CN114539394B - SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody - Google Patents

SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody Download PDF

Info

Publication number
CN114539394B
CN114539394B CN202111663259.0A CN202111663259A CN114539394B CN 114539394 B CN114539394 B CN 114539394B CN 202111663259 A CN202111663259 A CN 202111663259A CN 114539394 B CN114539394 B CN 114539394B
Authority
CN
China
Prior art keywords
seq
cov
sars
antigen
nanobody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111663259.0A
Other languages
Chinese (zh)
Other versions
CN114539394A (en
Inventor
杨鹏远
王楷
刘兰兰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Biophysics of CAS
Original Assignee
Institute of Biophysics of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Biophysics of CAS filed Critical Institute of Biophysics of CAS
Priority to CN202111663259.0A priority Critical patent/CN114539394B/en
Publication of CN114539394A publication Critical patent/CN114539394A/en
Application granted granted Critical
Publication of CN114539394B publication Critical patent/CN114539394B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/165—Coronaviridae, e.g. avian infectious bronchitis virus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/10—Detection of antigens from microorganism in sample from host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a high affinity nanobody of camelid origin of SARS-CoV-2 alpha mutant strain and beta mutant strain, particularly to an antibody and antigen binding fragment thereof that specifically bind to S protein of coronavirus (e.g., SARS-CoV-2), more particularly to a camelid nanobody or antigen binding fragment thereof that can bind to S protein of coronavirus such as SARS-CoV-2 wild-type primary strain and mutant strain thereof (especially B.1.1.7 mutant strain and B.1.351 mutant strain) with high affinity, which can be used for preventing, detecting, diagnosing or treating infection caused by coronavirus, especially SARS-CoV-2 virus.

Description

SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody
Technical Field
The invention belongs to the fields of biotechnology, immunodetection and biological medicine, in particular relates to a broad-spectrum high-affinity antibody or antigen binding fragment and application thereof in detection, diagnosis, prevention and treatment of coronaviruses, and particularly relates to application in detection, diagnosis, prevention and treatment of SARS-CoV-2 wild-type original strain, B.1.1.7 mutant strain (namely alpha mutant strain) and/or B.1.351 mutant strain (namely beta mutant strain).
Background
The novel coronavirus SARS-CoV-2 is a beta-coronavirus RNA virus. The virus has the characteristics of strong transmissibility, high mortality, high mutation speed and the like. SARS-CoV-2 causes respiratory tract infections, resulting in viral pneumonia and Acute Respiratory Distress Syndrome (ARDS) in some patients. At the same time, cytokine storm can be caused, and multi-organ injury is caused. The original strain of the novel coronavirus is separated until now, and the novel mutant strain viruses such as a D614G mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a B.1.429 mutant strain, a P.1 mutant strain, a B.1.617.2 mutant strain and the like continuously appear in the global transmission process, so that the transmission and the mortality of the viruses are greatly enhanced, and the vaccine protection capability is continuously reduced.
Some small molecule drugs and interferons are used for antiviral treatment in patients with covd-19, however, clinical results have been shown to be ineffective or have limited therapeutic effect only in the early stages of viral infection, with a serious series of drug side effects. Studies have demonstrated that antibody treatment strategies are the best solution for treating coronavirus patients, especially middle and late stage patients. Treatment of new coronavirus patients with post-cure patient serum containing high amounts of neutralizing antibodies is an effective treatment strategy. However, the limitation of patient serum therapy is that the plasma of the convalescence patient is difficult to obtain, the quantity is small, and the requirement of a huge patient group cannot be met, so that alternative engineering antibodies are needed for treatment.
Nanobodies (nanobodies) are single-domain antibodies that contain only the heavy chain antibody antigen-binding domain VHH, and have a number of distinct advantages over traditional polyclonal, monoclonal, and single-chain antibodies, such as small size, and can pass through tissues and organs (e.g., tunica vaginalis, spinal cord, brain, etc.) that are inaccessible to conventional antibodies; the stability is strong, and cold chain transportation and cold storage are not needed; low immunogenicity and easy humanized reconstruction. The invention takes the Spike protein (Spike protein, S protein) on the surface of SARS-CoV-2 virus as a target, and builds phage display nano antibody immune library and biopanning to develop camel-source high-affinity nano antibody capable of identifying various SARS-CoV-2 virus mutant strains simultaneously, thus laying foundation for mechanism research, clinical diagnosis and treatment of new coronapneumonia.
Disclosure of Invention
The invention aims to solve the technical problem of providing a broad-spectrum high-affinity antibody aiming at coronaviruses, which can effectively detect, block and treat coronaviruses, especially SARS-CoV-2 virus original strain and mutant strain thereof.
In a specific embodiment of the invention, nanobodies against coronaviruses such as SARS-CoV-2 are provided which bind to the S1 subunit of the S protein (also known as S1 protein) of the original strain (Wild Type), the British mutant strain (B1.1.7), the south Africa mutant strain (B.1.351), with affinities on the order of nanomolar.
In a specific embodiment of the present invention, nanobodies against coronaviruses such as SARS-CoV-2 are provided that are capable of effectively blocking infection of hACE2 overexpressing 293T cells by SARS-CoV-2 pseudovirus at semi-effective neutralization concentrations up to nanomolar levels.
In particular embodiments of the invention, the establishment of a variety of ELISA detection methods based on antigen/antibody reactions and the development of detection products can be performed.
In particular embodiments of the invention, isomorphous or multiple nanobody-based multivalent isogenetic engineering may be performed.
In a specific embodiment of the present invention, nanobodies against coronaviruses such as SARS-CoV-2 are provided, comprising the following amino acid sequences and functional properties:
i) Amino acid sequences shown in SEQ ID NO. 1-6; alternatively, the antibody may have the amino acid sequence of CDR1 of any one of SEQ ID NOS.7-11; the amino acid sequence of CDR2 of the hypervariable region shown in any one of SEQ ID NOs 12 to 16; and the hypervariable region CDR3 amino acid sequence shown in any one of SEQ ID NOS.17-22;
ii) the nanobody has nanomolar affinity with coronaviruses such as SARS-CoV-2 virus Wild Type original strain, B.1.1.7 mutant strain and B.1.351 mutant strain;
iii) The nano antibody effectively blocks the infection of 293T cells over-expressed by the hACE2 by SARS-CoV-2 pseudovirus.
The invention also provides a biological material containing the nucleic acid molecule for encoding the antibody, wherein the biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a phage vector, a viral vector or engineering bacteria.
The invention also provides any one of the following uses of the antibody:
1) Scientific research related to coronaviruses such as SARS-CoV-2 virus original strain and its mutant strain;
2) The method is used for detecting S protein on the surface of coronavirus such as SARS-CoV-2 virus original strain and mutant strain thereof;
3) Is used for developing coronaviruses such as SARS-CoV-2 virus original strain and mutant strain detection reagent or ELISA detection reagent.
In the invention, when analyzing and detecting, different concentrations of the nano antibodies are added into each hole of an ELISA plate coated with coronavirus such as SARS-CoV-2 virus Wild Type original strain, B.1.1.7 mutant strain and B.1.351 mutant strain antigens, and as the content of solid phase antigen in each hole is consistent, when the amount of the antibodies combined on the solid phase antigen is less, the combined amount of the added ELISA secondary antibodies and the combined nano antibodies is less, and finally substrate solution and developing solution are added, the developing reaction is shallow, and the OD value detected by an ELISA instrument is low; on the contrary, when the nano-antibody is combined with the solid phase antigen, the measured OD value is high, and the combination curve of the nano-antibody and SARS-CoV-2 is drawn according to the added nano-antibody amount and the OD value of the corresponding hole.
Specifically, the invention provides the following technical scheme:
1. an antibody or antigen binding fragment thereof, the amino acid sequence of which comprises a CDR1 as shown in any one of SEQ ID NO's 7-11, a CDR2 as shown in any one of SEQ ID NO's 12-16, a CDR3 as shown in any one of SEQ ID NO's 17-22;
preferably, the antigen binding fragment is, for example, fv, fab, fab ', scFv, F (ab') 2 Multivalent or multispecific fragments.
2. The antibody or antigen-binding fragment according to item 1, wherein the amino acid sequence is as shown in any one of SEQ ID NOs 1 to 6;
or the antibody or antigen binding fragment is an antibody comprising a sequence obtained by truncating amino acids 1 to 128 from the N terminal of any one of the sequences shown in SEQ ID NO. 1-6, or an antibody or antigen binding fragment with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues of any one of the sequences shown in SEQ ID NO. 1-6.
3. A genetically engineered antibody comprising the antibody or antigen binding fragment of item 1 or 2; preferably, the genetically engineered antibody is a humanized antibody, chimeric antibody, multivalent or multispecific antibody.
4. A fusion protein comprising the antibody or antigen-binding fragment of item 1 or 2 or the genetically engineered antibody of item 3; preferably, the fusion protein further comprises a tag polypeptide, a detection protein or an accessory protein.
5. A conjugate comprising the antibody or antigen-binding fragment of item 1 or 2 or the genetically engineered antibody of item 3 or the fusion protein of item 4; preferably, the conjugate further comprises a detectable label, a contrast agent, a drug, a cytokine, a radionuclide, an enzyme, a gold nanoparticle/nanorod, a nanomagnetic particle, a liposome, a viral coat protein, or VLP, or a combination thereof.
6. A nucleic acid molecule encoding the antibody or antigen binding fragment of clauses 1-2, the genetically engineered antibody of clause 3, the fusion protein of clause 4, or the conjugate of clause 5, wherein the nucleic acid molecule is RNA, DNA, or cDNA.
7. An expression vector comprising the nucleic acid molecule of item 6;
optionally, the expression vector may be a DNA, RNA, viral vector, plasmid, expression cassette, transposon, other gene transfer system, or a combination thereof;
preferably, the expression vector comprises a viral vector, such as a phage vector, lentivirus, adenovirus, AAV virus, retrovirus, other protein expression system, or a combination thereof.
8. A host cell comprising the expression vector of item 7; wherein the host cell is a host cell for expressing a foreign protein, e.g., a prokaryotic expression cell, a eukaryotic expression cell, a transgenic cell line; preferably, the host cell comprises a prokaryotic cell, a yeast cell, an insect cell, a plant cell, an animal cell.
9. A tissue sample or culture obtained by culturing the host cell of clause 8.
10. A protein or antigen binding fragment isolated from the tissue sample or culture of item 9.
11. A method of making the antibody or antigen-binding fragment of clauses 1-2, the genetically engineered antibody of clause 3, the fusion protein of clause 4, or the conjugate of clause 5, comprising isolating/recovering the protein or antigen-binding fragment of interest from the tissue sample or culture of clause 9.
12. A pharmaceutical composition comprising the antibody or antigen-binding fragment of item 1 or 2 or the genetically engineered antibody of item 3 or the fusion protein of item 4 or the conjugate of item 5 as an active ingredient; for example, the pharmaceutical composition is an inhaled aerosolized drug, a mucosal or epidermal drug, a subcutaneous drug, a vascular infusion drug, or a combination thereof; preferably, the medicament further comprises a pharmaceutically acceptable excipient or carrier.
13. A product comprising the antibody or antigen binding fragment of item 1 or 2 or the genetically engineered antibody of item 3 or the fusion protein of item 4 or the conjugate of item 5; for example, the product is a mask or air purifier cartridge, an environmental, object, or body surface disinfectant, or a combination thereof; preferably, the product is coated in a purifier cartridge or dissolved in a disinfectant for atomized spraying or surface wiping.
14. Use of the antibody or antigen binding fragment of item 1 or 2 or the genetically engineered antibody of item 3 or the fusion protein of item 4 or the conjugate of item 5 in the manufacture of a product or medicament for the prevention, treatment and/or diagnosis of a coronavirus infection.
15. Use of the antibody or antigen binding fragment of item 1 or 2 or the genetically engineered antibody of item 3 or the fusion protein of item 4 or the conjugate of item 5 in the preparation of a product for:
1) Detecting coronavirus antigens, in particular SARS-CoV-2 virus original strain and mutant strain thereof;
2) Blocking coronavirus infection, especially SARS-CoV-2 virus original strain and mutant strain thereof;
3) Killing coronavirus particles, especially SARS-CoV-2 virus original strain and mutant strain thereof;
4) Diagnosing coronavirus-induced related diseases, especially SARS-CoV-2 virus original strain and mutant strain thereof;
5) Treating diseases caused by coronavirus, especially SARS-CoV-2 virus original strain and mutant strain thereof;
6) Basic scientific research related to coronaviruses, in particular SARS-CoV-2 virus original strain and mutant strain thereof, was performed.
In particular embodiments of the invention, the coronavirus comprises HCoV-NL63, SARS-CoV-1, SARS-CoV-2, HCoV-229E, MERS-CoV, HCoV-OC43, HCoV-HKU1 or other coronavirus having a similar surface S protein structure.
In particular embodiments of the invention, mutants of SARS-CoV-2 virus include D614G mutant, B.1.1.7 mutant, B.1.351 mutant, B.1.429 mutant, P.1 mutant, B.1.617.2 mutant, and the like.
In a specific embodiment of the present invention, the tag polypeptide comprises a purification tag, a detection tag, an identification tag, a conjugation tag, a functional verification tag, and the like, such as a His tag, an HA tag, a Flag tag, a c-Myc tag, an Avi tag, and the like.
In a specific embodiment of the present invention, the detection protein contained in the fusion protein includes a fluorescent protein, a fluorescein-labeled protein, a peroxidase and other functional proteins, such as FPs protein, HRP protein, alexa Fluor-labeled protein, FITC-labeled protein and the like.
In a specific embodiment of the present invention, the auxiliary protein contained in the fusion protein is a protein for assisting folding, assisting expression, assisting solubilization, shielding functions of toxic proteins and the like, such as GST protein, MBP protein, SUMO protein, nusA protein.
Technical effects
The antibody for resisting coronavirus such as SARS-CoV-2 provided by the invention effectively overcomes the defects of low serum source, high cost, unstable structure and the like of the existing coronavirus such as SARS-CoV-2 rehabilitation patients, has high affinity, high sensitivity, high neutralization capacity, high yield and high stability, is low in cost and can be used for mass rapid production. The antibody provided by the invention can be used for blocking initial infection, diagnosing early infection and treating middle and late infection, and can also be used for scientific research tools and in vitro rapid detection, such as ELISA detection/diagnosis kit and colloidal gold detection/diagnosis kit.
The detection method established by the antibody of the invention, such as ELISA detection method, can accurately and sensitively detect whether the sample contains coronavirus such as SARS-CoV-2 virus. The pretreatment process of the sample is simple, the time consumption is low, a large number of samples can be detected simultaneously, and the sample detection cost is far lower than that of the traditional nucleic acid detection method. The antibody can be applied to a colloidal gold detection/diagnosis kit, can rapidly and accurately detect whether coronaviruses such as SARS-CoV-2 virus are contained in a sample, and has important practical significance for solving large-scale crowd infection and environmental and cargo sample pollution screening and identification.
Drawings
In order to more clearly illustrate the invention or the technical solutions of the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the invention, and other drawings can be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a graph showing the binding curves of the nanobody of the invention and S1 proteins of a Wild Type original strain, a B.1.1.7 mutant strain and a B.1.351 mutant strain of SARS-CoV-2 virus;
FIG. 2 shows affinity curves of the nanobody of the invention with S1 protein of SARS-CoV-2 virus Wild Type original strain, B.1.1.7 mutant strain and B.1.351 mutant strain (taking antibody A1 as an example);
FIG. 3 is a graph showing neutralization inhibition curves of the nano antibody of the invention on pseudo viruses of SARS-CoV-2 virus Wild Type original strain, B.1.1.7 mutant strain and B.1.351 mutant strain;
FIG. 4 shows the sequences of the antibodies of the invention and their CDR regions;
FIG. 5 shows the binding curves of the 6 antibodies of the invention and the S protein of SARS-1 virus;
FIG. 6 is a plasmid map of pComb3Xss used in example 1.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The equipment used is not pointed out by manufacturers, and is a conventional product which can be purchased by a regular channel manufacturer. The methods are conventional methods unless otherwise specified, and the starting materials are commercially available from the public sources unless otherwise specified.
Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.
The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof.
The experimental methods in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The quantitative tests in the following examples were all set up in triplicate and the results averaged.
According to some preferred embodiments of the invention, the nanobody may be prepared as follows: the method comprises the steps of taking an original strain SARS-CoV-2 protein as an immunogen to immunize an experimental animal camel, extracting total RNA of peripheral blood lymphocytes, cloning a heavy chain (VHH) gene fragment of the nano antibody by reverse transcription and nested PCR, cloning the gene fragment to a phagemid vector by enzyme digestion connection, efficiently and electrically converting the phagemid vector to escherichia coli, carrying out assisted phage rescue, constructing a phage nano antibody library, screening the SARS-CoV-2 nano antibody, carrying out expression purification on the SARS-CoV-2 nano antibody, and obtaining the SARS-CoV-2 nano antibody with high sensitivity and high cross reaction with popular mutant strains. The prepared nano antibody has small molecule, strong solubility, high temperature resistance, easy purification and easy expression.
According to some preferred embodiments of the present invention, the SARS-CoV-2 virus wild type original strain S protein and RBD protein are used as immunogens, and the SARS-CoV-2 virus wild type original strain S1 protein and the B.1.1.7 mutant strain B.1.351 mutant strain S1 protein are used as coated antigens, which are purchased from Beijing Yiqiao Shenzhou biological Co.
The ELISA plate is a 96-hole ELISA plate, and the coating concentration of the coating antigen is 1ug/mL.
The enzyme-labeled secondary antibody is horseradish peroxidase-labeled anti-HA tag antibody, and the concentration is 0.1 mug/mL. Purchased from Abcam corporation under the trade designation ab1265.
The color development liquid A consists of carbamide peroxide 1g, citric acid 10.3g and Na 2 HPO 4 ·12H 2 Prepared from 35.8g of O, 100 mu L of Tween-20 and 1000mL of distilled water, and has a pH value of 5.
The color development liquid B is prepared from 700mg of tetramethyl benzidine, 40mL of DMSO, 10.3 and g of citric acid and 1000mL of distilled water, and has a pH value of 2.4.
The reaction termination solution is 2M sulfuric acid solution.
EXAMPLE 1 construction of SARS-CoV-2 nanobody library
200ug of SARS-CoV-2 virus original strain S protein and RBD protein (Beijing Yiqiao China biological Co., ltd.) are mixed with equal volume of complete Freund 'S adjuvant, fully emulsified and injected into camel, and then the mixture of incomplete Freund' S adjuvant and immunogen is used for boosting, and the mixture is subjected to subcutaneous multipoint immunization at the back of the neck for 5 times. Starting from the third immunization, blood was taken from the jugular vein one week after each immunization and serum titers were measured.
White blood cells are separated from peripheral blood after the 5 th immunization, total RNA is extracted, and the total RNA is subjected to reverse transcription PCR and nested PCR (wherein, the reverse transcription PCR and the nested PCRThe system and parameters are described below), a VHH gene fragment was cloned, the cohesive ends modified with the restriction enzyme SfiI, and the VHH gene fragment was ligated to phagemid pComb3Xss (professor Bruce D Hammeock of UC Davis, proprietary, inc.), efficiently electrotransformed to E.coli ER2738 (stored in the laboratory, also commercially available, e.g., from NEB, UK) by T4 ligase, and a phage nanobody library of SARS-CoV-2 was constructed. The primary stock capacity reaches 10 after measurement 9 cfu, adding helper phage (multiplicity of infection 20:1) M13KO7 (purchased from NEB company, cat# N0315S) for rescue to obtain phage nanobody library with a library capacity of 10 12 pfu/mL, the diversity of the library is better.
Reverse transcription PCR:
the reverse transcription kit adopts PrimeScript TM RT-PCR Kit, available from Takara Corp., trade name: AK2701.
The reverse transcription system is as follows:
the reaction was carried out at 65℃for 5min. The cDNA first strand synthesis was performed by taking out the sample and placing it on ice, and applying the sample according to the following system.
30℃10min；42℃1h；72℃5min。
Nested PCR: (available from TAKATA company, cat# 6210A)
First round PCR:
the reaction system is as follows:
the reaction procedure was as follows:
second round PCR:
the reaction system is as follows:
the reaction procedure was as follows:
the nested PCR primer sequences were as follows (5 '-3'):
GSP-RT：CGCCATCAATRTACCAGTTGA(SEQ ID NO:23)
LP-leader：GTGGTCCTGGCTGCTCTW(SEQ ID NO:24)
F：CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTG GAGTC(SEQ ID NO:26)
R：CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGC TGTGGTGCG(SEQ ID NO:25)
wherein R represents a base A/G, W represents a base A/T, and K represents a base G/T.
EXAMPLE 2 screening of SARS-CoV-2 nanobody
Coating SARS-CoV-2 original strain virus S protein antigen in the 1 st hole of 96-hole ELISA plate, wherein the coating concentration is 1ug/mL, and the temperature is 4 ℃ overnight; the next day, pouring out the coating liquid, washing 3 times by using PBST, closing the 1 st hole and the 2 nd hole of the ELISA plate by using BSA, and incubating for 2h at room temperature; pouring out the sealing liquid, and washing 3 times by using PBST; adding the phage nanobody library obtained in the example 1 into a1 st hole, and reacting for 2 hours; pouring out the liquid, beating the liquid on clean absorbent paper, and washing the liquid with PBST for 5 times; 100 mu L of SARS-CoV-2 virus original strain S1 protein is added into the 1 st hole and reacted for 1h; sucking out the liquid in the 1 st hole, adding the liquid into the 2 nd hole, and reacting for 1h to remove phage combined with BSA; the eluate was collected, 5. Mu.L was used for titer determination, and the remainder was used for amplification.
The phage eluate was added to fresh E.coli ER2738 bacterial solution (stored in laboratory, also commercially available, e.g., from NEB company), and allowed to stand at 37℃for 15min; adding carbenicillin and SB culture medium, culturing at 37deg.C and 220rpm for 2 hr; helper phage M13KO7 (multiplicity of infection MOI=20:1) (available from NEB company under the designation N0315S) and kanamycin were added and incubated overnight; the next day, the supernatant was centrifuged and the phage was purified by precipitation with PEG-NaCl solution.
The amplified products are subjected to the next round of screening, the addition amount of each round of screening is guaranteed to be the same, the antigen coating concentration and the S protein competitive elution concentration are reduced by 2 times, the titer of each round is calculated, and monoclonal is selected for amplification and ELISA identification. Positive monoclonal was obtained by 3 rounds of panning.
EXAMPLE 3 expression of SARS-CoV-2 nanobody
Positive monoclonal plasmids were extracted and transformed into E.coli TOP10F' competent cells (purchased from Thermo Fisher), and after resuscitation, plated on solid medium overnight for culture. The next day, single clone is selected and cultured in SB-carboxybenzyl culture medium, and IPTG is added to induce overnight expression; the next day, cells are lysed by a high-pressure homogenizer, the membrane is filtered and then is purified by a nickel column, namely, the nano antibody is separated and purified by utilizing the affinity chromatography of a histidine tag and nickel chloride in the nickel column, so that the high-purity anti-SARS-CoV-2 nano antibody, namely, antibody A1-A6, is obtained, and the amino acid sequence of the obtained nano antibody is shown as SEQ ID NO. 1-6 through amino acid sequencing analysis.
EXAMPLE 4 binding curves of nanobodies to the S1 protein of SARS-CoV-2 Virus
The S1 protein of the Wild Type original strain of SARS-CoV-2 virus, the S1 protein of the B.1.1.7 mutant strain and the S1 protein of the B.1.351 mutant strain (Beijing Yiqiao China biological Co., ltd.) are respectively coated on a 96-well ELISA plate, the coating concentration of each well is 1ug/mL, and the reaction is carried out at 4 ℃ overnight; the next day, the liquid in the hole is thrown out, PBST containing 0.05% Tween is used for washing 3 times, and the ELISA plate is inverted and is dried on absorbent paper; adding a sealing solution, incubating for 30 minutes at 37 ℃, throwing out the liquid in the hole, washing 3 times by using 0.05% PBST, and reversely placing the ELISA plate on absorbent paper to be patted dry; 100. Mu.L of the nanobody solution obtained in example 3 at different dilution factors are added respectively, and incubated for 30 minutes at 37 ℃; throwing out the liquid in the hole, washing 3 times by using PBST, inverting the ELISA plate on absorbent paper, and beating to dry; adding enzyme-labeled secondary antibody (horseradish peroxidase-labeled anti-HA tag antibody, purchased from Roche company), and incubating at 37 ℃ for 30 minutes; throwing out the liquid in the hole, washing the plate for 3 times by using PBST, and drying; mixing the solution A and the solution B uniformly in equal volume, adding 100 mu L of each hole, developing color for 10-15 minutes in dark, adding a stopping solution to stop the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme label instrument. Binding curves of nanobody and SARS-CoV-2 virus Wild Type original strain S1 protein, b.1.1.7 mutant S1 protein and b.1.351 mutant S1 protein were plotted according to antibody concentration and OD values in the corresponding wells (see fig. 1). Experimental results show that the 6 nano antibodies have stronger affinity with Wild Type original strain S1 protein, B.1.1.7 mutant strain S1 protein and B.1.351 mutant strain S1 protein, which indicates that the nano antibodies have a certain broad spectrum.
EXAMPLE 5 affinity curves of nanobodies with SARS-CoV-2 Virus S1 protein
Affinity detection using avidin probes was performed using an Octec red 96 instrument, and the affinity detection method was performed by techniques conventional in the art, as follows. PBST of 0.02% Tween-20 was added to 8 wells of the first column of the black unbound 96-well plate; the S1 protein of the Wild Type original strain of SARS-CoV-2 virus, B.1.1.7 mutant S1 protein and B.1.351 mutant S1 protein were then added to the second row of 8 wells at a concentration of 15ug/ml biotin-labeled SARS-CoV-2 virus. PBST is added in the third, fifth, seventh, ninth and eleventh columns, the nanobody of the invention with double dilution is added in the fourth, sixth, eighth and tenth columns, wherein PBST is added in the 8 th hole of each column, glycine 2.0 is added in the twelfth column, and the liquid is 200ul per hole. The general procedure is as follows:
1) First, 8 avidin probes (strepavidin-sensor, available from FORTEBIO, cat: 18-5019) immersed in the first column PBST for equilibration for 60s;
2) Immersing the avidin probe into SARS-CoV-2S protein dilution liquid for combining for 3min;
3) Returning to the first, and balancing twice in the three-column PBST;
4) Immersing the balanced probe into a fourth row of nanometer antibody diluent to perform specific binding of antigen and antibody for 3min;
5) And returning to the third column PBST for dissociation for 10min.
6) After dissociation, the probe is regenerated for 5s in the twelfth column of glycine 2.0, and the bound nano antibody is completely eluted;
7) And then returning to the eleventh PBST for neutralization for 5s;
8) Repeating the steps 6) and 7);
9) Immersing the probe into the PBST of the fifth column for balancing; repeating the steps 4), 5), 6), 7) and 8) to sequentially detect the binding capacity of other nanobodies and SARS-CoV-2S protein;
10 Finally, importing the experimental data into an excel table;
the results are shown in FIG. 2 and Table 1, and the results show that the affinity ranges of the six nanobodies for the S1 protein of the Wild Type original strain of SARS-CoV-2 virus are: 5.15-25.4nM, affinity range for B.1.1.7 mutant S1 protein: 1.27-10.1nM, with an affinity of 10.5-125nM for the B.1.351 mutant S1 protein.
TABLE 1 affinity constant K of nanobody with S1 protein of SARS-CoV-2 Virus Wild Type original strain, B.1.1.7 mutant and B.1.351 mutant D (M)
Example 6 neutralization Capacity of nanobody to SARS-CoV-2 pseudoviral infection assay
The 6 nano-antibodies of the invention are diluted by a DMEM culture medium by a multiple ratio of 10 concentration gradients, and the final volume of each concentration is 50ul, wherein the 10 th gradient only contains the DMEM culture medium and the nano-antibodies have the concentration of 0, and the 10 th gradient is used as a control group, and 3ul of the nano-antibodies can generate about 1x10 5 SARS-CoV-2Wild type original strain pseudovirus (Wang Haikun institute of Shanghai Pasteur of China academy of sciences, or available from Beijing cloud Water chestnut Biotechnology Co., ltd.) of RLUs (related luciferase activity) is added into nanobody dilution, mixed, incubated at 37℃for 60min, and 50ul of HEK293T-hACE2 cells (Shanghai of China academy of sciences) containing 10000Pasteur institute Wang Haikun researchers benefit, or alternatively available from Nanjinovirzan biotechnology Co., ltd.) to the virus-antibody complex, mixed well and then added to 96-well cell culture plates, 3 replicate wells were set for each concentration of antibody. The cell culture plates were placed in a 37℃incubator, after 48 hours of incubation, the cell supernatants were discarded, 100ul of Bright-Glo (Promega) was added to each well, reacted for 2min, transferred to a white 96-well plate, and the firefly luciferase activity values were measured using a Varioskan Flash multifunction reader (the SARS-CoV-2 virus B.1.1.7 mutant pseudovirus neutralization assay was identical to the original pseudovirus neutralization assay procedure, and only the added pseudovirus was different, and pseudoviruses and HEK293T-hACE2 cells were each given by Shanghai Pasteur Wang Haikun researchers, or were also available from Beijing or Nannoviral biotechnology Co., ltd.). Drawing neutralization inhibition curve by using SARS-CoV-2S pseudovirus after adding antibody to HEK293T-hACE2 cell infection rate and nano antibody concentration as horizontal and vertical coordinates, and finally calculating EC according to the curve 50 Values. Infection rate = (experimental wells RLUs value-background value)/(control wells RLUs value-background value) x100%, background value is the value read by adding only 100ul Bright-Glo. The results are shown in FIG. 3, and the experimental results show that all six nano antibodies can specifically neutralize SARS-CoV-2S protein pseudovirus. Neutralization of Wild Type mutant pseudovirus EC 50 The range is as follows: 92.7-273.7nM, neutralization of B.1.1.7 mutant pseudovirus EC 50 The range is as follows: 71.1-210.8nM, neutralization of pseudovirus of the B.1.351 mutant EC 50 The range is as follows: 0.38-3.35uM.
EXAMPLE 7 binding curves of nanobodies to SARS-CoV-1 Virus S protein
The SARS-CoV-1 virus S protein (which is a benefit of the institute of biophysics, chapter of the institute of China, or can be purchased from Beijing Yiqiao China, biological Limited company) is coated on a 96-well ELISA plate, the coating concentration of each well is 1ug/mL, and the reaction is carried out at 4 ℃ overnight; the next day, the liquid in the hole is thrown out, PBST containing 0.05% Tween is used for washing 3 times, and the ELISA plate is inverted and is dried on absorbent paper; adding a sealing solution, incubating for 30 minutes at 37 ℃, throwing out the liquid in the hole, washing 3 times by using 0.05% PBST, and reversely placing the ELISA plate on absorbent paper to be patted dry; 100. Mu.L of the nanobody solution obtained in example 3 at different dilution factors are added respectively, and incubated for 30 minutes at 37 ℃; throwing out the liquid in the hole, washing 3 times by using PBST, inverting the ELISA plate on absorbent paper, and beating to dry; adding enzyme-labeled secondary antibody (horseradish peroxidase-labeled anti-HA tag antibody, purchased from Roche company), and incubating at 37 ℃ for 30 minutes; throwing out the liquid in the hole, washing the plate for 3 times by using PBST, and drying; mixing the solution A and the solution B uniformly in equal volume, adding 100 mu L of each hole, developing in dark for 10-15 minutes, adding a stopping solution to stop the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme-labeling instrument. Binding curves of nanobodies and SARS-CoV-1 virus S protein were plotted against antibody concentration and OD values in the corresponding wells (see fig. 5). Experimental results show that the 6 nano antibodies can be combined with S protein of SARS-CoV-1 virus, which proves that the nano antibodies can be combined with SARS-CoV-1 in addition to SARS-CoV-2, and the antibodies have broad spectrum on coronaviruses.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.
The foregoing description of the embodiments has been provided for the purpose of illustrating the general principles of the invention, and is not meant to limit the invention thereto, but to limit the invention thereto, and any modifications, equivalents, improvements and equivalents thereof may be made without departing from the spirit and principles of the invention.
/>
/>

Claims (25)

1. A nanobody or antigen-binding fragment thereof against the S1 protein of SARS-CoV-2 virus, the amino acid sequence of which comprises:
CDR1 as shown in SEQ ID NO. 7, CDR2 as shown in SEQ ID NO. 12, and CDR3 as shown in SEQ ID NO. 17;
CDR1 as shown in SEQ ID NO. 8, CDR2 as shown in SEQ ID NO. 13, and CDR3 as shown in SEQ ID NO. 18;
CDR1 as shown in SEQ ID NO. 9, CDR2 as shown in SEQ ID NO. 14, and CDR3 as shown in SEQ ID NO. 19;
CDR1 as shown in SEQ ID NO. 11, CDR2 as shown in SEQ ID NO. 16, and CDR3 as shown in SEQ ID NO. 20;
CDR1 as shown in SEQ ID NO. 10, CDR2 as shown in SEQ ID NO. 15, and CDR3 as shown in SEQ ID NO. 21; or (b)
CDR1 as shown in SEQ ID NO. 11, CDR2 as shown in SEQ ID NO. 16, and CDR3 as shown in SEQ ID NO. 22.
2. The nanobody or antigen-binding fragment thereof according to claim 1, wherein the amino acid sequence is as shown in any one of SEQ ID NOs 1 to 6.
3. A genetically engineered antibody comprising the nanobody of claim 1 or 2 or an antigen-binding fragment thereof; wherein the genetically engineered antibody is a humanized antibody.
4. A genetically engineered antibody comprising the nanobody of claim 1 or 2, or an antigen-binding fragment thereof, wherein the genetically engineered antibody is a chimeric antibody.
5. A nucleic acid molecule encoding the nanobody or antigen-binding fragment thereof of claim 1 or 2 or the genetically engineered antibody of claim 3 or 4, wherein the nucleic acid molecule is RNA or DNA.
6. The nucleic acid molecule of claim 5 which is a cDNA.
7. An expression vector comprising the nucleic acid molecule of claim 5 or 6.
8. The expression vector of claim 7, wherein the expression vector is a DNA, RNA, viral vector, plasmid, expression cassette, transposon, or a combination thereof.
9. The expression vector of claim 7, wherein the expression vector comprises a viral vector.
10. The expression vector of claim 7, wherein the expression vector comprises a phage vector, a lentivirus, an adenovirus, an AAV virus, a retrovirus, or a combination thereof.
11. A host cell comprising the expression vector of any one of claims 7-10; wherein the host cell is a host cell for expressing a foreign protein.
12. The host cell of claim 11, wherein the host cell is a prokaryotic expression cell, a eukaryotic expression cell, or a transgenic cell line.
13. The host cell of claim 11, wherein the host cell comprises a prokaryotic cell, a yeast cell, an insect cell, an animal cell.
14. The host cell of claim 11, wherein the host cell is an insect cell.
15. A tissue sample or culture obtained by culturing the host cell of any one of claims 11-14.
16. A protein or antigen binding fragment isolated from the tissue sample or culture of claim 15.
17. A method of preparing the nanobody of claim 1 or 2 or antigen-binding fragment thereof or the genetically engineered antibody of claim 3 or 4, comprising isolating/recovering the protein or antigen-binding fragment of interest from the tissue sample or culture of claim 15.
18. A pharmaceutical composition comprising the nanobody of claim 1 or 2 or an antigen-binding fragment thereof or the genetically engineered antibody of claim 3 or 4 as an active ingredient.
19. The pharmaceutical composition of claim 18, wherein the pharmaceutical composition is an inhaled aerosolized drug, a mucosal or epidermal drug, a subcutaneous drug, an intravascular drug, or a combination thereof.
20. The pharmaceutical composition of claim 18, wherein the drug further comprises a pharmaceutically acceptable excipient or carrier.
21. A product comprising the nanobody of claim 1 or 2 or an antigen-binding fragment thereof or the genetically engineered antibody of claim 3 or 4.
22. The product of claim 21, wherein the product is a mask or an air purifier cartridge, an environmental, object, or body surface disinfectant, or a combination thereof.
23. The product of claim 21, wherein the product is coated in a purifier cartridge or dissolved in a disinfectant for atomized spraying or surface wiping.
24. Use of the nanobody of claim 1 or 2 or an antigen-binding fragment thereof or the genetically engineered antibody of claim 3 or 4 in the manufacture of a product or medicament for the prevention, treatment and/or diagnosis of coronavirus SARS-CoV-2 infection.
25. Use of a nanobody according to claim 1 or 2 or an antigen-binding fragment thereof or a genetically engineered antibody according to claim 3 or 4 for the preparation of a product for:
1) Detecting coronavirus antigen, wherein the coronavirus is SARS-CoV-2 virus original strain and mutant strain thereof;
2) Blocking coronavirus infection, wherein the coronavirus is SARS-CoV-2 virus original strain and mutant strain thereof;
3) Killing coronavirus particles, wherein the coronavirus is SARS-CoV-2 virus original strain and mutant strain thereof;
4) Diagnosing a disease associated with a coronavirus, which is a SARS-CoV-2 virus original strain and a mutant strain thereof; or (b)
5) Treating the related diseases caused by coronavirus, which is SARS-CoV-2 virus original strain and its mutant strain.
CN202111663259.0A 2021-12-31 2021-12-31 SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody Active CN114539394B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111663259.0A CN114539394B (en) 2021-12-31 2021-12-31 SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111663259.0A CN114539394B (en) 2021-12-31 2021-12-31 SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody

Publications (2)

Publication Number Publication Date
CN114539394A CN114539394A (en) 2022-05-27
CN114539394B true CN114539394B (en) 2024-02-06

Family

ID=81669964

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111663259.0A Active CN114539394B (en) 2021-12-31 2021-12-31 SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody

Country Status (1)

Country Link
CN (1) CN114539394B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116120443A (en) * 2023-01-31 2023-05-16 深圳细胞谷生物医药有限公司 Camel-source nano antibody for targeting SARS-CoV-2RBD and sharing epitope of receptor ACE2

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112094342A (en) * 2020-09-25 2020-12-18 中国科学技术大学 Alpaca source nano antibody combined with SARS-CoV-2RBD
CN112094343A (en) * 2020-09-25 2020-12-18 中国科学技术大学 Alpaca source nano antibody combined with SARS-CoV-2RBD

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112094342A (en) * 2020-09-25 2020-12-18 中国科学技术大学 Alpaca source nano antibody combined with SARS-CoV-2RBD
CN112094343A (en) * 2020-09-25 2020-12-18 中国科学技术大学 Alpaca source nano antibody combined with SARS-CoV-2RBD

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Development of multi-specific humanized llama antibodies blocking SARS-CoV-2/ACE2 interaction with high affinity and avidity;Jianbo Dong et al;Emerging Micorbes ＆ Infections;第9卷(第1期);1-3 *
SARS-CoV-2 nanobodies 2.0;Fabien Labroussaa et al;Signal Transduction and Targeted Therapy;第6卷(第202期);1-3 *

Also Published As

Publication number Publication date
CN114539394A (en) 2022-05-27

Similar Documents

Publication Publication Date Title
CN111303279B (en) Single-domain antibody for novel coronavirus and application thereof
CN113264998B (en) Single-chain antibody of S1 protein on surface of anti-new coronavirus SARS-CoV-2 and application thereof
CN112094343A (en) Alpaca source nano antibody combined with SARS-CoV-2RBD
WO2023125520A1 (en) CAMEL-DERIVED NANOBODY WITH HIGH-AFFINITY FOR α, β, γ AND δ MUTANT STRAINS OF SARS-COV-2
CN114805563B (en) SARS-CoV-2alpha, gamma, delta and omicron mutant camel-derived high affinity nanobody
CN109232739B (en) anti-CD 38 nano antibody, coding gene and application
CN113150129A (en) Single-chain antibody of S2 protein on surface of anti-new coronavirus SARS-CoV-2 and application thereof
CN113861288B (en) Novel coronavirus SARS-CoV-2 broad spectrum neutralizing antibody and its use
Müller et al. Generation and isolation of target-specific single-domain antibodies from shark immune repertoires
EP3992205A1 (en) Sars coronavirus-2 spike protein binding compounds
WO2022061594A1 (en) Sars-cov-2 spike protein binding molecule and use thereof
CN110903394A (en) Polypeptide capable of binding CD4 and application thereof
CN114539394B (en) SARS-CoV-2 alpha mutant and beta mutant camelid-derived high affinity nanobody
CN114539395B (en) SARS-CoV-2 wild strain and alpha mutant strain camel-derived high affinity nanobody
CN113461810B (en) Fully human monoclonal antibody for resisting novel coronavirus spike protein and application thereof
CN114671947B (en) High-affinity nano antibody for surface S protein of different subtypes of hepatitis B virus and application thereof
CN114478761B (en) Green fluorescent protein shark source nano antibody, preparation method and application thereof
CN114591423B (en) Specific antibody of new coronavirus N protein and preparation method and application thereof
CN114249820B (en) Alpaca-derived nanobody combined with SARS-CoV-2RBD
CN115975015A (en) Peste des petits ruminants virus (PPRV) F protein nano antibody and preparation, purification and neutralization test method thereof
CN114702573B (en) Hepatitis B virus surface S protein high affinity nano antibody and application thereof
US20150240230A1 (en) Method for producing and obtaining variable domains of anti-digoxin monoclonal antibody fab fragment using the molecular biology cloning technique
CN114213539B (en) Nanobody 4NB357 capable of binding CD4 and application thereof
CN115124615B (en) Nanobody against novel coronavirus RBD domain antigen
WO2022170983A1 (en) Anti-coronavirus antibody, screening method therefor, pharmaceutical composition containing same, and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant