CN114557991A - New application of methyl ferulic acid as miR-378b inhibitor and application thereof - Google Patents
New application of methyl ferulic acid as miR-378b inhibitor and application thereof Download PDFInfo
- Publication number
- CN114557991A CN114557991A CN202210250394.0A CN202210250394A CN114557991A CN 114557991 A CN114557991 A CN 114557991A CN 202210250394 A CN202210250394 A CN 202210250394A CN 114557991 A CN114557991 A CN 114557991A
- Authority
- CN
- China
- Prior art keywords
- mir
- ferulic acid
- methyl ferulic
- methyl
- liver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
- A61P5/50—Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
Abstract
The invention relates to the technical field of medicines, in particular to a new application of methyl ferulic acid as a miR-378b inhibitor and an application thereof. The invention discloses the application of methyl ferulic acid as a miR-378b inhibitor in preventing or treating hepatic glycolipid metabolic disorder for the first time. The methyl ferulic acid can reverse the high expression of miR-378b in liver and cells caused by alcohol, in addition, the methyl ferulic acid effectively up-regulates PI3K-AKT and CaMKK2-AMPK signal pathways by inhibiting the expression of miR-378b, reduces liver lipid deposition, promotes cell glycogen synthesis, relieves liver inflammatory reaction and liver injury, and improves the sugar tolerance and insulin sensitivity of mice, thereby achieving the effect of preventing or treating the hepatic glycolipid metabolic disorder, and being used as a medicament for preventing or treating the hepatic glycolipid metabolic disorder. The invention provides a solid theoretical basis for clinically applying the methyl ferulic acid as the miR-378b inhibitor to prevent and treat the hepatic glycolipid metabolic disorder, is beneficial to promoting the clinical application of the methyl ferulic acid, and has a good application prospect.
Description
Technical Field
The invention relates to the technical field of medicines, in particular to a new application of methyl ferulic acid as a miR-378b inhibitor and an application thereof.
Background
The liver, as a central organ of glycolipid metabolism, can maintain the energy homeostasis of the body. The liver is one of the major target organs for insulin action and catabolism, and is also the locus where insulin resistance occurs. Insulin resistance results in a decrease in the biological effects of insulin on insulin-sensitive tissues, including the liver, as evidenced by increased hepatic glycogen output, decreased glucose uptake, decreased glycogen synthesis, and ultimately, hepatic glycolipid metabolism. In recent years, epidemiological investigation at home and abroad finds that the intake of ethanol is closely related to insulin resistance, insulin secretion dysfunction and high incidence of metabolic syndrome. Due to long-term alcoholism, alcohol damages liver and non-liver tissues, and endogenous Fatty Acid (FA) and Triglyceride (TG) of the liver are increased, so that TG is seriously accumulated in the liver to induce hepatic steatosis, and the accumulated fat can reduce the sensitivity of liver cells to insulin to form a vicious circle.
microRNA (miRNA) is an endogenous non-coding RNA with a regulation function, and is found in eukaryotes, and the size of the RNA is about 22 nucleotides. Recent years have seen increasing research that mirnas are involved in various biological processes related to glycolipid metabolism, including fat differentiation, lipid metabolism, and improvement of insulin sensitivity, etc., and play an important role in the progression of metabolic diseases. miR-378b is a member of the miR-378 family, and is a homologous sequence. Numerous studies have shown that miR-378b is ubiquitously expressed in many tissues. The document reports that miR-378a-3p has multi-level regulation and control effects on key genes of lipid metabolism and insulin signal transduction. In addition, in fatty liver and HepG2 cells of obese mice fed a high-fat diet, the expression of miR-378 was significantly up-regulated, disrupting glycolipid metabolic homeostasis. Recent studies have shown that expression of miR-378b is significantly elevated in ALD mouse liver and L-02 cells and impairs hepatic glycolipid metabolic processes by targeting IR and p110 α in the PI3K-AKT pathway and CaMKK2 in the CaMKK2-AMPK pathway.
