCGTGCCGATCTGCTGAGCTATCTGCGTCATGTTCAGTGGCTGCGTCGTGCCGGTGGTAGCAGCCTGAAAACCCTGGAACCGGAACTGGGCACCCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAACTGCTGATGAGCCGTCTGGCACTGCCGCAGCCTCCGCCTGATCCTCCGGCACCGCCTCTGGCACCTCCGAGCAGTGCATGGGGTGGTATTCGTGCAGCACATGCAATTTTAGGTGGTCTGCATCTGACCCTGGATTGGGCAGTTCGTGGTCTGCTGCTGCTGAAAACACGTCTG。
in order to solve the technical problems, the invention also provides a soluble expression and high-efficiency purification method of the fusion tag-free rhIL-11 and the mutant thereof, which comprises the following steps:
s1: by PCR technology, under the action of specific restriction enzyme and specific primer, inserting the gene sequences of rhIL-11 and rIL-11m without fusion tag into the temperature-sensitive expression vector, and adding no solubilizing protein gene or affinity purification tag gene sequence to the upstream or downstream of the gene sequences of rhIL-11 and rIL-11m to obtain rhIL-11 cloning vector and rIL-11m cloning vector; during the induction expression process of the temperature sensitive expression vector, rhIL-11 and rIL-11m are expressed in a prokaryotic expression system in a form that the N terminal and the lower C terminal are not fused with other amino acid sequences or labels (Tag-free);
s2: introducing the rhIL-11 cloning vector and the rIL-11m cloning vector obtained in the step S1 into escherichia coli, obtaining escherichia coli with positive cloning vector by scratching, culturing and screening the escherichia coli with positive cloning vector on a solid culture medium at a low temperature, then heating to induce a target gene to express in cells, and then harvesting thalli; the expression host of rhIL-11 and mutant rIL-11m thereof is Escherichia coli, which has distinct prokaryotic expression system characteristics, such as short culture period, high expression yield, no post-translational modification and disulfide bond oxidation performance, and the like, and common Escherichia coli host bacteria include BL21(DE3), BL21(DE3) pLysS, JM109, Rosetta (DE3), and the like, but are not limited thereto;
s3: resuspending the thalli harvested in the step S2 by using a resuspension buffer solution, then carrying out bacterial disruption in a mode of ultrasonic disruption or high-pressure homogeneous disruption, wherein the pressure of the high-pressure homogeneous disruption is 400-1000bar, releasing the protein in the bacteria into an extracellular resuspension buffer solution, and centrifuging to obtain a disrupted supernatant, wherein the resuspension buffer solution is a buffer solution containing 0-0.5M salt and having a pH value of 5.0-9.0; the salt is common salt, and can be NaCl or Na2SO4Or (NH)4)2SO4Etc., but not limited thereto;
s4: adjusting the conductivity value of the crushed supernatant obtained in the step S3 to 10-80mS/cm by using saturated ammonium sulfate, standing, and centrifuging to obtain a sample before column chromatography; performing hydrophobic chromatography (adsorption-elution mode) purification on a sample before column chromatography, adjusting the pH of the purified elution sample to 6.0-9.5 by using 1.0M Tris or 0.1M NaOH, diluting the sample by using distilled water to lead the sample to be conductive to 2-15mS/cm, then adjusting the urea concentration of an elution sample protein solution to a final concentration of 1.0-7.0M by using 8.0M urea solution, fully mixing the sample solution, and standing for 2-48h at the temperature of 4-25 ℃; the components of the crushed supernatant fluid are all host proteins of the escherichia coli, nucleic acid substances, soluble lipid, lipopolysaccharide, micromolecular pigments, amino acid, salts and other substances, after the sample flows through the chromatographic packing, the target protein is adsorbed on the packing, other impurities such as protein, nucleic acid and the like flow through and are removed, after proper washing, the protein is finally eluted by using the eluent; the hydrophobic chromatography packing is a medium with hydrophobic ligands, such as butyl sulfide, butyl, octyl, phenyl and the like, preferably the hydrophobic chromatography packing of butyl sulfide and butyl ligands; the hydrophobic chromatography equilibrium buffer solution is pH5.0-9.0 buffer solution, the conductance value is 40-80ms/cm, and the eluent is 5-50mM low-salt low-ionic strength buffer solution; the buffer salt is Tris (hydroxymethyl) aminomethane (Tris), phosphate, acetate, etc., but is not limited thereto;
s5: subjecting the sample solution after the treatment of step S4 to anion exchange chromatography purification, wherein the filler for anion exchange chromatography purification is a filler with ligands that can be dissociated with negative charges under specific conditions, including but not limited to DEAE-sepharose or Q-sepharose or Capto adhere, the equilibrium buffer for anion exchange chromatography purification is a buffer solution with pH 6.0-9.5, the buffer solution can be Tris or phosphate, the concentration of the buffer solution is 10mM-0.2M, the conductance value is 2-15mS/cm, and after the treatment, fusion tag-free rhIL-11 protein and rIL-11M protein are finally obtained, and the fusion tag-free rhIL-11 protein comprises rhIL-11 intact protein and one or more amino acid residues lacking N terminal; in this step, after the sample flows through the chromatographic packing, the target protein is adsorbed on the packing, and other impurities such as protein and nucleic acid flow through the chromatographic column to be removed, and finally the target protein is eluted, harvested, concentrated, changed and stored.
