CN114540328A

CN114540328A - Temperature-sensitive alpha-amylase and preparation method and application thereof

Info

Publication number: CN114540328A
Application number: CN202210151867.1A
Authority: CN
Inventors: 王鸿; 余锦标; 魏斌; 周镇燚
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2022-02-18
Filing date: 2022-02-18
Publication date: 2022-05-27

Abstract

A temperature-sensitive alpha-amylase, a preparation method and application thereof, belonging to the technical field of biological engineering. The nucleotide sequence of the temperature-sensitive alpha-amylase is shown as SEQ ID NO 1, and the amino acid sequence is shown as SEQ ID NO 2. The preparation method of the temperature-sensitive type degree-sensitive alpha-amylase comprises the following steps: 1) obtaining a target gene sequence AAO78808.1 through genome analysis, removing signal peptide and obtaining SEQ ID NO 1 after codon optimization, and synthesizing the alpha-amylase target gene by an enterprise with the SEQ ID NO 1; 2) constructing a recombinant strain containing an alpha-amylase target gene; 3) and (3) expression and purification of the recombinant temperature-sensitive alpha-amylase. The temperature-sensitive alpha-amylase has good activity at 30-40 ℃, and has suddenly reduced activity and poor stability at 50 ℃. Can be used in textile, paper-making, detergent, fermentation and food industries, etc.

Description

Temperature-sensitive alpha-amylase and preparation method and application thereof

(I) technical field

The invention belongs to the technical field of bioengineering, and particularly relates to a temperature-sensitive alpha-amylase and a preparation method and application thereof.

(II) background of the invention

Amylases are a generic term for a series of enzymes that hydrolyze starch molecules to produce glucose, maltose, cyclodextrins, and the like. Amylases can be classified as alpha-amylase, beta-amylase or gamma-amylase, depending on the type of isomerism of the enzymatic product; amylases are classified into acid amylases, neutral amylases, alkaline amylases, low-temperature amylases, temperature-sensitive amylases, high-temperature amylases, and the like, according to the enzymatic properties. Wherein the alpha-amylase is also called alpha-1, 4-glucan-4-glucan hydrolase, is an endonuclease, and can randomly act on alpha-1, 4 glycosidic bonds in starch molecules so as to release products such as glucose and the like.

Alpha-amylase has wide commercial application and is an important class of hydrolytic amylase preparations. In the production of baked goods such as bread, it is common to use alpha-amylase to reduce the fermentation time and the viscosity of the fermented dough, thereby improving the quality of bread and the production efficiency of products. Meanwhile, substances such as glucose and the like generated by hydrolyzing starch by alpha-amylase are beneficial to improving bread coloring, improving bread flavor and further increasing product competitiveness. However, the dosage of the enzyme preparation is not easy to master, and slight excess of the enzyme preparation can cause the problems of excessive degradation of starch, increase of viscosity of products such as bread and the like. Therefore, temperature-sensitive alpha-amylases are now increasingly being used, since they can act in the early stages of production, become inactivated during baking and eventually lose their activity completely. And is different from low-temperature or high-temperature amylase, the optimal reaction temperature of the temperature sensitive amylase is 30-60 ℃, the energy consumption is lower, and the temperature sensitive amylase is more environment-friendly, so that the application of the temperature sensitive amylase in textile, paper making, detergents, fermentation and food industries is widened.

Disclosure of the invention

The invention aims to provide a temperature-sensitive alpha-amylase and a preparation method thereof, and the temperature-sensitive alpha-amylase has the advantages of high activity, low energy consumption, safety, environmental protection and the like.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a temperature-sensitive α -amylase, wherein the amino acid sequence of the temperature-sensitive α -amylase is as set forth in SEQ ID NO: 2, respectively.

In a second aspect, the invention provides a coding gene of the above temperature-sensitive α -amylase, wherein the nucleotide sequence of the coding gene is as shown in SEQ ID NO: 1 is shown.

In a third aspect, the present invention provides a recombinant expression plasmid into which the above-described coding gene is inserted.

Preferably, the recombinant expression plasmid is obtained by inserting the coding gene into BamHI and XhoI sites of pET-28a (+) vector.

In a fourth aspect, the invention provides a recombinant gene engineering bacterium containing the recombinant expression plasmid.

Specifically, the recombinant gene engineering bacterium is obtained by transferring the recombinant expression plasmid into a host cell E.coli BL21(DE 3).

