CN114533853B - Application of Ctrp15 in preparation of product for promoting angiogenesis and improving cardiac function related to ischemia - Google Patents

Abstract

The invention discloses application of Ctrp15 in preparing a product for promoting angiogenesis and improving cardiac function related to ischemia. The invention provides application of Ctrp15 protein or coding gene thereof or substance taking Ctrp15 protein as active ingredient in at least one of the following; 1) preparing a product for treating heart injury; 2) preparing a product for relieving heart injury; 3) the product for improving the cardiac function repair capability after cardiac injury is prepared. According to the invention, whether Ctrp15 regulates and controls the collateral vessel neogenesis in the exercise process and researches on a molecular mechanism show that Ctrp15 protein secreted by exercise-induced skeletal muscle can improve the collateral vessel neogenesis after myocardial infarction and finally promote the repair of the cardiac function.

Description

Application of Ctrp15 in preparation of product for promoting angiogenesis and improving cardiac function related to ischemia

Technical Field

The invention belongs to the field of medicines, and particularly relates to application of Ctrp15 in preparation of a product for promoting angiogenesis and improving cardiac function related to ischemia.

Background

Myocardial Infarction (MI) is the death of myocardial ischemia and hypoxia caused by acute occlusion of coronary arteries, and is the leading cause of heart failure and death. Wherein a patient of about 1/3 found old myocardial infarction and had more adequate collateral circulation prior to hospitalization; and clinical studies show that the patient's long-term prognosis is obviously related to the degree of collateral circulation neogenesis, and the incidence of heart failure (3.1% vs11.6%) and the incidence of mortality (7.1% vs15.4%) after the collateral circulation establishes adequate reperfusion therapy for the patient for 60 months are significantly lower than those of inadequate patients. At present, the main treatment means for patients with myocardial infarction is to recover blood supply through reperfusion therapy, but a large number of patients still have complications such as heart failure and the like due to poor myocardial repair caused by failure of timely operation or ischemia-reperfusion injury and the like. Once heart failure occurs, the 5-year survival rate is only 50%. Therefore, the search of the target of medical drug intervention is urgently needed, and the recovery of the cardiac function is promoted by improving the angiogenesis after the cardiac injury.

The proliferation and sprouting of endothelial cells during collateral angiogenesis is a key cellular event in the formation of new blood vessel collateral, and the microenvironment during the repair of cardiac injury is formed by neutrophils, macrophages and a number of exocrine factors (VEGF, PDGF, etc.) infiltrating heart tissues, which mediate cell and tissue interactions. The research finds that the states of endothelial cells between skeletal muscle and heart tissue have high similarity, which indicates that the skeletal muscle and the heart tissue have relatively similar regulation mechanisms, the skeletal muscle is a main supporting organ for body movement and the research shows that the movement can promote the regeneration of collateral blood vessels in the heart, and simultaneously, the European journal of cardiovascular diseases shows that the moderate amount of movement is beneficial to the recovery of patients with cardiovascular diseases in 2020.

Myoconjin Ctrp15 is a member of the C1 q/TNF-related protein (CTRP) secretory family derived primarily from skeletal muscle tissue and is involved in regulating lipid metabolism and immune function. And the existing research suggests that the Ctrp15 factor from skeletal muscle can obviously inhibit the apoptosis of myocardial cells and the infiltration of inflammation to play the role of protecting the cardiac function when moving in an ischemia reperfusion model; however, the death of cardiomyocytes is mainly due to a lack of blood supply, so it is of critical concern that the establishment of regulation of collateral angiogenesis during myocardial infarction is critical.

Disclosure of Invention

The invention aims to provide application of Ctrp15 protein or coding gene thereof or substance taking Ctrp15 protein as active ingredient.

The application of the Ctrp15 protein or the coding gene thereof or the substance taking the Ctrp15 protein as an active ingredient in at least one of the following substances;

1) preparing a product for treating heart injury;

2) preparing a product for relieving heart injury;

3) the product for improving the heart function repair capability after heart injury is prepared.

In the above application, the heart damage is heart damage caused by myocardial ischemia.

In the above application, the cardiac injury caused by myocardial ischemia is cardiac injury caused by myocardial infarction.

In the application, the heart injury is old myocardial infarction, or chronic coronary occlusive lesion, or acute myocardial infarction, or acute coronary syndrome.

The improvement of the cardiac function repair ability after the cardiac injury is reflected in the promotion of the formation and the regeneration of the blood vessel collateral.

The application of the Ctrp15 protein or gene as a marker in preparing products for evaluating or assisting in evaluating the degree of heart injury of a person to be tested is also within the protection scope of the invention.

The application of the substance for detecting the Ctrp15 protein content or the Ctrp15 protein coding gene expression quantity in the preparation of products for evaluating or assisting in evaluating the heart damage degree of a person to be detected is also within the protection scope of the invention.

The application of the animal exercise promoting substance in preparing the animal model for promoting the collateral angiogenesis is also within the protection scope of the invention.

The invention also provides a preparation method of the collateral blood vessel regeneration promoting animal model, which comprises the following steps: the animal model for promoting the collateral vessel neogenesis is obtained after the animal exercises.

In the above application, the substance for detecting the Ctrp15 protein content comprises an antibody specifically binding to Ctrp15 protein, and in the embodiment of the invention, the antibody is coated on a well plate in an ELISA kit (Antipodes-online GmbH, Germany; Catalogumber ABIN 6955638).

In the above application, the cardiac injury is cardiac injury caused by myocardial ischemia.

In the above application, the cardiac injury caused by myocardial ischemia is cardiac injury caused by myocardial infarction.

In the application, the heart injury is old myocardial infarction, chronic coronary occlusive lesion, acute myocardial infarction or acute coronary syndrome.

According to the invention, whether Ctrp15 regulates and controls the collateral vessel neogenesis in the exercise process and researches on a molecular mechanism show that Ctrp15 protein secreted by exercise-induced skeletal muscle can improve the collateral vessel neogenesis after myocardial infarction and finally promote the repair of the cardiac function.

Drawings

FIG. 1 is a graph showing that exercise promotes functional repair of a heart after ischemic and hypoxic injury.

Figure 2 is an increase in vascular side branches in a motion-promoted heart.

Fig. 3 shows that the skeletal muscle significantly secretes Ctrp15 during exercise.

Fig. 4 shows that the expression of Ctrp15 is significantly reduced during cardiac ischemia.

Fig. 5 shows that the supplementation protein over-expression of Ctrp15 can effectively reduce cardiac injury.

Fig. 6 shows that the ability of knockout Ctrp15 to inhibit vascular collateral regeneration eventually exacerbates post-ischemic cardiac injury.

FIG. 7 shows that Ctrp15 expression in plasma of patients with cardiac injury is lower than that in healthy people.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the following examples, male wild-type mice (C57BL/6) were purchased from Beijing Huafukang Biotech GmbH, hereinafter abbreviated as wild mice (WT mice).