Further, the temperature-sensitive expression vector in step S1 is a λ PL/PR-cI857 temperature-sensitive system expression vector including, but not limited to, any one of a pBV220 plasmid, a pBV200 plasmid, a pBV221 plasmid, and a pBV222 plasmid, the pBV220 plasmid containing a PL promoter and a regulatory gene cI encoding a cI protein gene ctis 857 having an inhibitory effect on the promoter and being temperature-sensitive, and transcription and expression of a foreign gene inserted therein can be controlled by regulating the temperature of the culture system.
Further, in step S2, the temperature for increasing the temperature to induce the intracellular expression of the target gene is 30-45 ℃.
Further, the low-temperature culture temperature in step S2 is 30 ℃, and the culture is performed until the bacterial liquid OD is reached600Raising the temperature when the nm reaches 1.0 to induce the target gene to express in the cells, raising the temperature of the culture system to 42 ℃, keeping the temperature until the induction expression is finished, or keeping the temperature for more than 10min and then reducing the temperature to less than 42 ℃ for culture induction expression.
Further, the pH of the resuspension buffer in step S3 was 8.0.
Further, the pressure for the high-pressure homogenizing and crushing in step S3 is 600 bar.
Further, in step S4, the sample conductance is diluted to 6.0-8.0mS/cm by using distilled water, the urea concentration of the eluted sample protein solution is adjusted to 4.0-5.0M by using 8.0M urea solution, and the standing condition is 25 ℃ and standing for 16-24 h.
Compared with the prior art, the invention has the beneficial effects that: the invention utilizes the soluble high expression rhIL-11 of prokaryotic escherichia coli and mutant protein thereof, avoids forming inactive and unstructured inclusion bodies in the expression process of the rhIL-11 with stronger hydrophobicity and the mutant thereof in prokaryotic cells, and the subsequent downstream does not need to undergo the process of inclusion body renaturation; meanwhile, a prokaryotic escherichia coli system is used for directly and solubly expressing rhIL-11 and rIL-11m, the N terminal or the C terminal does not contain any fusion protein promoting sequence or affinity purification tag, and the subsequent process of removing the fusion protein or affinity tag sequence by enzyme digestion is not needed, so that compared with the prior art, the method has the advantages of simplifying the process steps, being easy to control, convenient to operate, short in manufacturing period, reducing the manufacturing cost and being suitable for large-scale production; in addition, the invention utilizes hydrophobic chromatography (adsorption mode) and anion exchange chromatography to efficiently purify the target protein from a complex system of the broken supernate of the escherichia coli bacteria, and the finally obtained rhIL-11 and rIL-11m proteins have correct spatial structures and good biological activity, high expression level and short expression period, and the yield and quality are improved while the cost is reduced.
Drawings
FIG. 1 is a characteristic structure map of rhIL-11-pBV220 recombinant plasmid according to an embodiment of the present invention;
FIGS. 2 and 3 are a pBV220 PCR amplification electrophoresis identification chart and an IL11PCR amplification electrophoresis identification chart, respectively, according to an embodiment of the present invention;
FIG. 4 is an SDS-PAGE identification of rhIL-11 soluble expression according to an embodiment of the present invention;
FIGS. 5 and 6 are the rhIL-11 hydrophobic chromatography purification chromatogram and the electrophoresis identification chart of the embodiment of the invention, respectively;
FIGS. 7 and 8 are the rhIL-11 ion exchange chromatography purification chromatogram and the electrophoresis identification chart of the embodiment of the invention, respectively;
FIG. 9 shows the structure of rhIL-11 and rhIL-11m in circular dichroism spectroscopy;
FIG. 10 shows a structure of rhIL-11 and rhIL-11m in fluorescence spectrometry according to an embodiment of the present invention;
FIG. 11 shows the result of RP-HPLC analysis of purity of rhIL-11 and rhIL-11m in accordance with an embodiment of the present invention;
FIG. 12 shows the structure of detecting rhIL-11 and rhIL-11m by SEC-HPLC according to an embodiment of the present invention;
FIG. 13 is a diagram showing the measurement of the cell proliferation activity of rhIL-11 and rhIL-11m (TF-1 cells) in accordance with an embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and the accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not used as limiting the present invention.
Example (b):
firstly, constructing an rhIL-11-pBV220 expression vector, and firstly, carrying out gene sequence conversion and escherichia coli host preference codon optimization on an rhIL-11 amino acid sequence (117AA without N terminal Pro) to obtain a gene sequence SEQ ID NO: 1 (namely, the gene sequence of rhIL-11 without the fusion tag), and carrying out mutation derivation of specific amino acid sites on the basis of rhIL-11 to obtain a mutant of rhIL-11 without the fusion tag (one or a plurality of amino acid substitutions are carried out at any sites in the rhIL-11 sequence), wherein the mutant of rhIL-11 without the fusion tag in the embodiment is rIL-11m, and the gene sequence of rIL-11m is shown in SEQ ID NO: 2; rIL-11m is the structural equivalent of rhIL-11, namely, one or more amino acid substitutions, deletions or insertions are carried out on any site in the primary structure amino acid sequence of rhIL-11 under the premise of not changing the main body space structure (namely, the alpha-helix of the up-up-down-down arrangement) of the rhIL-11.
The synthesized rhIL-11 gene sequence is inserted into a rhIL-11-pET-30a plasmid vector (a plasmid delivered by a gene synthesis company), an upstream primer and a downstream primer are designed by taking the rhIL-11-pET-30a as a template, a restriction enzyme Pst I site is introduced into the upstream primer, a restriction enzyme Hind III site is introduced into the downstream primer, and the rhIL-11 gene sequence is obtained through PCR amplification. The PCR reaction conditions are pre-denaturation at 98 ℃ for 2min, pre-denaturation at 98 ℃ for 10s, PCR at 53 ℃ for 15s, PCR at 72 ℃ for 8s, and PCR extension at 72 ℃ for 5min after 35 cycles.