The active development of clinical research on effective Chinese herbal medicines and monomer medicines thereof for preventing and treating the peripheral hepatic glycolipid metabolism disorder caused by alcohol becomes a new subject facing the field of glycolipid metabolism. Methyl Ferulic Acid (MFA) is an organic acid compound extracted from stem bark of Cicada-pterogyne of Guangxi ethnic characteristics Chinese herbal medicine, and has a chemical name of 3, 4-dimethoxy-cinnamic acid, and a molecular structural formula shown in the specification. MFA's effects of antioxidant stress, anti-inflammatory, anti-apoptotic, and liver protection have been previously demonstrated. Recent studies show that MFA regulates the progression of alcohol-induced hepatic insulin resistance and hepatic steatosis through a PI3K/AKT pathway and an AMPK pathway, thereby improving hepatic glycolipid metabolic disorders. However, specific targets and modes of regulation of MFA action need to be further explored. At present, products related to miRNA inhibitors for improving the metabolic disorder of the hepatic glycolipid are few, and the effect of MFA serving as a miR-378b inhibitor in preventing and treating the metabolic process of the hepatic glycolipid is not reported.
The molecular structural formula of the methyl ferulic acid is as follows:
。
disclosure of Invention
The invention aims to provide a new application of methyl ferulic acid.
The technical scheme of the invention is as follows:
the new application of the methyl ferulic acid as the miR-378b inhibitor comprises the following processes:
s1, reducing the area of hepatic steatosis and liver injury by inhibiting the size and the number of hepatic fat vacuoles caused by overexpression of miR-378b through methyl ferulic acid;
s2, the impaired glucose tolerance state of the miR-378b over-expression mouse is improved by the methyl ferulic acid;
s3, activating a PI3K-AKT signal pathway by inhibiting the expression of miR-378b through methyl ferulic acid, and relieving the insulin resistance of the liver of a mouse;
s4, the methyl ferulic acid activates a CaMKK2-AMPK signal pathway to inhibit liver lipid deposition by inhibiting the expression of miR-378b, and improves glycolipid metabolism.
Further, the miR-378b gene is used as an action target of the methyl ferulic acid.
Further, the miR-378b gene targets these target genes by binding to IR, p110 α, and CaMKK 23' UTR.
Further, the implementation of the invention also provides a miR-378b overexpression regulator, the complete sequence of the mouse miR-378b is amplified from mouse genome DNA by a PCR method, cloned into pAAV-MCS cut by BamHI and HindIII, and packaged with the recombinant AAV adeno-associated virus vector.
Further, the modulators include miR-378b mimetics capable of inducing hepatic insulin resistance and hepatic steatosis. The miR-378b simulant is purchased from a product of Shanghai Jikai Gene medicine science and technology GmbH, and the base sequence disclosed by the miR-378b simulant is as follows:
ACACTCCAGCTGGGAGTGGACTTGGAGTCA for positive direction;
and the reverse direction is CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCTTCTGA.
Furthermore, the methyl ferulic acid is used as a miR-378b inhibitor for preparing the medicine for treating the metabolic disorder of the hepatic glycolipid.
Further, the methyl ferulic acid can be made into tablet, capsule, granule or injection, with dosage of 1-100mg/kg methyl ferulic acid per day for administration in 2-3 times.
The technical scheme of the invention has the following beneficial effects:
the invention discloses the application of methyl ferulic acid as a miR-378b inhibitor in preventing or treating hepatic glycolipid metabolic disorder for the first time. The methyl ferulic acid can reverse the high expression of miR-378b in liver and cells caused by alcohol, in addition, the methyl ferulic acid effectively up-regulates PI3K-AKT and CaMKK2-AMPK signal paths by inhibiting miR-378b expression, reduces liver lipid deposition, promotes cell glycogen synthesis, relieves liver inflammatory reaction and liver injury, and improves mouse glucose tolerance and insulin sensitivity, thereby achieving the effect of preventing or treating hepatic glycolipid metabolic disorder, and being used as a medicament for preventing or treating hepatic glycolipid metabolic disorder.