In a fifth aspect, the invention provides an application of the recombinant genetic engineering bacteria in preparation of temperature-sensitive alpha-amylase.

Further, the recombinant gene engineering bacteria are prepared by the following method: the peptide as shown in SEQ ID NO: 1, inserting the coding gene shown in the specification into BamHI and XhoI sites of a pET-28a (+) vector to obtain a recombinant expression plasmid; transferring the recombinant expression plasmid into a host cell E.coli BL21(DE3) to obtain the recombinant gene engineering bacterium;

the application is as follows: inoculating the recombinant genetic engineering bacteria into an LB liquid culture medium containing kanamycin, culturing at 37 ℃ and 120rpm overnight, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.25mM, continuously culturing at 16 ℃ and 180rpm for 6-8 h, centrifuging, collecting thalli, resuspending obtained thalli precipitates by using PBS buffer solution, ultrasonically crushing in ice bath, centrifuging, and collecting supernatant, namely crude enzyme solution; the crude enzyme solution is purified by Ni-NTA agarose affinity resin: and (2) balancing the Ni-NTA agarose affinity resin by using an equilibrium buffer solution in sequence, washing the buffer solution to remove foreign proteins, separating target proteins by using an elution buffer solution, collecting the elution buffer solution containing the target proteins, and performing ultrafiltration and concentration to obtain the temperature-sensitive alpha-amylase.

Further, the composition of the equilibration buffer is: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, and a solvent of water;

the composition of the wash buffer was: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 20mM imidazole, and a solvent of water;

the composition of the elution buffer was: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 250mM imidazole, in water.

Preferably, the final concentration of kanamycin in the LB liquid medium containing kanamycin is 30. mu.g/mL.

Compared with the prior art, the invention has the beneficial effects that:

the temperature-sensitive alpha-amylase can be used in bakery food industries such as bread production and the like. The addition of alpha-amylase during production can help dough fermentation, increase production efficiency, and improve bread color and flavor. Meanwhile, the temperature-sensitive alpha-amylase can be gradually inactivated during bread baking, so that the problems of excessive degradation of starch and the like caused by continuous fermentation of the high-temperature alpha-amylase during baking can be effectively prevented.

The porous starch is modified starch obtained by physical, chemical or biological treatment, and is characterized in that pores extending to the interior of the starch granules exist on the surfaces of the starch granules. The porous structure has good adsorption capacity, so that the porous structure can be used as a microcapsule core material or an adsorbent and widely applied to the fields of medicine, chemical industry, food, agriculture and the like. Because starch is gelatinized at high temperature, temperature-sensitive alpha-amylase is often selected during the production of porous starch.

In order to prevent the fabric from breaking due to excessive tension in the weaving process in the modern textile industry, the slurry must be added in the process for protecting the fabric. Starch slurry is often used in industrial production because of its wide source, low cost, easy desizing, etc. When the temperature-sensitive alpha-amylase is applied to fabric desizing, the starch can be degraded into a water-soluble product, and the water-soluble product can be washed away more easily by water.

The temperature-sensitive alpha-amylase disclosed by the invention has higher activity and better stability, and can be applied to multiple aspects of spinning, papermaking, detergents, fermentation, food industry and the like.

(IV) description of the drawings

FIG. 1 is a glucose standard curve;

FIG. 2 the effect of different temperatures on enzyme activity;

FIG. 3 stability experiments of enzymes at different temperatures;

FIG. 4 effect of different pH on enzyme activity;

FIG. 5 stability experiments of enzymes at different temperatures;

FIG. 6 effect of metal ions and chelating agents on enzyme activity;

FIG. 7 is a Lineweaver-Burk plot of the enzymes;

FIG. 8 shows the result of TLC analysis of the enzymatic hydrolysate;

FIG. 9 shows the HPLC analysis results of the enzymatic products.

(V) detailed description of the preferred embodiments

The present invention is further illustrated by the following examples, which are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.

Example 1: preparation of temperature-sensitive alpha-amylase

Table 1 shows the experimental materials

Peptone	BECTON, DICKINSON AND Co.
		Yeast extract	BECTON, DICKINSON AND Co.
Sodium chloride	Aladdin
		Agar-agar	BECTON, DICKINSON AND Co.
Kanamycin sulfate (Kan)	Shanghai source leaf
		isopropylthio-beta-D galactoside (IPTG)	Biofrox Co Ltd
BCA protein concentration determination kit (enhancement type)	Biyuntian (a Chinese character)
		Ni-NTA agarose affinity resin	Kinseruit
Ultra-filtration tube	Merck Corp Ltd

LB liquid medium: peptone 1%, yeast extract 0.5%, sodium chloride 1%.