After the PCR product is identified by 2% agarose gel electrophoresis, the rhIL-11 gene sequence is inserted into the pBV220 plasmid, and the gene sequence of the pBV220 plasmid is as follows:
gaattcccggggatccgtcgacctgcagccaagcttctgttttggcttatgagagaagattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctcccggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagccaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaaggaatcagaaggccatcctgacggatggcctttttgcgtttctacaaactctttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcgggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggatctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccaacctctgacttgagcgtcgattttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccttatctttccctttatttttgctgcggtaagtcgcataaaaaccattcttcataattcaatccatttactatgttatgttctgaggggagtgaaaattcccctaattcgatgaagattcttgctcaattgttatcagctatgcgccgaccagaacaccttgccgatcagccaaacgtctcttcaggccactgactagcgataactttccccacaacggaacaactctcattgcatgggatcattgggtactgtgggtttagtggttgtaaaaacacctgaccgctatccctgatcagtttcttgaaggtaaactcatcacccccaagtctggctatgcagaaatcacctggctcaacagcctgctcagggtcaacgagaattaacattccgtcaggaaagcttggcttggagcctgttggtgcggtcatggaattaccttcaacctcaagccagaatgcagaatcactggcttttttggttgtgcttacccatctctccgcatcacctttggtaaaggttctaagcttaggtgagaacatccctgcctgaacatgagaaaaaacagggtactcatactcacttctaagtgacggctgcatactaaccgcttcatacatctcgtagatttctctggcgattgaagggctaaattcttcaacgctaactttgagaatttttgcaagcaatgcggcgttataagcatttaatgcattgatgccattaaataaagcaccaacgcctgactgccccatccccatcttgtctgcgacagattcctgggataagccaagttcatttttctttttttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtgctcatacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggaggttgtatggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaaagatctctcacctaccaaacaatgcccccctgcaaaaaataaattcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgcactgaccaccatgaaggtgacgctcttaaaaattaagccctgaagaagggcagcattcaaagcagaaggctttggggtgtgtgatacgaaacgaagcattggttaaaaattaaggag。
the method comprises the following specific operations: upstream and downstream introduction is designed, pBV220 plasmid is amplified, rhIL-11 gene is inserted into Pst I and Hind III sites of the polyclonal site of pBV220 plasmid to obtain rhIL-11-pBV220 recombinant plasmid. The PCR reaction conditions are pre-denaturation at 98 ℃ for 5min, pre-denaturation at 98 ℃ for 10s, PCR reaction at 58 ℃ for 15s, PCR reaction at 72 ℃ for 55s, extension at 72 ℃ for 5min after 35 cycles, and PCR products are identified by 0.7% agarose gel electrophoresis. The rhIL-11-pBV220 recombinant plasmid is transferred into DH5 alpha competent cells, and is cultured in Amp + resistant solid LB culture medium to screen single colonies. Selecting a single colony, activating the single colony for 16h at 30 ℃ in an LB culture medium, extracting a plasmid, transferring the plasmid into BL21(DE3) competent cells after plasmid sequencing verification is correct, obtaining BL21(DE3) expression strains containing rhIL-11-pBV220 recombinant plasmids, wherein the rhIL-11-pBV220 recombinant plasmid characteristic structure map is shown in the attached figure 1, the pBV220 PCR amplification electrophoresis identification map and the IL11PCR amplification electrophoresis identification map are respectively shown in the attached figures 2 and 3, wherein 1 in the attached figure 2: pBV220 Lane, 2: control group Lane, 3: 1kb DNA Marker; 1 in fig. 3: control group Lane, 2: IL11 Lane, 3: 100bp DNA Marker.
The primer sequences used in the above method are as follows:
the rhIL-11 gene PCR amplification upstream primer sequence:
5’-CCGTCGACCTGCAGCATATGGGTCCTCCTCCTGG-3’
the rhIL-11 gene PCR amplification downstream primer sequence:
5’-CCGCCAAAACAGAAGCTTTTACAGACGTGTTTTCAGCAGC-3’
the upstream primer sequence of PCR amplification of pBV220 plasmid:
5’-GTAAAAGCTTCTGTTTTGGCGGATGAGAG-3’
the upstream primer sequence of PCR amplification of pBV220 plasmid:
5’-CTGCAGGTCGACGGATCCCC-3’。
the gene sequence of the rhIL-11-pBV220 recombinant plasmid is as follows:
CATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTGACCACCATGAAGGTGACGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGATACGAAACGAAGCATTGGTTAAAAATTAAGGAGGAATTCCCGGGGATCCGTCGACCTGCAGcatATGGGTCCTCCTCCTGGTCCGCCTCGTGTTAGTCCGGATCCGCGTGCAGAACTGGATAGCACCGTTCTGCTGACCCGTAGCCTGCTGGCAGATACCCGTCAGCTGGCAGCACAGCTGCGTGATAAATTTCCGGCAGATGGTGATCATAATCTGGATAGCCTGCCGACACTGGCAATGAGCGCAGGCGCACTGGGTGCACTGCAGCTGCCTGGTGTTCTGACCCGTCTGCGTGCCGATCTGCTGAGCTATCTGCGTCATGTTCAGTGGCTGCGTCGTGCCGGTGGTAGCAGCCTGAAAACCCTGGAACCGGAACTGGGCACCCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAACTGCTGATGAGCCGTCTGGCACTGCCGCAGCCTCCGCCTGATCCTCCGGCACCGCCTCTGGCACCTCCGAGCAGTGCATGGGGTGGTATTCGTGCAGCACATGCAATTTTAGGTGGTCTGCATCTGACCCTGGATTGGGCAGTTCGTGGTCTGCTGCTGCTGAAAACACGTCTGTAAAAGCTTCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTCCCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGCCAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGATCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGTCGCATAAAAACCATTCTTCATAATTCAATCCATTTACTATGTTATGTTCTGAGGGGAGTGAAAATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCTATGCGCCGACCAGAACACCTTGCCGATCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTTCCCCACAACGGAACAACTCTCATTGCATGGGATCATTGGGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACCGCTATCCCTGATCAGTTTCTTGAAGGTAAACTCATCACCCCCAAGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGTCAACGAGAATTAACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATGGAATTACCTTCAACCTCAAGCCAGAATGCAGAATCACTGGCTTTTTTGGTTGTGCTTACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTTAGGTGAGAACATCCCTGCCTGAACATGAGAAAAAACAGGGTACTCATACTCACTTCTAAGTGACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCTTCAACGCTAACTTTGAGAATTTTTGCAAGCAATGCGGCGTTATAAGCATTTAATGCATTGATGCCATTAAATAAAGCACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCGACAGATTCCTGGGATAAGCCAAGTTCATTTTTCTTTTTTTCATAAATTGCTTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTGTGCTCATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGGAACAACGCATAACCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAAGACAGCTAAAAGATCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAA。
respectively inoculating recombinant engineering bacteria stock solution containing rhIL-11-pBV220 plasmid into 50mL LB culture medium containing ampicillin, shaking to activate overnight (12h) at 30 deg.C and 150rpm, inoculating activated bacteria solution into 500mL LB culture medium containing 100 μ g/m ampicillin at 30 deg.C and 200rpm, and culturing at 30 deg.C and 200rpm for about 3h to OD600nm reaches about 1.0, then the culture temperature is raised to 42 ℃, after recombinant gene expression on the plasmid is induced for 4h, the culture is finished, the thalli is harvested by centrifugation, ultrasonic disruption and centrifugation are carried out, and disrupted supernatant is obtained, as shown in figure 4, wherein, in the figure, (a) the bands 3 and 4 respectively represent the bands before and after induction, in the figure, (b) the bands 2 and 3 respectively represent the bands in disrupted supernatant and precipitation, and SDS-PAGE identification shows that rhIL-11 is mainly present in the disrupted supernatant of the bacteria, which indicates that the rhIL-11 is mainly highly expressed in a soluble form in the bacterial cells.
Then, the rhIL-11m (S19C) -pBV220 expression vector is constructed and expressed and identified.
Firstly, designing and synthesizing a primer, then extracting rhIL-11-pBV220 plasmid, and carrying out primer-mediated PCR mutation and amplification by taking the rhIL-11-pBV220 plasmid as a template. The PCR reaction conditions are pre-denaturation at 98 ℃ for 5min, denaturation at 98 ℃ for 15s, denaturation at 65 ℃ for 15s, and denaturation at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 35 cycles. The PCR product is identified by 2% agarose gel electrophoresis, then rhIL-11m (S19C) -pBV220 recombinant plasmid is transferred into DH5 alpha competent cells, and single colony is screened after the culture in Amp + resistant solid LB culture medium. And (3) selecting a single colony, activating the single colony for 16h at 30 ℃ in an LB culture medium, extracting a plasmid, transferring the plasmid into BL21(DE3) competent cells after the plasmid is verified to be correct by plasmid sequencing, and obtaining a BL21(DE3) expression strain containing the rhIL-11m (S19C) -pBV220 recombinant plasmid. The PCR mediated rhIL-11m (S19C) site-directed mutation primer sequence is as follows:
5’-CTGGATTGCACCGTTCTGCTGACCCGTAGCCTGCTG-3’
3’-CAGAACGGTGCAATCCAGTTCTGCACGCGGATCCGG-5’
the gene sequence of rhIL-11m (S19C) -pBV220 recombinant plasmid is as follows:
CATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTGACCACCATGAAGGTGACGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGATACGAAACGAAGCATTGGTTAAAAATTAAGGAGGAATTCCCGGGGATCCGTCGACCTGCAGcatATGGGTCCTCCTCCTGGTCCGCCTCGTGTTAGTCCGGATCCGCGTGCAGAACTGGATTGCACCGTTCTGCTGACCCGTAGCCTGCTGGCAGATACCCGTCAGCTGGCAGCACAGCTGCGTGATAAATTTCCGGCAGATGGTGATCATAATCTGGATAGCCTGCCGACACTGGCAATGAGCGCAGGCGCACTGGGTGCACTGCAGCTGCCTGGTGTTCTGACCCGTCTGCGTGCCGATCTGCTGAGCTATCTGCGTCATGTTCAGTGGCTGCGTCGTGCCGGTGGTAGCAGCCTGAAAACCCTGGAACCGGAACTGGGCACCCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAACTGCTGATGAGCCGTCTGGCACTGCCGCAGCCTCCGCCTGATCCTCCGGCACCGCCTCTGGCACCTCCGAGCAGTGCATGGGGTGGTATTCGTGCAGCACATGCAATTTTAGGTGGTCTGCATCTGACCCTGGATTGGGCAGTTCGTGGTCTGCTGCTGCTGAAAACACGTCTGTAAAAGCTTCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTCCCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGCCAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGATCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGTCGCATAAAAACCATTCTTCATAATTCAATCCATTTACTATGTTATGTTCTGAGGGGAGTGAAAATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCTATGCGCCGACCAGAACACCTTGCCGATCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTTCCCCACAACGGAACAACTCTCATTGCATGGGATCATTGGGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACCGCTATCCCTGATCAGTTTCTTGAAGGTAAACTCATCACCCCCAAGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGTCAACGAGAATTAACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATGGAATTACCTTCAACCTCAAGCCAGAATGCAGAATCACTGGCTTTTTTGGTTGTGCTTACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTTAGGTGAGAACATCCCTGCCTGAACATGAGAAAAAACAGGGTACTCATACTCACTTCTAAGTGACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCTTCAACGCTAACTTTGAGAATTTTTGCAAGCAATGCGGCGTTATAAGCATTTAATGCATTGATGCCATTAAATAAAGCACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCGACAGATTCCTGGGATAAGCCAAGTTCATTTTTCTTTTTTTCATAAATTGCTTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTGTGCTCATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATGGAACAACGCATAACCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAAGACAGCTAAAAGATCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAA。