The invention provides a solid theoretical basis for clinically applying the methyl ferulic acid as the miR-378b inhibitor to prevent and treat the hepatic glycolipid metabolic disturbance, is beneficial to promoting the clinical application of the methyl ferulic acid, and has better application prospect.
Drawings
FIG. 1 is a schematic diagram showing the pathological structural changes of the liver of the five groups of methyl ferulic acid in the example on alcohol-fed mice.
FIG. 2 is a graph showing the effect of methyl ferulic acid on the serological indicators of alcohol-fed mice according to the example;
wherein 2A is the level of TG in the liver of the mouse;
2B is the level of TC in the liver of the mouse;
2C is ALT level in mouse serum;
2D is AST levels in mouse serum;
2E is the glycogen content in the mouse liver;
2F is fasting blood glucose level;
2G is fasting serum insulin concentration;
2H is a steady state model assessment of the insulin resistance (HOMA-IR) index.
FIG. 3 is a graph showing the effect of methyl ferulic acid on insulin sensitivity in alcohol-fed mice according to the examples;
wherein 3A is the area under the glucose tolerance test and glucose tolerance curve (AUC);
3B is insulin tolerance test and AUC.
FIG. 4 is a graph showing the effect of methyl ferulic acid on miR-378b expression in the liver of an alcohol-fed mouse according to the example.
FIG. 5 is a schematic diagram of the effect of methyl ferulic acid on the liver morphology of miR-378b overexpression mice in the example.
FIG. 6 is a schematic diagram showing the effect of methyl ferulic acid on miR-378b expression of adeno-associated virus infected mice in example.
FIG. 7 is a schematic diagram showing the influence of methyl ferulic acid on the serological indicators of miR-378b overexpression mice in example;
wherein 7A is the level of TG in the liver of the mouse;
7B is glycogen content in mouse liver;
7C is the level of TC/TG in the serum of the mouse;
7D is the ALT/AST level in the serum of the mice.
FIG. 8 is a schematic diagram of the effect of methyl ferulic acid on the insulin sensitivity of miR-378b overexpression mice in example;
wherein 8A is glucose tolerance test and AUC;
8B is insulin tolerance test and AUC.
FIG. 9 is a schematic diagram of the influence of methyl ferulic acid on the sugar metabolism signal pathway of miR-378b overexpression mice in example;
wherein 9A is protein level of IR and p-IR after miR-378b overexpression is detected by a western blot method;
9B is the protein level of Akt1, Akt2, p-Akt1 and p-Akt2 after miR-378B overexpression is detected by a western blot method.
FIG. 10 is a schematic diagram of the effect of methyl ferulic acid on miR-378b overexpression mouse lipid metabolism signal pathway in example;
wherein 10A is protein level of FASN and SREBP-1c after miR-378b overexpression is detected by a western blot method;
10B is protein level of CPT-1 and PPAR after miR-378B overexpression is detected by a western blot method.
Detailed Description
The present invention will be described in detail with reference to specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
In an embodiment of the invention, establishing the animal model comprises: Lieber-Decalli alcohol liquid feed is fed to mice to generate hepatic steatosis and insulin resistance, and adeno-associated virus transfection is carried out to construct an animal model with miR-378b overexpression or knockdown.