Example 1 Ctrp15 protein secreted by exercise-induced skeletal muscle

Functional repair after exercise promotion of ischemia and hypoxia injury of heart

Selecting a WT wild mouse, and carrying out statistics on survival rate, cardiac function change and pathological level evaluation on cardiac remodeling change of the mouse after the myocardial infarction model by utilizing a swimming experiment and an acute myocardial infarction model, thereby determining the influence of exercise on the collateral vessel neogenesis degree and cardiac function repair after the myocardial infarction in the protection process of the heart.

Construction of motion model

Swimming simulation sports: swimming was initiated for 10 minutes each day and gradually increased for 10 minutes/day until after 50 minutes/day, exercise was performed for 6 days each week for 4 weeks, to obtain exercise model mice.

(II) construction of myocardial infarction animal model

Establishing a mouse model according to the currently reported general anterior coronary artery ligation descending scheme MI (coronary artery ligation), wherein the following operation processes are all operated under a sterile environment:

(1) selecting male WT mice (not in motion) with age of 8-10 weeks and weight of 20-22g and the exercise model mice (male with age of 8-10 weeks and weight of 20-22g, after exercise) obtained in the step (A) to respectively raise in SPF animal room, and performing chest depilation and skin preparation by using depilatory cream one day before planning operation;

(2) 2% isoflurane is used for continuous inhalation anesthesia in the operation, and 75% alcohol is used for disinfecting the local skin of the precordial region in a fixed position after the mouse is stabilized;

(3) under the condition of continuously inhaling the anesthetic, a small opening of about 1.2cm is formed in the left chest by using a pair of surgical scissors;

(4) separating pectoralis major and pectoralis minor muscle by using surgical forceps, and penetrating the intercostal space with a curved vessel forceps to gently extrude the heart;

(5) after the left anterior descending branch of the coronary artery is ligated by a square knot by using a No. 7 surgical operation needle thread, the far-end cardiac muscle is rapidly changed into white after ligation, and the heart is rapidly restored to the original position after thread cutting, and then the thoracic cavity is squeezed to exhaust the gas in the thoracic cavity;

(6) using a No. 4 surgical operation needle thread to perform intermittent suture on the skin at the surgical opening;

(7) and (3) model evaluation: establishing a model by a remote electrocardiograph evaluation model within half an hour after coronary artery ligation, observing that ST segment in electrocardiogram is obviously raised and prompting the model to be successfully established after the coronary artery ligation, and performing subsequent experiments to obtain a myocardial infarction mouse model (non-motion group) and a myocardial infarction mouse model (motion group) (taking the current day of the operation as the day of myocardial infarction 0);

(8) after the mice revive, the myocardial infarction mouse model is placed on a heat-insulating pad and placed back into a feeding cage, the analgesic buprenorphine (0.05 mg/kg/12h, i.p.) is fed within two days after surgery, and the mice are fed in an SPF environment.

(III) transthoracic echocardiography examination

In order to evaluate the effect of the basic level (after exercise) and MI (coronary artery ligation) of the mice on the change of the heart function of the mice, the myocardial infarction mouse model (non-exercise group) and the myocardial infarction mouse model (exercise group) obtained in the second step are subjected to non-invasive echocardiogram detection at different time after the operation. Mice without MI coronary artery ligation were used as a control group, and divided into a sports control group (the same movement pattern as described above (a)) and a non-sports control group.

The relevant indexes of the mouse cardiac function comprise Left Ventricular Ejection Fraction (LVEF); left ventricular minor axis foreshortening (LVFS); left ventricular end systolic diameter (LVIDS); left ventricular end diastolic diameter (LVIDD), etc. The results of all samples were tested using the same ultrasound parameters, and at least 3-5 cycles of continuity were measured for each sample and averaged.

The operation steps of the small animal echocardiography are as follows:

(1) mice fed in an SPF environment were depilated, skin prepared one day in advance using depilatory cream: removing hair from neck and chest of the mouse;

(2) injecting an anesthetized mouse into the abdominal cavity by using tribromoethanol (0.25g/kg), and fixing the mouse on an inspection table in a supine position after the mouse is anesthetized successfully;

(3) a small animal high-resolution ultrasonic imaging system (Visual Sonic 2100) is used for debugging, and a 30MHz probe is used for cardiac function detection;

(4) coating the couplant on the surface of the chest of the mouse to avoid air bubbles, slightly adjusting the body position after the probe is contacted with the couplant, and firstly enabling the long axis of the heart of the mouse to be parallel to the probe to obtain the long axis section of the left ventricle beside the sternum;

(5) at the moment, the probe is rotated clockwise by about 90 degrees to obtain a horizontal section of the M-shaped mitral chordae tendineae, and the papillary muscles can be seen in the visual field as a standard retention map for subsequent analysis and value collection.

The results are shown in fig. 1, wherein a is the survival curve of mice in a non-moving group and a moving group after the myocardial infarction operation, B is the echocardiogram of the mice moving and constructing a myocardial infarction model at 4 weeks, and B1 is the left ventricular ejection fraction under different treatment conditions; the survival rate and the cardiac function change of the myocardial infarction mouse model at different time after MI operation are counted, and the survival rate of the myocardial infarction mouse model prepared by the exercise group mouse is higher than that of the myocardial infarction mouse model prepared by the non-exercise group mouse (figure 1A); exercise improved cardiac function in mice (fig. 1B and fig. 1B 1), and this result suggests that moderate exercise can reduce cardiac injury following myocardial infarction.

Secondly, exercise improves the collateral blood vessel neogenesis degree after myocardial infarction

Collateral angiogenesis in the heart was evaluated by pathological levels of vessel walls positive for von Willebrand factor vWF (antibody cat: ab6994, Inc.: abcam), and the effect of exercise on the degree of collateral angiogenesis after myocardial infarction during protection of the heart was clarified.