LB solid medium: peptone 1%, yeast extract 0.5%, sodium chloride 1%, agar 1% -2%.

IPTG mother liquor: weighing appropriate amount of isopropyl thio-beta-D galactoside (IPTG) powder, preparing into 100mM with pure water, filtering and sterilizing with 0.22 μm needle filter, subpackaging into 1.5mL centrifuge tubes, and storing at-20 deg.C for use.

Kan mother liquor: weighing appropriate amount of kanamycin sulfate (Kan) powder, preparing into 30mg/mL with pure water, filtering and sterilizing with 0.22 μm needle filter, subpackaging into 1.5mL centrifuge tubes, and storing at-20 deg.C for use.

And (3) an equilibrium buffer: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol.

Washing buffer solution: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 20mM imidazole.

Elution buffer: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 250mM imidazole.

The experimental steps are as follows:

(1) construction of recombinant Strain containing alpha-Amylase Gene

Obtaining an alpha-amylase initial sequence AAO78808.1 from EZbiocloud, removing a signal peptide, and performing codon optimization to obtain SEQ NO.1, wherein the SEQ NO.1 is handed over to a biological company to synthesize a target gene PL 2. Designing the restriction enzyme cutting site as BamHI/XhoI, and connecting the target gene with pET-28a (+) empty vector. And (2) carrying out competent mixing on the ligation product and a recipient bacterium TOP10, placing the mixture on ice for 10-15 min, immediately taking out the mixture after heat shock for 120s at 42 ℃, placing the mixture on ice for 2-5 min, adding 800 mu L of LB liquid culture medium, resuscitating the mixture at 37 ℃ and 200rpm for 45min, transforming part or all of the mixture to an LB agar plate containing 100 mu g/mL of kanamycin, carrying out overnight culture at 37 ℃, screening recombinant plasmids, and carrying out electrophoresis and sequencing verification on the recombinant plasmids. The sequencing primer sequences were as follows:

a forward primer:

T7:TAATACGACTCACTATAGGG

reverse primer:

T7ter:TGCTAGTTATTGCTCAGCGG

(2) induced expression of enzyme and preparation of crude enzyme solution

The recombinant plasmid verified to be correct was transformed into e.coli BL21(DE3) to obtain a recombinant strain containing the α -amylase gene. The recombinant strain containing the alpha-amylase gene was inoculated into LB/Kan solid plates (final Kan concentration 30. mu.g/mL) and cultured at 37 ℃ until single colony generation. Single colonies were picked and inoculated into 200mL LB/Kan liquid medium (final Kan concentration 30. mu.g/mL), cultured at 37 ℃ and 180rpm to OD₆₀₀0.6-0.8, adding IPTG to make the final concentration 0.25mM, continuing culturing at 16 deg.C and 180rpm for 6-8 h, and centrifuging at 8000rpm for 10min after induction. The bacteria is resuspended with 15ml PBS buffer solution, the bacteria is broken by ultrasonic under ice bath, centrifuged for 10min at 8000rpm, and the supernatant is collected as crude enzyme solution.

(3) Purification of enzymes

Adding appropriate amount of Ni-NTA agarose affinity resin into hollow tube of chromatography tube, draining the stock solution naturally, washing with pure water, and adding 4 times volume of balance buffer solution to balance the resin. And (3) absorbing the crude enzyme solution, mixing with the resin uniformly, and chelating for 3h at 4 ℃. Naturally draining the crude enzyme solution after chelation, washing the resin with 3 times of volume of balance buffer solution, washing buffer solution and elution buffer solution respectively, preserving the eluate respectively, and detecting and verifying the tube number and corresponding purity of the target protein by SDS-PAGE. Collecting target protein according to SDS-PAGE result, and obtaining alpha-amylase pure protein PL2 after ultrafiltration, concentration and desalination by a 30KDa ultrafiltration tube.

(4) Determination of enzyme concentration

Protein concentration in the specification is determined by using a BCA protein concentration determination kit.

An appropriate amount of 25mg/mL protein standard solution was diluted to 0.5mg/mL with PBS buffer. Adding the standard substance into standard substance wells of a 96-well plate according to 0, 1, 2, 4, 8, 12, 16 and 20 mu L, and adding the standard substance diluent to make up to 20 mu L. And diluting a proper amount of alpha amylase pure protein to a proper volume by using a buffer solution, and adding 20 mu L of the diluted alpha amylase pure protein into a sample well of a 96-well plate. According to the standard substance and the sample quantity, according to the volume ratio of BCA kit A liquid to BCA kit B liquid of 50: 1, preparing a proper amount of BCA working solution, and fully and uniformly mixing. Add 200. mu.L BCA working solution to each standard well and sample well and incubate at 37 ℃ for 30 min. And measuring the absorbance of each hole at 562nm by using a microplate reader, drawing a standard curve, and calculating the protein concentration in the sample according to the standard curve.

Example 2: enzymatic Properties of temperature-sensitive alpha Amylases

Glucose standard solution: accurately weighing 75.0mg of anhydrous glucose, adding a proper amount of pure water to dissolve the anhydrous glucose, and fixing the volume to a 25mL volumetric flask.

3, 5-dinitrosalicylic acid (DNS) developer solution: weighing 18.2g of sodium potassium tartrate in a small amount of distilled water, heating, adding 0.63g of 3, 5-dinitrosalicylic acid while the solution is hot, adding 26.2mL of 2mol/L NaOH aqueous solution, weighing 0.5g of phenol and 0.5g of anhydrous sodium sulfite, transferring the phenol and the anhydrous sodium sulfite into the prepared solution, stirring for dissolving, using distilled water to fix the volume to 100mL, and storing the solution in a dark place for one week.

Standard curve: taking 0, 20, 40, 60, 80 and 100 mu L of the glucose standard solution to a 1.5mL plastic centrifuge tube with the corresponding number, respectively adding 100, 80, 60, 40, 20 and 0 mu L of distilled water, respectively adding 100 mu L of DNS reagent, uniformly mixing, heating in a boiling water bath for 5min, respectively adding 800 mu L of distilled water to each test tube after cooling by running water, uniformly mixing, transferring 200 mu L of each test tube to a 96-well plate, detecting the absorbance of each test tube at 492nm by using a microplate reader, and drawing a standard curve by taking the mass concentration of the glucose as the abscissa and the absorbance (A492) as the ordinate.

(1) Effect of temperature on Amylase Activity

mu.L (2mg/mL) of PL2 enzyme solution was added with 95. mu.L of PBS and 100. mu.L of 1% soluble starch (dissolved in PBS), and incubated at different temperatures (20 ℃, 30 ℃, 40 ℃, 50 ℃, 60 ℃, 70 ℃, 80 ℃) for 30 min. Inactivating in boiling water bath for 5min after incubation, centrifuging to obtain 100 μ L supernatant, mixing with 100 μ L DNS detection solution, heating in boiling water bath for 5min, cooling with running water, adding 800 μ L pure water into reaction solution, and measuring absorbance at 492nm with 200 μ L. And calculating enzyme activity at different temperatures according to the enzyme activity definition, taking the maximum enzyme activity as 100%, calculating relative enzyme activity at other temperatures, and determining the optimal reaction temperature of the amylase. The result shows that the optimal reaction temperature of PL2 in starch hydrolysis is 40 ℃, the enzyme has better activity in the range of 20-50 ℃, and the enzyme activity is all above 50%. Along with the rise of the temperature, the enzyme activity is gradually reduced, the enzyme activity is rapidly reduced after the temperature is over 50 ℃, and the enzyme activity is almost 0 after the temperature is over 60 ℃.

(2) Thermal stability of Amylase

Taking 5 mu L (2mg/mL) of PL2 enzyme solution, adding 95 mu L PBS, preserving heat for 1h, 2h, 4h and 8h at different temperatures (30 ℃, 40 ℃ and 50 ℃), then adding 100 mu L of soluble starch, reacting for 30min at the optimum temperature (40 ℃), measuring the enzyme activity by a DNS method, taking the enzyme activity measured without heat preservation treatment at the optimum temperature as 100%, and calculating the relative enzyme activity under other conditions to judge the temperature stability. The results show that PL2 has good stability at incubation temperatures of 30 ℃ and 40 ℃, and the enzyme activity is substantially unchanged within 8 h. However, at 50 ℃ the activity of PL2 dropped sharply and was completely inactivated within 1 h.

(3) Effect of pH on Amylase

Taking 5 mu L (2mg/mL) of PL2 enzyme solution, adding 95 mu L of buffer solution with different pH values, adding 100 mu L of 1% soluble starch (dissolved by the buffer solution with different pH values), incubating for 30min at the optimal temperature (40 ℃), determining the enzyme activity by a DNS method, taking the maximum enzyme activity as 100%, and calculating the relative enzyme activity under the other conditions to determine the optimal pH value of the reaction. The result shows that the optimum pH of PL2 is 8.6, the enzyme activity is in an increasing trend within the pH range of 4-7, the enzyme activity has certain volatility within the pH range of 7-8.6, the enzyme activity is gradually reduced after the pH exceeds 8.6, and the enzyme activity is basically inactivated when the pH is 10.

(4) pH stability of Amylase

Taking 5 mu L (2mg/mL) of PL2 enzyme solution, adding 95 mu L of buffer solutions with different pH values (pH: 6, 7, 8, 8.6 and 9), respectively preserving heat for 1h, 2h and 4h at 4 ℃, then adding 100 mu L of 1% soluble starch (dissolved by the buffer solutions with different pH values), incubating for 30min at the optimum temperature (40 ℃), determining the enzyme activity by a DNS method, taking the enzyme activity measured when the enzyme is not treated under the optimum temperature and pH reaction conditions as 100%, and calculating the relative enzyme activity under the other conditions to judge the pH stability. The result shows that PL2 has good stability within the pH range of 6-9, and still has about 50% of activity at the lowest after the temperature is kept for 8 hours.

(5) Effect of Metal ions and chelating Agents on PL2 Activity

mu.L (2mg/mL) of PL2 enzyme solution was added to 93. mu.L of the optimum pH buffer solution, 100. mu.L of 1% soluble starch (dissolved in the optimum pH buffer solution), and 2. mu.L of each of the metal ion and the chelating agent was added to give a final concentration of 1 mM. Incubating for 30min at the optimum temperature (40 ℃), determining enzyme activity by a DNS method, taking the measured enzyme activity without adding metal ions or chelating agents as 100%, and calculating relative enzyme activity under the other conditions to judge the influence of different ions and chelating agents on the enzyme activity. The results show that Cu²⁺、Co²⁺Two kinds of metal ions with strong promoting effect on enzyme activity, Mg²⁺、Mn²⁺、Zn²⁺、Ba²⁺The four metal ions have stronger inhibition effect on enzyme activity, and the chelating agent EDTA can completely inhibit the enzyme activity.

(6) Determination of enzyme kinetic parameters

Under the optimal reaction condition, 100 mu L of soluble starch with the concentration of 0.1%, 0.2%, 0.4%, 0.6%, 0.8% and 1.0% respectively is added for reaction for 30min, the reciprocal of the substrate concentration is used as an abscissa, the reciprocal of the reaction rate is used as an ordinate, and K of the enzyme is calculated according to a linear regression equation_mAnd V_maxThe value is obtained. K is calculated according to a linear regression equation_mIs 1.17mg/mL, V_maxIs 32.0 mu mol/L min, R²Equal to 0.9985, R²The proximity to 1 indicates that the experimental results are reliable.

(7) Analysis of Amylase enzymatic hydrolysate

TLC product analysis

Analyzing the enzymolysis product by thin layer chromatography, mixing 400 μ L (0.2mg/mL) of PL2 enzyme solution with 400 μ L of 1% soluble starch substrate, reacting at optimum temperature, taking 200 μ L of reactant at 0.5h, 1h, 2h and 4h respectively, inactivating in 100 deg.C boiling water bath for 5min, centrifuging, and taking supernatant. Taking 2mg/mL maltose (maltobiose) and 2mg/mL glucose as standard substances, respectively taking the standard substances and reactants, spotting the standard substances and the reactants on a thin-layer chromatography plate by using capillary vessels, drying the thin-layer chromatography plate by blowing, and then placing the thin-layer chromatography plate in a spreading cylinder, wherein the composition and the volume ratio of a spreading agent are as follows: n-butanol: acetic acid: water: 3: 1. And taking out the chromatography plate when the liquid level moves to the edge of 1cm at the top end, drying by using a blower, and putting the chromatography plate into the layer spreading cylinder for spreading again. After the spreading layer is finished, soaking the spreading layer plate in 10% H₂SO₄Placing in ethanol solution for about half a minute, and heating in oven at 110 deg.C for 5min for color development. After color development, the enzymatic products at different time points are analyzed according to the chromatographic results of the standard. The results show that the degradation products in different time periods are all glucose, and no other products are generated.

2. High performance liquid chromatography

Sample preparation: 200. mu.L of each reaction and a blank were filtered through a 0.22 μm aqueous needle filter and then detected. The detection conditions were as follows:

liquid phase conditions: the mobile phase is pure water, the chromatographic column is TSK gel G3000Pwxl, the flow rate is 0.5mL/min, the sample injection volume is 10 mu L, and the collection time is 30 min.

A detector: an evaporative light scattering detector was used.

The results show that: as shown in fig. 9, the enzymatic hydrolysis product of PL2 was further determined to be glucose by comparing the peak time of glucose and maltose standards (maltobiose) with the enzymatic hydrolysis product.

Sequence listing

<110> Zhejiang industrial university

<120> temperature-sensitive alpha-amylase, preparation method and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2154

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

caacagaaac taacatcacc cgataataac ttggtcatga cctttcaggt tgatagcaag 60

ggcgcaccga cgtacgagct cacctacaaa aacaaagttg ttatcaagcc gagcaccctg 120

ggtttggagc tgaaaaaaga agataacacc cgtaccgatt ttgattgggt tgatcgtcgt 180

gatctgacca aattagactc gaagaccaat ttgtacgacg gtttcgaggt gaaagacacg 240

cagactgcta ccttcgatga gacgtggcag ccggtttggg gtgaagagaa agagatccgc 300

aaccactata acgagctggc ggtgactctg taccaaccga tgaatgatcg ctctattgtg 360

atccgctttc gtcttttcaa cgatggcctg ggttttcgtt acgaatttcc gcaacaaaaa 420

tccctgaatt acttcgtgat taaggaggaa cattcccagt tcggtatgaa cggtgaccac 480

attgcgtttt ggattccggg cgactatgat acccaagaat atgactacac catcagccgt 540

ttaagcgaaa ttcgcggtct gatgaaagag gcgattacgc caaactctag ccaaaccccg 600

tttagccaaa ccggcgttca gactgcctta atgatgaaaa ccgacgacgg cttgtacatc 660

aacttgcacg aagcggcttt ggtggattac agctgtatgc acctgaacct ggacgacaaa 720

aacatggtct tcgaaagctg gctgacccca gatgcgaagg gtgacaaagg ctatatgcag 780

accccgtgca acactccgtg gcgtacaatc atcgtgagcg atgatgcgcg caatattctg 840

gcgtcgcgca ttaccctgaa tttgaatgag ccgtgtaaaa tcgccgacgc cgctagctgg 900

gttaagccgg tgaagtatat cggtgtttgg tgggatatga ttactggaaa gggcagctgg 960

gcatataccg acgaattgac gtctgtgaag ctaggagaga ctgactactc caagacgaaa 1020

ccaaacggca aacactctgc gaataccgcg aatgttaagc gctacattga ttttgcggct 1080

gcgcatggtt tcgacgcggt tctggttgaa ggctggaacg agggctggga agattggttt 1140

ggtaacagca aggactacgt gttcgacttc gttacccctt atccggattt cgacgtcaag 1200

gagattcatc gttacgcggc tcgcaaaggc atcaagatga tgatgcacca cgaaaccagt 1260

gcgagcgttc gtaattacga acgtcatatg gacaaggcgt accagtttat ggcagacaac 1320

ggctataatt ccgtgaagtc cggttatgtg ggtaacatca ttccgcgtgg tgagcatcat 1380

tatggtcagt ggatgaacaa ccactacctg tacgccgtca agaaggcggc tgactataaa 1440

atcatggtga atgcacacga ggctacccgt ccgaccggta tctgccgtac ctacccgaac 1500

ctgattggta acgaatctgc cagaggcacc gaatacgaga gctttggtgg caacaaggtt 1560

tatcatacca ccatcctgcc gttcacccgt ttggtgggtg gtccgatgga ttacactccg 1620

ggtatttttg agacgcactg caacaagatg aatccggcaa acaactccca agtcagaagc 1680

accatagcgc gtcagctggc actgtatgtg accatgtatt ctccgctgca gatggctgcc 1740

gacatcccgg aaaactatga gcgcttcatg gatgcgtttc aattcattaa ggacgttgca 1800

ttggactggg atgaaacaaa ttacctggag gcggaaccgg gcgagtacat caccatcgcg 1860

cgtaaggcga aagacaccga tgactggtat gtagggtgca ccgcgggtga gaatggtcat 1920

acctccaagc tggttttcga cttcctgacg ccgggcaaac agtatatcgc taccgtttat 1980

gcagacgcga aagacgctga ttggaaagaa aatccccagg catacaccat caagaagggc 2040

atcctgacga acaaaagcaa gttgaatctc cacgctgcga acggcggtgg ctatgccatt 2100

tcgatcaagg aggttaaaga taaaagcgaa gccaaaggtc tgaaacgcct gtaa 2154

<210> 2

<211> 717

<212> PRT

<213> Bacteroides thetaiotaomicron

<400> 2

Gln Gln Lys Leu Thr Ser Pro Asp Asn Asn Leu Val Met Thr Phe Gln

1 5 10 15

Val Asp Ser Lys Gly Ala Pro Thr Tyr Glu Leu Thr Tyr Lys Asn Lys

20 25 30

Val Val Ile Lys Pro Ser Thr Leu Gly Leu Glu Leu Lys Lys Glu Asp

35 40 45

Asn Thr Arg Thr Asp Phe Asp Trp Val Asp Arg Arg Asp Leu Thr Lys

50 55 60

Leu Asp Ser Lys Thr Asn Leu Tyr Asp Gly Phe Glu Val Lys Asp Thr

65 70 75 80

Gln Thr Ala Thr Phe Asp Glu Thr Trp Gln Pro Val Trp Gly Glu Glu

85 90 95

Lys Glu Ile Arg Asn His Tyr Asn Glu Leu Ala Val Thr Leu Tyr Gln

100 105 110

Pro Met Asn Asp Arg Ser Ile Val Ile Arg Phe Arg Leu Phe Asn Asp

115 120 125

Gly Leu Gly Phe Arg Tyr Glu Phe Pro Gln Gln Lys Ser Leu Asn Tyr

130 135 140

Phe Val Ile Lys Glu Glu His Ser Gln Phe Gly Met Asn Gly Asp His

145 150 155 160

Ile Ala Phe Trp Ile Pro Gly Asp Tyr Asp Thr Gln Glu Tyr Asp Tyr

165 170 175

Thr Ile Ser Arg Leu Ser Glu Ile Arg Gly Leu Met Lys Glu Ala Ile

180 185 190

Thr Pro Asn Ser Ser Gln Thr Pro Phe Ser Gln Thr Gly Val Gln Thr

195 200 205

Ala Leu Met Met Lys Thr Asp Asp Gly Leu Tyr Ile Asn Leu His Glu

210 215 220

Ala Ala Leu Val Asp Tyr Ser Cys Met His Leu Asn Leu Asp Asp Lys

225 230 235 240

Asn Met Val Phe Glu Ser Trp Leu Thr Pro Asp Ala Lys Gly Asp Lys

245 250 255

Gly Tyr Met Gln Thr Pro Cys Asn Thr Pro Trp Arg Thr Ile Ile Val

260 265 270

Ser Asp Asp Ala Arg Asn Ile Leu Ala Ser Arg Ile Thr Leu Asn Leu

275 280 285

Asn Glu Pro Cys Lys Ile Ala Asp Ala Ala Ser Trp Val Lys Pro Val

290 295 300

Lys Tyr Ile Gly Val Trp Trp Asp Met Ile Thr Gly Lys Gly Ser Trp

305 310 315 320

Ala Tyr Thr Asp Glu Leu Thr Ser Val Lys Leu Gly Glu Thr Asp Tyr

325 330 335

Ser Lys Thr Lys Pro Asn Gly Lys His Ser Ala Asn Thr Ala Asn Val

340 345 350

Lys Arg Tyr Ile Asp Phe Ala Ala Ala His Gly Phe Asp Ala Val Leu

355 360 365

Val Glu Gly Trp Asn Glu Gly Trp Glu Asp Trp Phe Gly Asn Ser Lys

370 375 380

Asp Tyr Val Phe Asp Phe Val Thr Pro Tyr Pro Asp Phe Asp Val Lys

385 390 395 400

Glu Ile His Arg Tyr Ala Ala Arg Lys Gly Ile Lys Met Met Met His

405 410 415

His Glu Thr Ser Ala Ser Val Arg Asn Tyr Glu Arg His Met Asp Lys

420 425 430

Ala Tyr Gln Phe Met Ala Asp Asn Gly Tyr Asn Ser Val Lys Ser Gly

435 440 445

Tyr Val Gly Asn Ile Ile Pro Arg Gly Glu His His Tyr Gly Gln Trp

450 455 460

Met Asn Asn His Tyr Leu Tyr Ala Val Lys Lys Ala Ala Asp Tyr Lys

465 470 475 480

Ile Met Val Asn Ala His Glu Ala Thr Arg Pro Thr Gly Ile Cys Arg

485 490 495

Thr Tyr Pro Asn Leu Ile Gly Asn Glu Ser Ala Arg Gly Thr Glu Tyr

500 505 510

Glu Ser Phe Gly Gly Asn Lys Val Tyr His Thr Thr Ile Leu Pro Phe

515 520 525

Thr Arg Leu Val Gly Gly Pro Met Asp Tyr Thr Pro Gly Ile Phe Glu

530 535 540

Thr His Cys Asn Lys Met Asn Pro Ala Asn Asn Ser Gln Val Arg Ser

545 550 555 560

Thr Ile Ala Arg Gln Leu Ala Leu Tyr Val Thr Met Tyr Ser Pro Leu

565 570 575

Gln Met Ala Ala Asp Ile Pro Glu Asn Tyr Glu Arg Phe Met Asp Ala

580 585 590

Phe Gln Phe Ile Lys Asp Val Ala Leu Asp Trp Asp Glu Thr Asn Tyr

595 600 605

Leu Glu Ala Glu Pro Gly Glu Tyr Ile Thr Ile Ala Arg Lys Ala Lys

610 615 620

Asp Thr Asp Asp Trp Tyr Val Gly Cys Thr Ala Gly Glu Asn Gly His

625 630 635 640

Thr Ser Lys Leu Val Phe Asp Phe Leu Thr Pro Gly Lys Gln Tyr Ile

645 650 655

Ala Thr Val Tyr Ala Asp Ala Lys Asp Ala Asp Trp Lys Glu Asn Pro

660 665 670

Gln Ala Tyr Thr Ile Lys Lys Gly Ile Leu Thr Asn Lys Ser Lys Leu

675 680 685

Asn Leu His Ala Ala Asn Gly Gly Gly Tyr Ala Ile Ser Ile Lys Glu

690 695 700

Val Lys Asp Lys Ser Glu Ala Lys Gly Leu Lys Arg Leu

705 710 715

Claims

1. A temperature-sensitive α -amylase, characterized by: the amino acid sequence of the temperature-sensitive alpha-amylase is shown as SEQ ID NO: 2, respectively.

2. The gene encoding a temperature-sensitive α -amylase according to claim 1, wherein: the nucleotide sequence of the coding gene is shown as SEQ ID NO: 1 is shown.

3. The recombinant expression plasmid of claim 2 encoding a gene insertion.

4. The recombinant expression plasmid of claim 3, wherein: the recombinant expression plasmid is obtained by inserting the coding gene into BamHI and XhoI sites of pET-28a (+) vector.

5. A recombinant genetically engineered bacterium comprising the recombinant expression plasmid of claim 3.

6. The recombinant genetically engineered bacterium of claim 5, wherein: the recombinant gene engineering bacteria are obtained by transferring the recombinant expression plasmid into a host cell E.coli BL21(DE 3).

7. The use of the recombinant genetically engineered bacterium of claim 5 in the preparation of temperature-sensitive alpha-amylase.

8. The use of claim 7, wherein: the recombinant gene engineering bacteria are prepared by the following method: the peptide as shown in SEQ ID NO: 1, inserting the coding gene shown in the specification into BamHI and XhoI sites of a pET-28a (+) vector to obtain a recombinant expression plasmid; transferring the recombinant expression plasmid into a host cell E.coli BL21(DE3) to obtain the recombinant gene engineering bacterium;

9. The use of claim 8, wherein: the composition of the equilibration buffer is as follows: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, and a solvent of water; the composition of the wash buffer was: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 20mM imidazole, and a solvent of water; the composition of the elution buffer was: 20mM Tris, 500mM NaCl, 10% (v/v) glycerol, 250mM imidazole, in water.

10. The use of claim 8, wherein: in the LB liquid medium containing kanamycin, the final concentration of kanamycin is 30 mug/mL.