Example 1: influence of methyl ferulic acid on miR-378b expression and glycolipid metabolism in liver of alcohol-fed mouse
1.1 embodiments
Group 1 was a normal control group: in the morning, the gavage drug solvent is 0.5 percent of CMC-Na, and the dosage is l0 mL/kg; a standard control liquid feed;
group 2 is the alcohol model group: in the morning, the gavage drug solvent is 0.5 percent of CMC-Na, and the dosage is l0 mL/kg; Lieber-DeCarli alcohol liquid feed;
group 3 is the methyl ferulic acid high dose treatment group: irrigating the stomach with methyl ferulic acid at a dose of 20mg/kg in the morning; Lieber-DeCarli alcohol liquid feed;
group 4 was medium dose treatment with methyl ferulic acid: irrigating the stomach with methyl ferulic acid at a dose of 10mg/kg in the morning; Lieber-DeCarli alcohol liquid feed;
1.2 establishment of animal models and intervention of methyl Ferulic acid
50 male mice, 4 weeks old, C57BL/6J, purchased from Schlekschada laboratory animals Co., Ltd, Hunan, weighed 20-25 g. Adaptive feeding was performed for 1 week, mice were randomly divided into 5 groups according to the embodiment, mice of the normal control group were given matching control liquid feed for 4 weeks, and finally were gavaged once a day with isocaloric dextrin. Mice in the model group and the methyl ferulic acid treatment group were fed with standard Lieber-DeCarli alcohol liquid feed for 4 weeks. The alcohol liquid feed contains 5% (v/v) ethanol, and the concentration of alcohol needs to be gradually increased in order to adapt to alcohol feeding. The last day was gavaged once with 20% ethanol. Model mice were gavaged with MFA or 0.5% CMC-Na, by weight, once daily for 2 weeks.
At the end of the experiment, mice were euthanized after anesthesia and serum and liver were immediately collected for subsequent assays.
1.3 Glucose Tolerance Test (GTT)
At the end of the 4-week end experiment, after the mice were fasted for 12 hours without water prohibition, 20% glucose solution (2 g/kg) was intraperitoneally injected, and glucose concentrations of rat tail venous blood 15min, 30min, 60min, and 120min after injection were measured using a glucometer to evaluate the glucose tolerance level of the mice.
Referring to fig. 3, the results show: compared with normal control group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to model group.
Compared with a normal control group, the mice fed with the alcohol liquid feed in the model group show abnormal glucose tolerance, and the glucose tolerance of the mice in the model group is reduced to different degrees after MFA treatment. Different degrees of improvement in glucose tolerance in mice were suggested following treatment with different concentrations of MFA (fig. 3A).
1.4 Insulin Tolerance Test (ITT)
After fasting for 6 hours, the mice were intraperitoneally injected with insulin injection (0.75U/kg), and blood glucose concentrations of tail veins 15min, 30min, 60min, 90 min, and 120min after insulin injection were measured using a glucometer, to evaluate insulin tolerance levels of the mice.
Referring to fig. 3, the results show: at the same time point, the blood sugar level of the mice fed with the alcohol liquid feed in the model group is obviously increased, and the sugar tolerance of the mice in the model group is reduced to different degrees after the MFA treatment. Suggesting that different concentrations of MFA treatment resulted in different degrees of improvement in glucose tolerance (fig. 3B).
1.5 detection of TG/TC, ALT/AST and glycogen levels in liver and serum
Liver samples of each group of mice are prepared into homogenate by using physiological saline or phosphate, or mouse serum is directly diluted in a certain proportion, and then TG/TC, ALT/AST and glycogen levels in the liver and the serum are measured by using a full-automatic biochemical analyzer and a commercial specific detection kit.
Referring to fig. 2, the results show: compared with the normal control group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to model group. The lipid content (TG/TC) in the liver of a mouse and the level of a biomarker (ALT/AST) of serum liver function are obviously increased by feeding the alcohol liquid feed, and the MFA treatment can effectively improve the in-vivo lipid metabolism abnormality caused by alcohol intake and reduce the liver injury induced by alcohol. The results suggest that MFA has a therapeutic effect on alcoholic lipid deposition and liver damage (fig. 2A-E).
1.6 serum blood glucose and insulin detection
The serum of the mice was diluted with physiological saline, and the blood glucose level was measured by a full-automatic biochemical analyzer using a glucose assay kit. The level of insulin in serum was measured according to the mouse insulin ELISA kit instructions from Crystal Chem, USA. The steady state model evaluation of insulin resistance (HOMA-IR) values were calculated according to the formula: fasting plasma glucose (mmol/L). times.fasting insulin (. mu.IU/mL)/22.5.