(one) evaluation of collateral angiogenesis in the heart by vWF-positive intima-vessel

(1) Collecting the heart of the mouse at 1 week after operation, and taking out the heart after flushing the heart and circulating blood;

(2) cutting off connective tissues adhered to the surface of the heart, placing the heart in physiological saline to clean the heart, absorbing water on the surface of the heart and in a heart cavity by using absorbent paper, placing the heart in formalin tissue fixing liquid, and keeping the heart in a diastolic shape to perform overnight dehydration fixation;

(3) taking out the heart, and performing paraffin embedding, slicing, flaking and dewaxing to water;

(4) firstly, 1 Xcitric acid solution is used for heating in an autoclave for 90 seconds to repair cell surface antigens on slices, and double distilled water ddH is used after room temperature is recovered ₂ O cleaning for 3 times, 3 minutes each time;

(5) deionization of H with 3% endogenous peroxidase blocker ₂ O ₂ Incubating the aqueous solution for 20 minutes at room temperature, wiping off the blocking agent, and washing the solution with 1 XPBS for 3 times (3 minutes each time);

(6) sealing the goat serum at room temperature for 30 minutes, and spin-drying the serum on the slices;

(7) an antibody against endothelial cell specific marker vWF (antibody cat # ab6994, Abcam, ratio 1:500) was formulated with PBS and incubated overnight in a wet box at 4 ℃ in a refrigerator; taking out the slices, recovering to room temperature for 30 minutes, and washing with 1 × PBS for 3 times, each time for 3 minutes;

(8) incubating and adding an immunohistochemical secondary antibody marked by horseradish peroxidase for 30 minutes at room temperature, and washing for 3 times by 1 XPBS (phosphate buffered saline) for 3 minutes each time;

(9) performing color development by using a DAB kit, and mixing the three liquids A/B/C in ddH according to the proportion of 1:20 according to the instruction ₂ In O (as-prepared), the sections were quickly placed in ddH, and the color was developed under a microscope for about 2 minutes, until the tissue sections were slightly yellow ₂ O cleaning for 3 times, 3 minutes each time;

(10) staining the nuclei for 3 minutes by using hematoxylin staining solution, and flushing out the staining by using tap water;

(11) preparing hydrochloric acid alcohol differentiation solution by using concentrated hydrochloric acid and ethanol, treating the slices in the differentiation solution for 2 seconds, and bluing the slices with low-speed running tap water for 5 minutes;

(12) taking out the slices, quickly dipping the slices in 95% alcohol for 3 times and 5 seconds/time in sequence, and soaking the slices in 100% absolute ethyl alcohol for 5 minutes; finally, after soaking in xylene for 10 minutes, mounting the slices by using neutral gum and a cover slip, placing the slices in a fume hood, collecting pictures under a 200-fold mirror after the neutral gum is hardened, and randomly selecting 8-10 fields for data collection and analysis of each slice.

The results are shown in fig. 2, wherein a is cardiac vWF staining after myocardial infarction operation of the non-motile group and the motile group, a1 is quantitative statistics on vWF positive cells, and the number of vWF positive endothelial cells in the myocardial infarction mouse model group (motile group) prepared after the exercise is more than that in normal culture of the simple myocardial infarction mouse model (non-motile group); indicating that vWF positive endothelial cells increased significantly after exercise, indicating that exercise promoted an increase in vascular collateral in the heart, i.e., promoted collateral angiogenesis.

Thirdly, skeletal muscle high secretion Fam132b after movement (Ctrp15)

Male C57BL/6 WT mice were selected, a motor model was constructed, and post-motor skeletal muscle high secretion Fam132b (Ctrp15) was found by sequencing the transcriptome of post-motor skeletal muscle.

Construction of motion model

Constructing a motion model by the same method;

(II) construction of myocardial infarction animal model

Constructing a myocardial infarction animal model by the same method;

(III) transcriptomics sequencing

Collecting skeletal muscle tissues of mice to extract RNA, detecting the concentration and purity of the RNA, and then fragmenting the RNA and performing reverse transcription to obtain single-stranded cDNA-double-stranded cDNA; then, the cDNA is purified and amplified to construct a DNA library. Sequencing analysis was performed using the Illumina sequencing platform.

The results are shown in fig. 3, a is a Heat-map cluster analysis showing factors highly expressed in skeletal muscle after exercise (top 19), wherein the source of skeletal muscle is mainly Fam132B (Ctrp15) according to the known source, B is a gene significantly increased in skeletal muscle after exercise and is mutually analyzed with a protein library known as secretory protein; 5 of the genes which are increased after the exercise are found to be secreted, including (Ctrp15, Adipoq, Hbegf, Angptl4, Agt), the expression level of the 5 secreted genes is shown as B1, and the expression level of Ctrp15 is the highest; after the comprehensive analysis, Ctrp15 (amino acid sequence 1) was selected as the research point.

Fourthly, the expression of Ctrp15 is obviously reduced in the process of cardiac ischemia

By using an ELISA detection method, the dynamic change of the Ctrp15 in the myocardial ischemia engineering is determined by detecting the Ctrp15 gene level in the plasma of the mouse and the Ctrp15 gene level in the heart tissue of the mouse model with the myocardial infarction prepared in the first step after one week and four weeks of operation. The control group was a sports model mouse without coronary ligation.

Detection of plasma Ctrp15

The detection was carried out by a commercial ELISA kit (Co.: antibodies-online GmbH; cat. No.: ABIN 6974881) in the following manner:

(1) preparing all reagents and working standards;

(2) removing excess microporous slat frames from the plate and replacing them in desiccant-containing plastic bags;

(3) add 100. mu.L of standard or sample to each well and incubate at 37 ℃ for 2 hours;

(4) removing the liquid from each well without rinsing;

(5) add 100. mu.L of 1 × Biotin-labeled antibody to each well and incubate at 37 ℃ for 1 hour;

(6) the well was aspirated, 300. mu.L of 1 × Wash buffer per well, the liquid was removed completely after thorough washing, lifted dry on clean paper, and the wash was repeated 3 times. Note that: the stain board on the absorbent paper can remove any residual buffer solution;

(7) add 100. mu.L of avidin-HRP conjugate working solution per well. Incubation at 37 ℃ for 1 hour;

(8) sucking out and cleaning for 5 times according to the step 6;

(9) adding 90 mu L of TMB substrate color development solution into each hole, and incubating for 15-30 minutes at 37 ℃ in a dark place;

(10) add 50. mu.L of stop solution to each well, the color should change from blue to yellow in the well;

(11) the absorbance of each well was determined using a microplate reader at 450nm over 5 minutes.

qPCR (second) for detecting Ctrp15 gene transcription level in mouse heart tissue

1. RNA extraction and reverse transcription in cardiac tissue

(1) Taking heart tissue blocks of a myocardial infarction mouse model, which are fresh or frozen in a refrigerator or liquid nitrogen at minus 80 ℃ for three days, one week or four weeks after operation, into a 1.5mL centrifuge tube without RNase, adding 2 beads of inactivated RNase, adding 1mL TRIzol reagent, performing shake digestion for 2-3 times by using a tissue homogenizer, and keeping the temperature below 10 ℃ during homogenization;

(2) taking down the homogenized tissue suspension (based on no tissue block observed), adding 200 mu L of trichloromethane into each tube, covering the tube cover tightly, then strongly reversing and oscillating for about 10 seconds, enabling the liquid to be chyle, standing on ice for layering, and then oscillating twice repeatedly;

(3) after layering, centrifuging at 12000rpm for 20 minutes at 4 ℃, wherein the three layers can be found, and sucking supernatant liquid and transferring the supernatant liquid to new centrifugal tubes of 1.5mL respectively;

(4) adding 1.5 times volume of 800 mu L isopropanol into each tube, lightly mixing uniformly, and placing in a refrigerator at minus 20 ℃ overnight for RNA extraction;

(5) taking out the overnight mixed solution, and centrifuging at 12000rpm for 15 minutes at the temperature of 4 ℃;

(6) preparing 75% alcohol by using absolute alcohol and DEPC water without RNA enzyme, adding 1mL of prepared alcohol into each tube after centrifuging and discarding supernatant, cleaning RNA precipitate, and repeating the step for three times;

(7) and finally, abandoning the supernatant and centrifuging again, absorbing residual alcohol by using a 200 mu L liquid transfer gun, air-drying in a super clean bench, adding 20-30 mu L DEPC (diethylpyrocarbonate) water to dissolve RNA to obtain RNA solution, detecting the quality of the RNA solution, measuring the concentration of the RNA solution, and carrying out reverse transcription to obtain cDNA.