respectively inoculating recombinant engineering bacteria stock solution containing rhIL-11m (S19C) -pBV220 plasmid into 50mL LB culture medium containing ampicillin, shaking to activate overnight (12h) at 30 deg.C and 150rpm, inoculating the activated bacteria solution into 500mL LB culture medium containing 100 μ g/m ampicillin at a ratio of 2% (v/v), and culturing at 30 deg.C and 200rpm for about 3h to OD600And nm reaches about 1.0, the culture temperature is increased to 42 ℃, recombinant genes on the plasmids are induced to express for 4 hours, the culture is ended, thalli are harvested by centrifugation, the thalli are crushed by ultrasound, the crushed supernatant is obtained by centrifugation, and SDS-PAGE identification shows that rhIL-11m (namely rIL-11m) mainly exists in the bacterial crushed supernatant, which indicates that the rhIL-11m is highly expressed mainly in a soluble form in bacterial cells.
Crushing the supernatant of rhIL-11 and rhIL-11M, centrifuging at 4 deg.C and 12000rpm for 20min, adding ammonium sulfate to give final concentration of 0.5M, and salting out at 4 deg.C overnight; the next day, the salted-out protein solution was centrifuged at 12000rpm for 20min at 4 ℃ and the supernatant was collected for sampling.
Hydrophobic chromatography process (adsorption elution mode): purification was performed by hydrophobic chromatography using a Butyl-S column, which was prewashed with buffer B (20mmol/L Tris-HCl, pH8.0) for 3-5 column volumes before loading, and equilibrated with buffer A (20mmol/L Tris-HCl,0.5M (NH4)2SO4, pH8.0) for 3-5 column volumes. After loading, 3-5 column volumes were equilibrated with buffer a again, then eluted sequentially with 60% and 100% buffer B, and the eluted products were collected and purified by 12% SDS-PAGE. See fig. 5 and fig. 6, where 1 in fig. 6: loading a sample; 2: flowing through the sample; 3: leaching the sample; 4: elution sample, 5: protein molecular weight marker, the results show that rhIL-11 can be firmly combined on a chromatographic column, and higher purity (> 95%) and higher recovery rate (70%) can be obtained.
Anion exchange chromatography procedure: displacing a collected buffer solution system containing target protein into a buffer solution A (20mmol/L Tris-HCl, pH8.0) of a purified product collected in the hydrophobic chromatography process, adjusting the urea concentration of an eluted sample protein solution to be 5.0M by using 8.0M urea solution, and standing the sample solution for 24 hours at 25 ℃ after fully mixing; and (2) purifying the treated protein solution by Capto Q column anion exchange chromatography, wherein before loading, the chromatography column is pre-washed by buffer solution B (20mmol/L Tris-HCl, 1M NaCl, pH8.0) for 3-5 column volumes, then is balanced for 3-5 column volumes by buffer solution A, is loaded and collects flow-through liquid, is balanced for 3-5 column volumes by buffer solution A, and finally is sequentially washed by 15% of buffer solution B to obtain hybrid protein, then is eluted by 35% of buffer solution B, is collected as an eluted product, and is subjected to 12% SDS-PAGE to identify a purification result. See fig. 7 and 8, fig. 8 1: protein molecular weight marker; 2: loading a sample; 3: flowing through the sample; 4: and eluting the sample, wherein the result shows that the rhIL-11 can be combined on the chromatographic column, and the rhIL-11 with higher purity (> 98%) and extremely high protein recovery rate (-90%) are obtained by elution, and the combination of the result of hydrophobic chromatography shows that the method can efficiently purify the target protein.
This example also identified the structure and activity of rhIL-11 and rhIL-11m proteins, and identified the secondary structure of rhIL-11 and rhIL-11m proteins by circular dichroism: firstly, the buffer solution of the protein sample is replaced to 5.0mM PB, pH7.0, the concentration of the protein is concentrated and adjusted to 0.2-0.3mg/ml, a sample pool with the thickness of 0.1cm is used, the scanning wavelength interval is 1.0nm, the scanning repetition time is 5 times, the scanning wavelength range is 190-. The results shown in FIG. 9 show that the secondary structures of rhIL-11 and rhIL-11m are mainly alpha-helix structures and contain a small proportion of beta-sheet structures, and the results are almost consistent with the crystal structures reported by theory, which indicates that the rhIL-11 can form a correct sheet structure in the process of intracellular expression of Escherichia coli.
And identifying the secondary structures of the rhIL-11 and the rhIL-11m protein by a fluorescence spectrophotometer. Firstly, the buffer solution of the protein sample is replaced to 5.0mM PB, pH7.0, the concentration of the protein is concentrated and adjusted to about 0.1mg/ml, the sample is placed in a quartz cuvette sample cell with the optical path of 1.0cm, the excitation wavelength is set to 280nm, the emission wavelength is set to 280-450nm, the interval of the scanning wavelengths is 1.0nm, and the scanning speed of the sample is 1000 nm/min. The results shown in FIG. 10 show that aromatic amino acid structures with strong hydrophobicity in rhIL-11 and rhIL-11m are orderly folded in the interior of protein, which indicates that rhIL-11 and rhIL-11m form a correct, orderly and compact tertiary structure in the intracellular expression process of Escherichia coli.
Purity analysis was performed using an HPLC system with mobile phase a as double distilled water ddH2O + 0.1% TFA, mobile phase B as acetonitrile + 0.1% TFA, flow rate 0.5ml/min, gradient 0-30 min: 70% A + 30% B, 30-45 min: the 30% mobile phase B restricted gradient is increased to 100% mobile phase B, 45-60 min: 100% of mobile phase B, 60-70 min: 70% A + 30% B, the detection wavelength is 280nm, and the result is shown in figure 11. And performing gel filtration analysis by using an HPLC system, wherein the model of a gel filtration column is TKS3000-GSW, the mobile phase is 50mM Na2HPO4/NaH2PO4,0.15M Na2SO4, the pH value is 7.2, the flow rate is 0.5ml/min, the detection wavelength is 280nm, and the result is shown in the attached figure 12, and shows that rhIL-11 and rhIL-11M can form protein monomers with uniform structures in the intracellular expression process.
In this example, TF-1 cells were used for cell viability assay, TF-1 cells were cultured in RPMI-1640 medium containing 2.0ng/ml of GM-CSF and fetal bovine serum, after growth of the cells was stabilized by passage of the cells, the cells were harvested, and the cell concentration was adjusted to 2X 10 using RPMI-1640 medium containing fetal bovine serum5Distributing the cells/ml, continuously culturing for 24 hr in 96-well plate, adding culture medium containing RPMI + fetal calf serum of IL-11 with different concentrations, co-culturing for 72 hr, and finally detecting cell proliferation with CCK-8 working solution, the result is shown in figure 13, which indicates that the cells expressed in Escherichia coliThe rhIL-11 has good bioactivity.
The above is an embodiment of the present invention. The embodiments and specific parameters in the embodiments are only for the purpose of clearly illustrating the verification process of the invention and are not intended to limit the scope of the invention, which is defined by the claims, and all equivalent structural changes made by using the contents of the specification and the drawings of the present invention should be covered by the scope of the present invention.
Claims (9)
1. The rhIL-11 without the fusion tag and the mutant thereof are characterized in that the gene sequence of the rhIL-11 without the fusion tag is expressed in SEQ ID NO: 1, the gene expressing rhIL-11 without fusion tag is obtained by carrying out codon Escherichia coli preference optimization on humanized IL-11; the rhIL-11 mutant without fusion tag is derived by mutation of specific amino acid site based on rhIL-11.
2. The fusion tag-free rhIL-11 and its mutants of claim 1, wherein the fusion tag-free rhIL-11 mutant is rIL-11m, and the gene sequence of rIL-11m is shown in SEQ ID NO: 2; rIL-11m is the structural equivalent of rhIL-11, namely, one or more amino acid substitutions, deletions or insertions are carried out on any site in the primary structure amino acid sequence of the rhIL-11 on the premise of not changing the main body space structure of the rhIL-11.
3. The method for soluble expression and efficient purification of fusion tag-free rhIL-11 and its mutants according to any one of claims 1-2, comprising the steps of:
s1: inserting the gene sequences of rhIL-11 and rIL-11m without fusion tags into a temperature-sensitive expression vector, wherein no dissolving protein promoting gene or affinity purification tag gene sequence is added at the upstream or downstream of the gene sequences of the rhIL-11 and the rIL-11m to obtain a rhIL-11 cloning vector and a rIL-11m cloning vector;
s2: introducing the rhIL-11 cloning vector and the rIL-11m cloning vector obtained in the step S1 into escherichia coli, obtaining escherichia coli with positive cloning vector by scratching, culturing and screening the escherichia coli with positive cloning vector on a solid culture medium at a low temperature, then heating to induce a target gene to express in cells, and then harvesting thalli;
s3: resuspending the thalli harvested in the step S2 by using a resuspension buffer solution, then carrying out bacterial disruption in a mode of ultrasonic disruption or high-pressure homogeneous disruption, wherein the pressure of the high-pressure homogeneous disruption is 400-1000bar, releasing the protein in the bacteria into an extracellular resuspension buffer solution, and centrifuging to obtain a disrupted supernatant, wherein the resuspension buffer solution is a buffer solution containing 0-0.5M salt and having a pH value of 5.0-9.0;
s4: adjusting the conductivity value of the crushed supernatant obtained in the step S3 to 10-80mS/cm by using saturated ammonium sulfate, standing, and centrifuging to obtain a sample before column chromatography; performing hydrophobic chromatography purification on a sample before column chromatography, adjusting the pH of an eluted sample after purification to 6.0-9.5 by using 1.0M Tris or 0.1M NaOH, diluting the sample by using distilled water to conduct electric conduction to 2-15mS/cm, then adjusting the urea concentration of an eluted sample protein solution to a final concentration of 1.0-7.0M by using 8.0M urea solution, and standing for 2-48h at the temperature of 4-25 ℃ after fully mixing sample liquid;
s5: subjecting the sample solution after the treatment of step S4 to anion exchange chromatography purification, wherein the filler for anion exchange chromatography purification is a filler with ligands that can dissociate the negatively charged ligands under specific conditions, such as DEAE-sepharose or Q-sepharose or Capto adhere, the equilibrium buffer for anion exchange chromatography purification is a buffer solution with pH 6.0-9.5, the buffer solution can be Tris or phosphate, the concentration of the buffer solution is 10mM-0.2M, the conductance value is 2-15mS/cm, and the fusion tag-free rhIL-11 protein and the rIL-11M protein are finally obtained after the treatment, and the fusion tag-free rhIL-11 protein comprises the whole rhIL-11 protein and one or more amino acid residues lacking the N terminal.