The results show that: compared with a normal control group mouse, the fasting blood glucose and the insulin level of the model group mouse are obviously increased, correspondingly, the HOMA-IR in the model group mouse is obviously increased, and the increase of the HOMA-IR of the alcohol-fed mouse is effectively reduced after the intervention of the methyl ferulic acid. These results suggest that methyl ferulic acid has an improving effect on hepatic insulin resistance caused by ethanol (FIGS. 2F-H).
1.7 hematoxylin-eosin staining (H & E)
After the collected liver specimen is fixed for about 24 hours by 4% paraformaldehyde, the liver specimen is embedded by liquid paraffin, and cut into 6μm sections for H & E. The pathological changes of the mouse liver tissue were then observed under an optical microscope.
The results show that: compared with the normal control group mouse, the liver of the model group mouse has obvious hepatic steatosis and is balloon-like, a plurality of lipid drop vacuoles with different sizes can be seen in liver cells, and the methyl ferulic acid treatment group effectively reverses liver pathological damage caused by alcohol diet (figure 1).
1.8 real-time fluorescent quantitative PCR (qRT-PCR) detection
Extraction of total RNA from liver tissue of the above mice was performed using TRIzol according to the instructions. Then, miRNA is subjected to reverse transcription by adopting a miRNeasy kit to obtain cDNA, and the miRNA is detected by a miRNA detection kit. Performing quantitative analysis on fluorescent quantitative PCR instrument (ABI 7500 thermolcycler) at 5 deg.C for 3 min; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 5s, annealing at 72 ℃ for 10s, and U6 as an internal reference for 40 cycles. Each sample was tested in triplicate and the data obtained was expressed as 2-ΔΔCtThe method is used for relative quantitative treatment.
The miR-378b simulant and U6 are both purchased from Shanghai Jikai Gene medicine science and technology Co., Ltd, and the primer sequences are as follows: miR-378b (forward: ACACTCCAGCTGGGAGTGGACTTGGAGTCA; reverse: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCTTCTGA), U6 (forward: CTCGCTTCGGCAGCACA; reverse: AACGCTTCACGAATTTGCGT).
Referring to fig. 4, the results show: compared with the normal control group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to the model group. miR-378b was significantly up-regulated in liver tissue of model group alcohol-fed mice, whereas miR-378b expression was significantly reduced after MFA treatment, however, there was no significant effect on miR-378b expression after MFA intervention at a dose of 5mg/kg (fig. 4). In conclusion, the results show that the medicament can reverse the high expression of alcohol-induced miR-378b to a certain extent, and the MFA plays the most effective therapeutic role when the dosage is 10mg/kg, so that the MFA of 10mg/kg is applied to the next animal experiment.
Experimental example 2 establishment of miR-378b overexpression animal model and mechanism for improving glycolipid metabolism by methyl ferulic acid
2.1 establishment of animal model with miR-378b overexpression
To modulate miR-378b expression in vivo, the entire miR-378b sequence was amplified from mouse genomic DNA by PCR techniques and cloned into BamHI and HindIII digested pAAV MCS. The miR-378b overexpressed adeno-associated virus vector and a corresponding negative control are ordered from the Shanghai Jikai gene company. The packaged adeno-associated virus was designated AAV-miR-378b-up, and other empty (untranslated) adeno-associated virus vectors were designated AAV-miR-378b-NC as negative controls. Then, C57BL/6J mice were randomly divided into 3 groups, namely, a.AAV-miR-378b-up-NC group, b.AAV-miR-378b-up group, c.AAV-miR-378b-up + MFA group. Injecting corresponding adeno-associated virus 200 μ L into tail vein of each mouse, the total amount is 1 × 1011v.g is added. The next day the molding phase was started and all mice were given standard control liquid feed for 4 weeks. In addition, AAV-miR-378b-up + MFA group mice were gavaged once daily for 2 weeks with MFA (10 mg/kg), while other groups were treated with a placebo treatment with 0.5% CMC-Na.
2.2 glucose tolerance test As in 1.3 above
Referring to fig. 8, the results show: compared with AAV-miR-378b-up NC group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to AAV-miR-378b-up group.
Compared with the AAV-up-NC control group mouse, the glucose tolerance level of the AAV-miR-378b-up group mouse is obviously improved. At the same time point, the blood glucose levels were significantly reduced and impaired glucose tolerance was improved in MFA-treated mice (fig. 8A).
2.3 insulin tolerance test As in 1.4 above
The results show that: compared with the AAV-up-NC control group mouse, the glucose tolerance level of the AAV-miR-378b-up group mouse is obviously improved. At the same time point, the blood glucose levels of mice in the administered group decreased significantly, suggesting increased sensitivity to insulin (fig. 8B).
2.4 detection of TG/TC, ALT/AST and glycogen levels in liver and serum as described above 1.5
The results show that: compared with mice in a miR-378b negative control group, the lipid content (TG/TC) in serum and liver and the level of serum hepatic function biomarkers (ALT/AST) of the mice in an AAV-miR-378b-up group are both obviously increased, and the MFA treatment can effectively improve lipid metabolism abnormality caused by overexpression of miR-378b and reduce ethanol-induced liver injury. Liver glycogen content was significantly reduced in mice of the miR-378b overexpressing group, compared to the AAV-up-NC control group, while glycogen levels were significantly increased after MFA treatment (FIGS. 7A-D). The above results suggest that MFA improves lipid deposition and glycogen synthesis by alcohol.
2.5 hematoxylin-eosin staining same as above 1.7
The results show that: compared with the AAV-up-NC control group, the AAV-miR-378b-up group mouse liver cell arrangement is disordered, lipid vacuoles are formed among liver cells, and steatosis is generated. After MFA treatment, the area and local necrosis of liver steatosis caused by miR-378b overexpression can be obviously reduced (figure 5).
2.6 real-time fluorescent quantitative PCR detection is as above 1.8
Referring to fig. 6, the results show: compared with AAV-miR-378b-up NC group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to AAV-miR-378b-up group. The expression level of the liver miR-378b of the AAV-miR-378b-up group mouse is obviously higher than that of the AAV-up-NC control group, and the increase of the miR-378b expression level caused by miR-378b overexpression is obviously reversed after MFA treatment (figure 6).
2.7 Western blot method for detecting protein level of key factor in glycolipid metabolic signal pathway
Extracting total protein in liver tissue by using precooled RIPA reagent. Equal amounts of protein were subjected to SDS-PAGE and samples were transferred to PVDF membrane under constant flow conditions. Sealing in 5% skimmed milk diluted by TBST at normal temperature for 1h, adding specific primary antibody, incubating overnight at 4 deg.C, and using horse radish peroxidase-labeled goat anti-mouse or horse radish peroxidase-labeled goat anti-rabbit antibody as secondary antibody. Finally, the protein bands were developed luminescently using enhanced chemiluminescence system (ECL) reagents.
The results show that: compared with AAV-miR-378b-up NC group, # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to AAV-miR-378b-up group. Compared with an AAV-up-NC control group, after the liver overexpresses miR-378b, the protein expression amounts of IR, p-Akt1 and p-Akt2 in the liver of AAV-miR-378b-up mice are obviously reduced, and the MFA treatment can reverse the effect after miR-378b overexpression. It is suggested that MFA may regulate insulin signaling pathway in vivo, at least in part, via miR-378B, improving hepatic insulin resistance (fig. 9A-B).
Furthermore, referring to FIG. 10, the results show that # p < 0.05, # p < 0.01; p < 0.05, p < 0.01 compared to AAV-miR-378b-up group. Compared with AAV-up-NC control group, the protein expression levels of lipid synthesis genes FASN and SREBP-1c in the liver of AAV-miR-378B-up group mouse are obviously increased, the protein expression levels of lipid oxidative degradation genes CPT1 and PPAR are reduced, and the effect of miR-378B after over-expression can be reversed after MFA treatment (figure 10A-B). Suggesting that MFA may inhibit lipid synthesis and promote lipid oxidative degradation at least partially through miR-378b in vivo.
By combining the results, the invention fully discloses that the methyl ferulic acid can obviously improve the hepatic steatosis, the glucose tolerance and the insulin resistance of mice caused by alcohol by regulating the expression of miR-378b, and confirms that the methyl ferulic acid can regulate the hepatic glycolipid metabolism by inhibiting the expression of miR-378 b. Therefore, the methyl ferulic acid is expected to be developed into a preparation for preventing and treating the metabolic disorder of the hepatic glycolipid, provides a new idea for the development of related medicaments in the later period, and has great social significance and market prospect.
The above description is a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and those skilled in the art can make appropriate adjustments or modifications without departing from the principle of the present invention, and the adjustments or modifications should also fall within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the protection scope of the claims.
Claims (6)
1. The new application of the methyl ferulic acid as the miR-378b inhibitor is characterized by comprising the following steps:
s1, reducing the area of hepatic steatosis and liver injury by inhibiting the size and the number of hepatic fat vacuoles caused by overexpression of miR-378b through methyl ferulic acid;
s2, the impaired glucose tolerance state of the miR-378b over-expression mouse is improved by the methyl ferulic acid;
s3, activating a PI3K-AKT signal channel by inhibiting the expression of miR-378b through methyl ferulic acid, and relieving the insulin resistance of the liver of a mouse; s4, activating a CaMKK2-AMPK signal channel by inhibiting the expression of miR-378b to inhibit liver lipid deposition and improve glycolipid metabolism.
2. The new use of methyl ferulic acid as an inhibitor of miR-378b according to claim 1, which is characterized in that: the miR-378b gene is used as an action target of the methyl ferulic acid.
3. The new use of methyl ferulic acid as an inhibitor of miR-378b according to claim 2, which is characterized in that: the miR-378b gene targets the target genes by binding to IR, p110 alpha and CaMKK 23' UTR.
4. The novel use of methyl ferulic acid as a miR-378b inhibitor according to claim 1, which is characterized in that: and also provides a miR-378b overexpression regulator, the full sequence of the mouse miR-378b is amplified from mouse genome DNA by a PCR method, cloned into the pAAV-MCS cut by BamHI and HindIII, and packaged with the recombinant AAV adeno-associated virus vector.
5. Use of methyl ferulic acid according to any one of claims 1 to 4 as an inhibitor of miR-378b in the preparation of a medicament for treating hepatic glycolipid metabolic disorders.
6. Use according to claim 5, characterized in that: the methyl ferulic acid can be made into tablet, capsule, granule or injection, and the dosage is 1-100mg/kg methyl ferulic acid/day, and can be administered in 2-3 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210250394.0A CN114557991A (en) | 2022-03-15 | 2022-03-15 | New application of methyl ferulic acid as miR-378b inhibitor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210250394.0A CN114557991A (en) | 2022-03-15 | 2022-03-15 | New application of methyl ferulic acid as miR-378b inhibitor and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114557991A true CN114557991A (en) | 2022-05-31 |
Family
ID=81719521
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210250394.0A Withdrawn CN114557991A (en) | 2022-03-15 | 2022-03-15 | New application of methyl ferulic acid as miR-378b inhibitor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114557991A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102940621A (en) * | 2012-11-27 | 2013-02-27 | 桂林医学院 | Application of methyl ferulic acid in preparation of medicine for preventing and curing hepatic fibrosis |
| CN105582003A (en) * | 2016-02-26 | 2016-05-18 | 桂林医学院 | Application of methyl ferulic acid in preparation of medicine for preventing and treating alcoholic liver disease |
-
2022
- 2022-03-15 CN CN202210250394.0A patent/CN114557991A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102940621A (en) * | 2012-11-27 | 2013-02-27 | 桂林医学院 | Application of methyl ferulic acid in preparation of medicine for preventing and curing hepatic fibrosis |
| CN105582003A (en) * | 2016-02-26 | 2016-05-18 | 桂林医学院 | Application of methyl ferulic acid in preparation of medicine for preventing and treating alcoholic liver disease |
Non-Patent Citations (2)
| Title |
|---|
| QI CHENG: "Ethanol-Induced Hepatic Insulin Resistance is Ameliorated by Methyl Ferulic Acid Through the PI3K/AKT Signaling Pathway", FRONTIERS IN PHARMACOLOGY * |
| YAN ZHANG: "Methyl ferulic acid ameliorates alcohol-induced hepatic insulin resistance via miR-378b-mediated activation of PI3K-AKT pathway", BIOMEDICINE & PHARMACOTHERAPY * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Leick et al. | PGC-1α is required for AICAR-induced expression of GLUT4 and mitochondrial proteins in mouse skeletal muscle | |
| Ying et al. | Phloretin protects against cardiac damage and remodeling via restoring SIRT1 and anti-inflammatory effects in the streptozotocin-induced diabetic mouse model | |
| Wei et al. | Mechanism of Astragalus polysaccharides in attenuating insulin resistance in Rats with type 2 diabetes mellitus via the regulation of liver microRNA‑203a‑3p | |
| Wan et al. | PGC1α protects against hepatic steatosis and insulin resistance via enhancing IL10‐mediated anti‐inflammatory response | |
| Fang et al. | Crocin improves insulin sensitivity and ameliorates adiposity by regulating AMPK-CDK5-PPARγ signaling | |
| Wu et al. | Metformin regulating miR-34a pathway to inhibit Egr1 in rat mesangial cells cultured with high glucose | |
| Li et al. | SERPINA3C ameliorates adipose tissue inflammation through the Cathepsin G/Integrin/AKT pathway | |
| Wang et al. | MicroRNA-21 and microRNA-146a negatively regulate the secondary inflammatory response of microglia after intracerebral hemorrhage | |
| Deng et al. | miR-671-5p attenuates neuroinflammation via suppressing NF-κB expression in an acute ischemic stroke model | |
| Jiang et al. | cGAS-STING signaling pathway promotes hypoxia-induced renal fibrosis by regulating PFKFB3-mediated glycolysis | |
| Shi et al. | LncRNA-MALAT 1 regulates cardiomyocyte scorching in diabetic cardiomyopathy by targeting NLRP3 | |
| CN114557991A (en) | New application of methyl ferulic acid as miR-378b inhibitor and application thereof | |
| Yoon et al. | Cyclophilin B, a molecule chaperone, promotes adipogenesis in 3T3‑L1 preadipocytes via AKT/mTOR pathway | |
| CN113209115A (en) | Medicine for treating intrahepatic cholestasis type liver injury | |
| CN114432333B (en) | Application of MiR-503 cluster sponge in preparation of medicine for treating type 2 diabetes | |
| CN112195181B (en) | Application of MiR-29sponge in preparation of medicine for treating type 2 diabetes | |
| Tian et al. | Spleen-kidney supplementing formula alleviates renal fibrosis in diabetic rats via TGF-β1-miR-21-PTEN signaling pathway | |
| CN110302209B (en) | miR-451a antisense chain inhibitor and application thereof | |
| Shu et al. | Akebia saponin D from Dipsacus asper wall. Ex CB Clarke ameliorates skeletal muscle insulin resistance through activation of IGF1R/AMPK signaling pathway | |
| CN111110868B (en) | NR2F6 gene and application of coded protein thereof in preparation of medicines | |
| CN112294835B (en) | Application of LncRNA-266 in preparation of drug for inducing differentiation of brown adipocytes | |
| Yu et al. | Atractylodin alleviates cancer anorexia-cachexia syndrome by regulating NPY through hypothalamic Sirt1/AMPK axis-induced autophagy | |
| CN115590844B (en) | Application of mesaconic acid in preparation of medicine for preventing or treating metabolic syndrome | |
| Li et al. | Decrypting the circular RNAs does a favor for us: Understanding, diagnosing and treating diabetes mellitus and its complications | |
| Ke et al. | HBC-embedded resveratrol regulates gut microbiota to prevent NAFLD via activating AMPK signaling pathway |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20220531 |
|
| WW01 | Invention patent application withdrawn after publication |