2. Real-time fluorescent quantitative PCR (Realtime-PCR) reaction

(1) Taking a proper amount of 8-row 200-mu-L centrifuge tubes, calculating according to 2 multiple holes of each sample, and placing the centrifuge tubes on a constant-temperature metal bath at 4 ℃, wherein the reagents added into each hole are as follows:

2 × SYBR Green PCR Master Mix 10 μL

RNase Free H2O 7 μL

upstream primer 1. mu.L

Downstream primer 1. mu.L

cDNA 1 μL

(2) Carrying out real-time fluorescence quantitative PCR reaction by using an iQ5 real-time quantitative PCR instrument, wherein the reaction steps are as follows: (ii) 95 ℃ for 5 minutes, (ii) 95 ℃ for 45 seconds, and (iii) 60 ℃ for 1 minute (45 cycles); dissolution curve: 55 ℃→ 95 ℃ (0.5 ℃/cycle increase, 30 seconds per cycle);

(3) the primer sequences used were:

an upstream primer Ctrp15-F, AGGCAGGACACTACACTTCTG;

a downstream primer Ctrp15-R is TCACCACTCTGCTTGGTAAGG;

the results are shown in fig. 4, the left graph is the plasma Ctrp15 level at different time points after the myocardial infarction, the right graph is the Ctrp15 gene level of the heart tissue at different time points after the myocardial infarction, and it can be seen that the protein and gene expression of the Ctrp15 is obviously reduced in the ischemia process after 1 week and 4 weeks after the myocardial infarction regardless of the plasma Ctrp15 and the Ctrp15 gene level in the mouse plasma and the heart tissue.

Example 2 application of Ctrp15 protein to treatment or alleviation of cardiac injury

Whether the cardiac injury is effectively relieved is detected by over-expressing Ctrp15 with supplementary protein: on the premise of successful model construction, a myocardial infarction model is established by using a WT wild mouse, the Ctrp15 is over-expressed by the supplementary protein, and the therapeutic effect of collateral vessel neogenesis on cardiac function repair after myocardial infarction by promoting the exercise prescription based on Ctrp15 is determined through cardiac ultrasound and pathological detection.

Heart-injured Mice (MI) were treated in vivo with protein Ctrp 15:

(1) a myocardial infarction mouse model (non-motor group) was obtained in the same manner as in the construction of the heart injury animal model of example 1;

(2) preparation of protein Ctrp 15:

taking out protein Ctrp15 (AVISCEA BIOSCIENCE; cat # 00393-06-100) from a refrigerator at 4 deg.C, centrifuging at 12000rpm for 1 min at low temperature and high speed to make the powder aggregate at the bottom of the tube, dissolving with sterile PBS buffer (pH 7.2-7.4; 0.01M; cat # Solarbio; cat # P1020) to obtain protein Ctrp15 solution with concentration of 1mg/mL, and treating on ice;

(3) injection of protein Ctrp 15:

protein Ctrp15 injection group: the prepared protein Ctrp15 solution was aspirated into a 1mL insulin syringe and the graduations were marked. Mice in a myocardial infarction mouse model (non-motor group) constructed in the above (1) were anesthetized with isoflurane for 12 hours after MI using a gas anesthesia system, and according to the marked groups, protein Ctrp15 solution was injected into the corresponding mice through the medial angular veins of the mice, respectively, in an amount of 100 μ L in total per mouse, at a weight of 200ng protein/g mouse.

PBS injection group (control group): a control reagent PBS, which is different from the protein Ctrp15 injection group and is only injected intravenously;

the injection is respectively injected once again at 1 day and 3 days after the operation. In order to avoid adverse reaction of mice and ensure that eyes of the mice are not damaged in the injection process, the liquid of the injector is ensured not to have gas, the total injection amount is not higher than 100 mu L, and the speed is not suitable to be too high.

(4) And (3) post-injection treatment: the mice are placed in a warm pad at 37 ℃ and are continuously observed for half an hour after the mice revive, and the mice are placed in a feeding cage after no bleeding and other abnormalities exist.

Survival was counted and mice were weighed for Body Weight (BW) and Heart Weight (HW).

The results are shown in fig. 5, wherein a is a 28-day survival curve after myocardial infarction of the protein Ctrp15 injection group (marked as Ctrp15 recombinant protein in the figure) and the control group (PBS), B is a general heart diagram of the four weeks after myocardial infarction of the protein Ctrp15 group (marked as Ctrp15 recombinant protein in the figure) and the control group (PBS), and B1 is a heart/body weight ratio of the protein Ctrp15 group (marked as Ctrp15 recombinant protein in the figure) and the control group (PBS); the mice in each group were fed normally for 4 weeks (day 0 on day MI surgery), and as a result, it was found that the post-myocardial infarction mortality of the mice was significantly reduced after protein Ctrp15 supplementation (fig. 5A); in the protein Ctrp15 group, there was no significant change in the heart volume of mice around the post-myocardial infarction compared to the control group (PBS) (fig. 5B); the Body Weight (BW) and the Heart Weight (HW) of the mouse are weighed, and the heart body weight ratio of the mouse is calculated (fig. 5B 1), so that the heart body weight ratio reflecting the heart decompensation hyperplasia is obviously reduced after the protein Ctrp15 is supplemented, which indicates that the Ctrp15 protein can reduce the heart injury.

The arterial loop experiment was as follows:

(1) selecting mice of the protein Ctrp15 injection group (marked as Ctrp15 recombinant protein in the figure) and the PBS injection group (marked as a control group in the figure), taking off cervical vertebrae to be killed, and wiping skin with 75% alcohol for disinfection;

(2) separating thoracic aorta blood vessel, removing fat and connective tissue around aorta, and cutting into artery ring with length of about 0.5 mm;

(3) adding a sheared vascular ring into each well of a precooled 96-well cell culture plate, carefully adding 70 mu L of pre-melted Matrigel glue to cover the vascular ring at 37 ℃ and incubating for 0.5h to solidify the glue;

(4) 80. mu.L of a culture solution containing 10% FBS was added to cover the collagen surface.

(5) And on the third day, the arterial ring of the new blood capillary is observed under an inverted microscope.

As shown in fig. 5C, it can be seen that the mice injected with Ctrp15 protein in vivo have Ctrp 15-supplemented to promote the formation and regeneration of vascular side branches, compared to PBS-injected mice.

Example 3 knock-out of CTRP15 significantly aggravates cardiac injury after myocardial infarction

In order to determine the protection effect of Ctrp15 on cardiac function, a gene CTRP15 KO mouse is constructed; the coronary artery anterior descending is simultaneously ligated to WT and CTRP15 KO mice to construct a myocardial infarction model, and the influence of CTRP15 on heart injury after myocardial infarction is definitely knocked out by observing the neogenesis function and pathological change of blood vessel collateral.

Construction of CTRP15 gene knock-out mouse

Compared with the wild type C57BL/6 mouse, the CTRP15 gene knock-out mouse (named as CTRP15-KO mouse) only has the deletion of the 5122 th base C of the CTRP15 gene (sequence 2) in the genome, and the other genes are not changed.

The CTRP15 gene knock-out mouse can be prepared by site-directed mutagenesis or other existing techniques, and the invention takes the following as an example:

CTRP15 full-body knockout mice were constructed from Cyagen Biosciences.

The gene sequences identified were as follows:

mFam132b-1-F: 5’-CGTTGCACGAGCTTGGGATCT-3；

mFam132b-1-R: 5’-CTCGGTGAGTGCTGTGGAAAAGAC-3’。

the CTRP15 gene knock-out mouse creates a mFam132b knock-out by microinjecting TALENs in fertilized eggs of a C57BL/6 mouse, the mFam132b gene is located on mouse chromosome 1, and exon 5 is selected as a TALEN target site; the specific method comprises the following steps:

TALEN mRNA was obtained by in vitro transcription and then injected into fertilized eggs for KO mouse construction. Genotyping was performed by PCR (primers mFam132b-1-F and mFam132 b-1-R) and DNA sequencing analysis to obtain 322bp of CTRP15 gene knock-out mice.

In the CTRP15 gene knock-out mouse (named CTRP15-KO mouse), only the CTRP15 gene in the genome is deleted compared with the wild type mouse

Normal base sequence: 5'-tctgtgtgctccgtagcccgaagttgagggagccttccaccggggcccaggcttgaatctgaccagcggcc-3'

Knock-out mouse ID # 30: 5 '-tctgtgtgctccgtagcccgaagttgagggagc-ttccaccggggcccaggcttgaatctgaccagcggcc-3' (-1).

(II) construction of heart injury animal model

The construction of the heart injury animal model was carried out using the CTRP15-KO mouse and the C57BL/6 wild-type mouse in the same manner as in example 1.

(III) mouse arterial Ring test

(1) Selecting a heart injury animal model constructed by WT and a heart injury animal model constructed by a CTRP15-KO mouse, removing cervical vertebrae, killing, and wiping skin with 75% alcohol for disinfection;

(2) separating thoracic aorta blood vessel, removing fat and connective tissue around aorta, and cutting into artery ring with length of about 0.5 mm;

(3) adding a sheared vascular ring into each well of a precooled 96-well cell culture plate, carefully adding 70 mu L of pre-melted Matrigel glue to cover the vascular ring at 37 ℃ and incubating for 0.5h to solidify the glue;

(4) 80. mu.L of a culture solution containing 10% FBS was added to cover the collagen surface.

(5) And on the third day, the arterial ring of the new blood capillary is observed under an inverted microscope.

(IV) wheat germ agglutinin fluorescence (WGA) staining

(1) Firstly, performing paraffin embedding and fixed section on heart tissue, dewaxing by using dimethylbenzene and alcohol with gradient concentration to water, heating the water in a pressure cooker by using 1 x citric acid solution for 90 seconds to repair cell surface antigens of the section, taking out the section, continuing to cool the section at room temperature under the soaking of the citric acid solution, and then washing the section for 3 times by using 1 x PBS;

(2) further sealing the goat serum at room temperature for 30 minutes by using imported goat serum, wiping off the serum, performing drop dyeing by using 1 multiplied by WGA, incubating for 1 hour at 37 ℃ in a dark environment, washing residual dye by using 1 multiplied by PBS for 3 times and 3 minutes/time, sealing the slices by using DAPI sealing solution and cover glass, and storing the slices in a dark environment at 4 ℃;

(3) observing by using a Nikon fluorescence microscope in a dark environment, processing picture data by specific matched software after obtaining the picture, and calculating the cross-sectional area of the muscle cells.

The results are shown in fig. 6, wherein A represents the quantitative statistics of arterial ring experiments of normal wild mice and CTRP15 knockout mice, B represents the cardiac WGA staining and B1 represents the quantitative statistics of WGA staining after 4 weeks of myocardial infarction of normal wild mice and CTRP15 knockout mice; compared with normal wild mice, the CTRP15 knockout mice obviously weaken the regeneration function of vessel collateral; the compensatory changes in cardiomyocytes were detected by WGA staining and it was found that all of the CTRP15 knockout groups had larger lesions (increased myocyte cross-sectional area) than the other groups and aggravated post-myocardial infarction cardiac injury.

Example 4 differences in Ctrp15 expression levels in blood plasma of patients with cardiac injury and healthy persons

First, Ctrp15 expression level difference between blood plasma of heart injury patient and healthy person

According to the principle of sex age matching, 14 healthy people and 22 heart injury patients (the testee is informed, and the heart injury patients are identified) are selected, and the plasma Ctrp15 level of the testee is detected by ELISA.

The Ctrp15 content in human plasma was determined using an ELISA kit (company: antibodies-online GmbH, Germany; cat number ABIN 6955638) in which the well plate was coated with an antibody that specifically binds Ctrp15 protein.

(1) Preparing reagents, samples and standards as per instructions;

(2) add 100. mu.L of standard or sample per well. Incubate 1 hour at 37 ℃;

(3) add 100. mu.L of detection reagent A to each well and incubate for 60 minutes at 37 ℃;

(4) suction and wash plate 3 times;

(5) add 100. mu.L of detection reagent B to each well and incubate for 30 min at 37 ℃;

(6) suction and wash plate 5 times;

(7) add 90. mu.L of substrate solution to each well and incubate at 37 ℃ for 10-20 minutes;

(8) add 50. mu.L stop solution. Read immediately at 450nm and calculate.

The results are shown in fig. 7, where the expression level of Ctrp15 in the plasma of heart-injured patients was lower than that of healthy people (P < 0.01).

The Ctrp15 in the plasma as a marker can be applied to the preparation of products for detecting or diagnosing or assisting in detecting or assisting in diagnosing whether a person to be detected has heart damage or evaluating or assisting in evaluating the degree of heart damage of the person to be detected;

the application of the substance for detecting the Ctrp15 protein content in the blood plasma in preparing products for detecting or diagnosing or assisting in detecting or assisting in diagnosing whether a person to be detected has heart damage or evaluating or assisting in evaluating the degree of heart damage of the person to be detected;

the heart damage degree of the to-be-detected person with low Ctrp15 protein content in the plasma is larger than or is more than the candidate with high Ctrp15 protein content in the plasma.

The substance for detecting the Ctrp15 protein content in the plasma comprises an antibody specifically binding to Ctrp15 protein.

Sequence listing

<110> institute of cardiovascular and cerebrovascular diseases of Beijing

Application of <120> Ctrp15 in preparation of product for promoting angiogenesis and improving cardiac function related to ischemia

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 316

<212> PRT

<213> Artificial sequence

<400> 1

Leu Gly Val Pro Glu Ser Ala Glu Pro Val Gly Thr His Ala Arg Pro

1 5 10 15

Gln Pro Pro Gly Ala Glu Leu Pro Ala Pro Pro Ala Asn Ser Pro Pro

20 25 30

Glu Pro Thr Ile Ala His Ala His Ser Val Asp Pro Arg Asp Ala Trp

35 40 45

Met Leu Phe Val Lys Gln Ser Asp Lys Gly Ile Asn Ser Lys Arg Arg

50 55 60

Ser Lys Ala Arg Arg Leu Lys Leu Gly Leu Pro Gly Pro Pro Gly Pro

65 70 75 80

Pro Gly Pro Gln Gly Pro Pro Gly Pro Phe Ile Pro Ser Glu Val Leu

85 90 95

Leu Lys Glu Phe Gln Leu Leu Leu Lys Gly Ala Val Arg Gln Arg Glu

100 105 110

Ser His Leu Glu His Cys Thr Arg Asp Leu Thr Thr Pro Ala Ser Gly

115 120 125

Ser Pro Ser Arg Val Pro Ala Ala Gln Glu Leu Asp Ser Gln Asp Pro

130 135 140

Gly Ala Leu Leu Ala Leu Leu Ala Ala Thr Leu Ala Gln Gly Pro Arg

145 150 155 160

Ala Pro Arg Val Glu Ala Ala Phe His Cys Arg Leu Arg Arg Asp Val

165 170 175

Gln Val Asp Arg Arg Ala Leu His Glu Leu Gly Ile Tyr Tyr Leu Pro

180 185 190

Glu Val Glu Gly Ala Phe His Arg Gly Pro Gly Leu Asn Leu Thr Ser

195 200 205

Gly Gln Tyr Thr Ala Pro Val Ala Gly Phe Tyr Ala Leu Ala Ala Thr

210 215 220

Leu His Val Ala Leu Thr Glu Gln Pro Arg Lys Gly Pro Thr Arg Pro

225 230 235 240

Arg Asp Arg Leu Arg Leu Leu Ile Cys Ile Gln Ser Leu Cys Gln His

245 250 255

Asn Ala Ser Leu Glu Thr Val Met Gly Leu Glu Asn Ser Ser Glu Leu

260 265 270

Phe Thr Ile Ser Val Asn Gly Val Leu Tyr Leu Gln Ala Gly His Tyr

275 280 285

Thr Ser Val Phe Leu Asp Asn Ala Ser Gly Ser Ser Leu Thr Val Arg

290 295 300

Ser Gly Ser His Phe Ser Ala Ile Leu Leu Gly Leu

305 310 315

<210> 2

<211> 8907

<212> DNA

<213> Artificial sequence

<400> 2

tcctgaatgg ctagagctct ggggctatgc gcctgaactg gaccgcgtca ttaccttgag 60

ctagggtcca ggaagccatg ccagtaccag aactatttgg atctgggccc tctggaagaa 120

cccatgacat cactaggaca gtccgttgtt tgggaaaata actactttca catggcaaca 180

gatctggttg tcagcgctcc agctggggcc ctcactgtga acagagcagg gtcacttgat 240

atcttagggt catgcttccc aaatcaagtc ccttctttgg actccctctt ctagccttta 300

agggcacctg gacgcacaca atttaagatt aaaacaaatc aagcaagcaa gcaaacaaag 360

gaaaaaacaa aaaacaaaac aaaacaaaac aaaacaaaaa aagaaacaaa gaaacccagg 420

tgtgctgctt tatctacagc caatgtaatg acagcagctc aaggcagcta ggcctgcctc 480

tctggaggag aaccacccag aaaaggcctc ctcgcagttc atcctttagg atttgccaca 540

tctgtcctgg ttgaatgctc cgtggtgggc agtgggcagc agtctgagct ccatctgcct 600

ggcttaggac atcagaggga tccgaccttt cagccagact gggtcagttc tctgtagctg 660

ctagtagcag actccgtagc tggagcctga gaggtgccag ctgtgcagat acatccgggg 720

tggggaagag cagggaaacc ttaaaagtgc tccaggttcc ccagcttgaa aaggaggagc 780

cataagggct gccatattct caggtactca acttgtcatt aaggcctgga accatgagaa 840

aagaagagac ccggggcggg gggaggtcct aagaagacgt gcagaatggt gcagtgggtg 900

tccttagaga aagggggggg tgtcttagaa agcctcgggt gcagggctag gagaagagaa 960

gctaaccctg ggctacaggc agcaaagtgg aggcgtgcac ggaccggatc gggcgcccgc 1020

ctcctcaggg tcccctgtgc ctgcagagcg tgccctagcc gcgagggggc gacggcagcg 1080

agggcggcgc gcgcgaggcg ggggattcaa gcgcgttata aggcgccgac ctgaccagcc 1140

gtgctcttta ctgccgccgc cgccgccagc atggcctcga cccgccgccc cgtcggagct 1200

cgcacgctgc tcgcctgcgc cagcctactc gccgccatgg gcctcggtgt ccctgagtcc 1260

gcggagcccg tggggactca tgcacgcccg cagccgcccg gggccgagct gcccgccccg 1320

ccagccaaca gcccgccggt aagacgcagc cgcgccccac atcttcctgt cccggggggc 1380

cctaagacgg tggggaaggt ggcacccctt gctgcgcagt gtccaacact ggggatacgt 1440

cgctctcagg ggctctgtga gacccagggt tgggtggatg cgtcctctgt accgtggctt 1500

tggcggcaga actccactag gccagtagga gagattggga aaggtgtgaa atgcagttaa 1560

cttgctcctc gtgaaactgg aagactggtg agagagcggg gctcccagat ctagttcctt 1620

tttgttaggt gactgcgtct gggaaaggag tgatgtaacc aggctctgcc tgcgatccct 1680

cccaagatct ccacctgaac tgctggggtg gagacgcagg ctggggaggg tgtggctaga 1740

ggcctgggga gggtggattg gtagccttca ttggagctgg tcagtcctgt tggtgagagt 1800

tcagggaaga atttcagggt ctagttgatc gctcatgctg tgggccaggc acaaggaaac 1860

cccaggccag cgcgctcttc agttctcagc accccagggg ccaacaaaac atccactaag 1920

acagctggag atggttacaa tacctccctc tgcaaggcat ccctgggtcc ttccaccatc 1980

ccatttctgc ctcctttggt gggagtaaac atgtccttgt tgtctgaagc ctccccctga 2040

cccccagcca tcagccttca aaactttcat gaggtccaga catagtcacc aggaagtggg 2100

gagtaggctg gaccttccca gtggaatgtt ggccttgaac cctctttggg aggggcaagg 2160

tgtcaccagt tccctgatag ctggaaccca gctcccactc caactcctgg ggcccctgac 2220

caacatggct ccatgtattt tcggtgctgc cctcaagttg acagtggtgc gagtctgtac 2280

acaggccacc ggtcccctgg aagggtcagt acacctgttc tgacctataa tggaagcact 2340

gcactgtgag tgtccactga gggcatcaga cagcaagaag catagaagcc tccatcatcc 2400

tgacacagca gcctggcctg tgacccacaa gaccccggtt tgggtagttt tgagatcctg 2460

ggtctttctg tcagacactg gagtctgtgc ccttgacttc ttctaaggcc tcttgaatgg 2520

ttcattcctt tcctagctgg tagccctaca tggaacccag accattagag gcctattaac 2580

tgtcctattt gccaaaggcc tctgccagga aacaaggcca ctctcagagc ttgaatcctt 2640

gggccagtgt tttagaaagc tgagaaaagt aaaggcctag ctagagtcat gacatccggc 2700

tcctctgccc cactgctccc catgccctgt gaccacagtg gccctgaggc tggtctccct 2760

gacacttctg actgtgggga gggacaaaat gacctgttgt cacccagtat tcatatattc 2820

atagtcacct cctaagcaac tgtgggttcc agtgactgtc aaaggacggt gacactcaag 2880

gaaaagcaag aagatacatc ccagagcacc tgctttggag ccccactcct accttcctgc 2940

agcctgggct ccctcctcca tgggctgggg atgggtcgga cactacctct gaaaacacaa 3000

gtgacaaggg caagatgcta ccaagcaaac ctactgtggc catctgtgtt ccaggaaccc 3060

accattgcgc atgcacacag tgtggatccc cgggatgctt ggatgctgtt cgtcaagcag 3120

agtgacaagg ggatcaacag taagaggagg agcaaagcca ggaggctgaa ggtgagcagc 3180

ttgggcccac cacctccccg agcccctagt accctttcca acagcagaag ccatggaaag 3240

aaacaaggat caagtatgaa gctggcgtcc agcaagtcag gagttaggag ccctcaggat 3300

gccaggtcct ccccagattt cccttcatgg ccagagggag aagctcaccc aacatatgct 3360

aaggagttgg gttggcttcg ggctgctgga atggtacagg atgggagcct ctcagtatgg 3420

ccctggcttg ggcaggaagc tggcacttgg acctgatgac tgactcctgc attgagttcc 3480

tccaagtaac tctggatcca ggctgggctt cagtgtgtgt tgtgtttctc tattgagggt 3540

cagccttacc tgcccaggat ctgacccatt cactgggcct gggtgtgtgt atgtgtgtgt 3600

ggtcagccct gcccccttag gctacctggc cttgcttagg cttctctatg caggagcttg 3660

cctccttccc ttaggtcctg acccagacca gtataaactc ccaagtgcag tggagacttg 3720

ttgttgtgtc tcaggccaga ctgagattca cgtccccaga agcagcctgg gtggtcttta 3780

tctgggaatc acatccagag aggcagctgt agggctcttg catacagagc ctgccgtgcc 3840

ctgtacagcc cctaagaagc tccacatctg cacaatccca tccttgccca tgcctgcact 3900

ccatgcttga tgatagagga gtatgagagc cctaaggacc tccacacgga gggaagagcc 3960

cacagccaag gcgggagctc tcctgccagc ctcgatgtag gacccggcag aagggtcacc 4020

tctcccctca aatgttctta acctctacct tcccttccag cttggcctgc caggaccccc 4080

agggccacca ggtcctcagg gccccccagg cccctttatc ccatctgagg ttctgctgaa 4140

ggagttccag ctgttgctga aaggtagggg tgccattctg tgggcacatg ttctggtgtg 4200

ggcaaaccag cagggcatct ctagagggta aagttcaggt cccagcaaac acctgctatg 4260

ttgcttccct gttggccgcc ctgcctgtca tggggcggga ctgtgggtgg gagacatgcg 4320

gcaggtggaa gcctcaggga aggaggcctt ttattgttct tcactgagga caggccctgc 4380

agcctgctgc tggggagtgg ctgtcactat cttctgtaaa tgactgtacc atggaggact 4440

gctgcgagcc ctttcctgct tctgtgccac tgcttgtttg gttttaaata agcttccaga 4500

gggtgacgaa cctttgtgtt tcttccagta tagccacaat aagtatttct atacaacatt 4560

ctcaaaaata caggtatcgt tatagagggt gaggctagcg aacaagggtg ctgggtgctg 4620

gatatgcact tgctggagct tgtgtcagat ggtgtgaagg gaaactggca gctgccaggt 4680

caggcagtaa tgtccccagg acctccagtg tcagtcacca cgctctaagg ccacgggctg 4740

gtgagtagag tggtccaccg actgctttgt gtcaggcgca gtacggcagc gagagagcca 4800

tctggagcac tgcaccaggg atctcactac accagcctcg ggtagccctt cccgtgtccc 4860

agccgcccag gagcttgata gccaggaccc aggggcattg ttagctctgc tggctgcgac 4920

cttggcccag ggcccgcggg caccacgtgt ggaggccgca ttccactgtc gcttgcgccg 4980

ggatgtgcag gtggatcggc gtgcgttgca cgagcttggg atctactacc tggtgagtgg 5040

ggatgcagct ggctggatgg agcagggtgg ggacctaggg tgacctcgtc tgtgtgctcc 5100

gtagcccgaa gttgagggag ccttccaccg gggcccaggc ttgaatctga ccagcggcca 5160

gtacaccgca cctgtggctg gcttctatgc gcttgctgcc actctgcacg tgggtgaggt 5220

tcaggacgtg gcgatgggag ggaccatcca ttgccctgcc cctgccaggg tgcacatgac 5280

caccatggac caccatggcc tgtcttttcc acagcactca ccgagcagcc aagaaaggga 5340

ccaacacgac cccgggatcg tctgcgcctg ctgatctgca tccagtctct ctgccagcac 5400

aatgcgtgag tgggcattgc agcctagccc tttttagtgt aaagaccctc ttccattgac 5460

cccatcctac cctaactcct tcccaggacc catgagacag gcccttcctg attccaggac 5520

tctcattcag aggacagaga gagagagcga gcctctgtag ggcctttgtg gaattccatg 5580

agcccttcct tggtcactct cccgctcctc cccggtgaat ttgtcccatg acttttattg 5640

cttattactg gtggtgtcca tcctgtgtgc ctcatttggt ccatgagaac ggggactgtg 5700

accctctgcc tggtacctgg aatggaggcc aggcaaaggg caggtgctct gcatcgttgg 5760

gagaggtgtg agtgaacagt gggggaggtc tcagacctaa gctggctttg gacttcctaa 5820

atctgctggt tttgcatgtc acctatcttg gtttcccatc ggagaagcag gcctttgtgg 5880

ccttgcatgg atctggcctt tcctgtcttt cctcctgagg gcccaggttc aagcactgcc 5940

tcctagggat gatggctctg gacctagcac tttactgcct atggggctga gcactgaatg 6000

gctgctgctg agtgcagagt gcagctggcg agcctgggga caggctgacc ctctttctgt 6060

cttgggcgca gctccctgga gactgtgatg gggctggaga acagcagcga gctcttcacc 6120

atctcagtaa atggtgtcct ctatctacag gtgtgtgggg ctgtgctggc catgtgggaa 6180

gggggtgtag gggtgttggc agacgctcag ggctattggc atagcaccct tggacacatt 6240

caagtgccga tgctggcttg agaagaggcg agcttcaggt cccattctcc ctccaactct 6300

tatcccccag cccgtgttgg tgcgacagta gtttcacttt cagaccttcc aagaatctga 6360

tgtgacagac aggtgcttcc agccacccag gccctccatg gccaggaagg tggggggcat 6420

agaacttgat gaggcctgag cccctgggac tatgggaggc ccaagacagt tatatgtgga 6480

acctcagtga cggtctcttt tgtcattgtg gttggcattt actagaaagt aaagaggtgt 6540

gtggagtgct catatagttc tgctgagctc cagggtggat ggcttggatc aagccagctg 6600

tagtgctgtt agcatgagtt ccattgaagt caaagggtgt gcattacatg tgggtcctcg 6660

gaagcgactt ccctgggagg atctcagtcc ttattctggc agtttccagg gaatgtgatg 6720

ccacactggg cagccagagc agagtaatgc tcacgatggt tctacaggcc acagcaggcg 6780

gtggcagagg aaccaccttg cttgcctctt aaacctgacc tgagccctga gcaggagctt 6840

gctcccatat actgagatgg aaacactgga gagcaataga ataagagcca ctgtgtgggg 6900

tttgaatgcg agactaccaa acattgcctc tggactaaga tgtggtattc tcccatgtgg 6960

ggcagagtag gtcacagtat ggatatgact cctgttgggc actgtaggct gcctagggtc 7020

tctgctgcag ggccggccag ataactgaca tatgctcttc cctccaggca ggacactaca 7080

cttctgtctt cttggacaat gccagcggct cctccctcac ggtacgcagt ggctctcact 7140

tcagtgctat cctcctgggc ctgtgagcag ctgctgcagg ctcttaccct taccaagcag 7200

agtggtgaca gtggccctgt gcacaaggaa gcccactgga cctctgcaca cactggccat 7260

cgcaatacct cttaccatag ccactgtatt cctgcagagg tgatggaagc aggctctccc 7320

agaaccagca gcaatttgtg aatatcctaa gccctgcttg gctcttctgg gaccatccag 7380

cttacatggt agcacttgct ctattcccag ctacagagct ggcatccttg tagctctatt 7440

caggctcaaa ttccttcctg tggcccagca aactagtcag gccactcact acctgggaca 7500

actcagcctg cacagggtag gaaatgactg taggtcctta gtgcttaaga gggaagccca 7560

gaccttcttg gaccatacac tgtctacctg ggttcctgag ttcctatcct gcagtattct 7620

ctatgtctgc ctagagtaca gcctcaggga cctaggaacg tcaggggcca gtaatcctag 7680

gcctggcagc agtttctgtg tctggggtaa gcacgatgac ctgcaggccc ctggtgagca 7740

ccctaacata ctggagctac actcctttgc catccttatc ctctacaaag gctaccagcc 7800

aacttcccaa ccctcggagg ctcgggctca ctgctagggc ccacacacta aaccaaagtt 7860

tgagcacagt tatccacaca gggcacctgc tcacaagttt ccctcctgag actccattgt 7920

aaagggggtg ggtggtctgg ctgaatggca gcttgggagg aagaagctgg ctgagggctc 7980

ttcccatgag aagggctgcc accctgcagc ctgctttagt ggttttccca tttttaacaa 8040

aatgtgggac cagatcctaa taggcagtgg agagggctgg accttccaag tcctgatggc 8100

ctgctgatga aagagctgac agccagcagt ccacacccac cagctgcttt gggatctctt 8160

ggcctagcag gagtgctcaa gcctgggaca gaggggatag ctccagttgc ttcatctttc 8220

agctgacacc aggatgaagc taccacatca gaacgccctt ctataatcgg acctgtcccc 8280

aaatcaggct tccaacagag cgacaggtgc ctgggggagc tgtccgtgag caggcctggc 8340

ccgattctca gtatggctgg tacccaccct accaggaagc actgtgctgg cctgggtcct 8400

gactccctgg cactctgata aggacatgag gtggaaacac cccacccttt tctggatttc 8460

attttgtatc cagtgggcac agacatgtca gtgacgttat cttctaccct tgagaaagcc 8520

acataagcac atatcttacc ttccaacaac tgtgttacac agcaacttaa aagtatttat 8580

tgtgtcatat tgctaggcag aatatattta tgtaatggat cacacaaagc cctaacaatg 8640

aagggcagac ccgagaagca tgacctcttt ccagctcact tcaccaaaga ccatgagggg 8700

taagctctgg aaagcaaggg agaaatgcct ttagtcttga gactcctact gaagtagcag 8760

gagaggctct tactaaccag gaaggccaca gtgccaagag ttacccagac agaagcactt 8820

ggggacatgg gtcacagcct atggggcact gaatgattcc tgggctgcta tgaaattgct 8880

aaattaaact gtttagcttt ctgatga 8907

Claims (1)

1. The application of Ctrp15 protein or its coding gene or substance with Ctrp15 protein as active component in at least one of the following;

   1) preparing a product for treating heart injury caused by myocardial infarction;

   2) preparing a product for relieving heart injury caused by myocardial infarction;

   3) preparing products for promoting the formation and the regeneration of blood vessel side branches in the heart.

Images