4. The soluble expression and high-efficiency purification method of fusion tag-free rhIL-11 and mutants thereof according to claim 3, wherein the temperature-sensitive expression vector in step S1 is a lambda PL/PR-cI857 temperature-sensitive system expression vector, the lambda PL/PR-cI857 temperature-sensitive system expression vector includes but is not limited to any one of pBV220 plasmid, pBV200 plasmid, pBV221 plasmid and pBV222 plasmid, the pBV220 plasmid contains PL promoter and cIts857 regulatory gene cI encoding cI protein gene having inhibitory effect on the promoter and being temperature-sensitive, and transcription and expression of foreign gene inserted therein can be controlled by adjusting the temperature of the culture system.
5. The method for soluble expression and efficient purification of fusion tag-free rhIL-11 and its mutants according to claim 3, wherein the temperature for inducing intracellular expression of the target gene by increasing temperature in step S2 is 30-45 ℃.
6. The method of claim 5, wherein the cultivation temperature at step S2 is 30 ℃ and the cultivation is performed at a temperature as low as OD of bacterial liquid600When nm reaches 1.0, the temperature is raised to induce the target gene to express in cells, the culture system is raised to 42 ℃, the temperature is maintained until the induction expression is finished, or the temperature is maintained for more than 10min and then is lowered to less than 42 ℃ for culture and induction expression.
7. The method for soluble expression and efficient purification of fusion tag-free rhIL-11 and its mutants according to claim 3, wherein the pH of the resuspension buffer in step S3 is 8.0.
8. The method for soluble expression and efficient purification of fusion tag-free rhIL-11 and its mutants according to claim 3, wherein the pressure for high pressure homogeneous disruption in step S3 is 600 bar.
9. The soluble expression and high-efficiency purification method of fusion tag-free rhIL-11 and its mutant as claimed in claim 3, wherein the sample conductance is diluted to 6.0-8.0mS/cm by distilled water in step S4, the urea concentration of the eluted sample protein solution is adjusted to 4.0M-5.0M by 8.0M urea solution, and the standing condition is 25 ℃ for 16-24 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210328547.9A CN114561395B (en) | 2022-03-30 | 2022-03-30 | Fusion tag-free rhIL-11 and soluble expression and efficient purification method of mutant thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210328547.9A CN114561395B (en) | 2022-03-30 | 2022-03-30 | Fusion tag-free rhIL-11 and soluble expression and efficient purification method of mutant thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114561395A true CN114561395A (en) | 2022-05-31 |
| CN114561395B CN114561395B (en) | 2023-07-28 |
Family
ID=81720597
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210328547.9A Active CN114561395B (en) | 2022-03-30 | 2022-03-30 | Fusion tag-free rhIL-11 and soluble expression and efficient purification method of mutant thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114561395B (en) |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1298883A (en) * | 1999-12-07 | 2001-06-13 | 北京双鹭药业有限责任公司 | Preparing process and application of recombined human interleukin-11 |
| CN1377893A (en) * | 2001-03-30 | 2002-11-06 | 北京英莱特生物技术开发有限公司 | Interleukin 11 analog |
| US20030228657A1 (en) * | 2001-04-13 | 2003-12-11 | Pownder Tracey A. | Methods for enhancing the translation and expression of recombinant proteins |
| US20060228783A1 (en) * | 2003-08-13 | 2006-10-12 | Jorg Windisch | Expression vectors, transformed host cells and fermentation process for the production of recombinant polypeptides |
| CN1938333A (en) * | 2003-12-03 | 2007-03-28 | 达尔塔生物技术有限公司 | Interleukin-11 fusion proteins |
| CN101165181A (en) * | 2006-09-29 | 2008-04-23 | 上海新生源医药研究有限公司 | High expression method for recombination human interleukins-11 |
| US20100009407A1 (en) * | 2006-10-13 | 2010-01-14 | Novo Nordisk Health Care Ag | Processing Enzymes Fused to Basic Protein Tags |
| CN102140487A (en) * | 2010-01-29 | 2011-08-03 | 东莞太力生物工程有限公司 | Method for preparing recombinant human interleukin-11 |
| US20130273585A1 (en) * | 2012-04-11 | 2013-10-17 | Gangagen, Inc. | Soluble cytoplasmic expression of heterologous proteins in escherichia coli |
| CN107435045A (en) * | 2016-10-10 | 2017-12-05 | 上海华新生物高技术有限公司 | The nucleotide sequence and solution expression with high efficiency method of a kind of optimum combination human interleukin-12 |
| CN113782186A (en) * | 2021-09-08 | 2021-12-10 | 四川大学华西医院 | System for assisting in diagnosing asthenia |
| CN114686487A (en) * | 2021-11-08 | 2022-07-01 | 泰州博莱得利生物科技有限公司 | Efficient expression method of feline canine interleukin 11(IL-11) in pichia pastoris and application thereof |
-
2022
- 2022-03-30 CN CN202210328547.9A patent/CN114561395B/en active Active
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1298883A (en) * | 1999-12-07 | 2001-06-13 | 北京双鹭药业有限责任公司 | Preparing process and application of recombined human interleukin-11 |
| CN1377893A (en) * | 2001-03-30 | 2002-11-06 | 北京英莱特生物技术开发有限公司 | Interleukin 11 analog |
| US20030228657A1 (en) * | 2001-04-13 | 2003-12-11 | Pownder Tracey A. | Methods for enhancing the translation and expression of recombinant proteins |
| US20060228783A1 (en) * | 2003-08-13 | 2006-10-12 | Jorg Windisch | Expression vectors, transformed host cells and fermentation process for the production of recombinant polypeptides |
| CN1938333A (en) * | 2003-12-03 | 2007-03-28 | 达尔塔生物技术有限公司 | Interleukin-11 fusion proteins |
| CN101165181A (en) * | 2006-09-29 | 2008-04-23 | 上海新生源医药研究有限公司 | High expression method for recombination human interleukins-11 |
| US20100009407A1 (en) * | 2006-10-13 | 2010-01-14 | Novo Nordisk Health Care Ag | Processing Enzymes Fused to Basic Protein Tags |
| CN102140487A (en) * | 2010-01-29 | 2011-08-03 | 东莞太力生物工程有限公司 | Method for preparing recombinant human interleukin-11 |
| US20130273585A1 (en) * | 2012-04-11 | 2013-10-17 | Gangagen, Inc. | Soluble cytoplasmic expression of heterologous proteins in escherichia coli |
| CN107435045A (en) * | 2016-10-10 | 2017-12-05 | 上海华新生物高技术有限公司 | The nucleotide sequence and solution expression with high efficiency method of a kind of optimum combination human interleukin-12 |
| CN113782186A (en) * | 2021-09-08 | 2021-12-10 | 四川大学华西医院 | System for assisting in diagnosing asthenia |
| CN114686487A (en) * | 2021-11-08 | 2022-07-01 | 泰州博莱得利生物科技有限公司 | Efficient expression method of feline canine interleukin 11(IL-11) in pichia pastoris and application thereof |
Non-Patent Citations (7)
| Title |
|---|
| HAIDONG TAN等: "Purification and Characterization of Recombinant Truncated Human Interleukin-11 Expressed as Fusion Protein in Escherichia coli", vol. 27, no. 13, pages 905, XP019230883, DOI: 10.1007/s10529-005-7179-3 * |
| YIFAN SU等: "Facile production of tag-free recombinant human interleukin-11 by transforming into soluble expression in Escherichia coli", pages 1 - 7 * |
| 孙卫国等: "pBV220/hIL-4优化表达及其包涵体复性研究", vol. 226, no. 5, pages 205 - 208 * |
| 方宇等: "PD-L1胞外域密码子优化及原核表达纯化", vol. 50, no. 12, pages 49 - 54 * |
| 杨云彭等: "密码子优化策略在异源蛋白表达中的应用", vol. 35, no. 12, pages 2227 - 2237 * |
| 赵加玲等: "结核分枝杆菌H37Rv新基因Rv2742克隆表达及纯化", vol. 35, no. 9, pages 1771 - 1786 * |
| 黄鹏: "密码子优化提高重组金葡菌肠毒素O在大肠杆菌中的表达水平", no. 5, pages 006 - 86 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114561395B (en) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112209995B (en) | Preparation method of SARS-CoV-2 surface protein receptor binding region | |
| KR20110132447A (en) | A polynucleotide and polypeptide sequence and methods thereof | |
| CN113087804B (en) | Bivalent plant immune fusion protein and production method and application thereof | |
| WO2024087784A1 (en) | Recombinant type xvii humanized collagen expressed in yeast and preparation method therefor | |
| US20160168226A1 (en) | Process for production of insulin and insulin analogues | |
| CN108059676B (en) | Anti-human nerve growth factor scFv antibody and preparation method thereof | |
| CN112625117A (en) | Non-denaturing purification method and application of soluble recombinant teriparatide | |
| CN116554309A (en) | Recombinant human III type collagen and preparation method and application thereof | |
| CN116970067A (en) | Strategy for improving recombinant expression level of human serum albumin | |
| CN114561395A (en) | Soluble expression and high-efficiency purification method of fusion-tag-free rhIL-11 and mutant thereof | |
| CN114507293B (en) | Fusion protein for expressing linaclotide in gene recombination tandem and method for expressing linaclotide | |
| CN114933658B (en) | Short peptide element and application method thereof | |
| WO2003010204A1 (en) | Process for preparation of polypeptides of interest from fusion peolypeptides | |
| CN109942700A (en) | A kind of recombinant type buckwheat trypsase inhibitor mutant and trypsase affinitive material | |
| CN114908113A (en) | Preparation method of human interleukin-5 recombinant protein | |
| CN112646044B (en) | TFF2-Fc fusion protein and high-efficiency expression production method thereof | |
| CN111019927B (en) | Recombinant plasmid for expressing TEV protein, recombinant engineering bacterium and method for preparing and purifying TEV protein | |
| CN110093394B (en) | Protein inclusion body and preparation method of recombinant human beta-nerve growth factor | |
| CN102925470B (en) | A kind of method of recombinant expressed production human thymosin in yeast | |
| CN110982808A (en) | Kex2 enzyme variants and methods for stable expression | |
| CN111575314A (en) | Application of stable urokinase receptor mutant suPARcc in eukaryotic extracellular protein expression | |
| CN114350587B (en) | Engineering bacterium for expressing linaclotide by gene recombination in series | |
| CN114075295B (en) | Efficient renaturation solution of Boc-human insulin fusion protein inclusion body and renaturation method thereof | |
| CN112522234B (en) | Preparation method of restriction endonuclease FseI | |
| CN116949086A (en) | Method for recombinant expression of hemoglobin by Kluyveromyces marxianus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |