CN114525295A - Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof - Google Patents

Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof Download PDF

Info

Publication number
CN114525295A
CN114525295A CN202011222747.3A CN202011222747A CN114525295A CN 114525295 A CN114525295 A CN 114525295A CN 202011222747 A CN202011222747 A CN 202011222747A CN 114525295 A CN114525295 A CN 114525295A
Authority
CN
China
Prior art keywords
cancer
anaerobic
salmonella
strains
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011222747.3A
Other languages
Chinese (zh)
Inventor
刘陈立
王作伟
盛方芊
曾正阳
卢伟琪
郭旋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Institute of Advanced Technology of CAS
Original Assignee
Shenzhen Institute of Advanced Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Institute of Advanced Technology of CAS filed Critical Shenzhen Institute of Advanced Technology of CAS
Priority to CN202011222747.3A priority Critical patent/CN114525295A/en
Publication of CN114525295A publication Critical patent/CN114525295A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/46—Ingredients of undetermined constitution or reaction products thereof, e.g. skin, bone, milk, cotton fibre, eggshell, oxgall or plant extracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01047—N-Acetyldiaminopimelate deacetylase (3.5.1.47)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y403/00—Carbon-nitrogen lyases (4.3)
    • C12Y403/03—Amine-lyases (4.3.3)
    • C12Y403/03007—4-Hydroxy-tetrahydrodipicolinate synthase (4.3.3.7)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)

Abstract

The invention relates to a method for constructing strict anaerobic salmonella, the strict anaerobic salmonella constructed by the method and application thereof in tumor treatment.

Description

Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof
Technical Field
The invention relates to the field of tumor targeted therapy, in particular to a method for constructing strict anaerobic salmonella, the strict anaerobic salmonella constructed by the method and application thereof in tumor therapy.
Background
Cancer is a leading cause of death worldwide. Compared with normal cells, cancer cells have the characteristics of unlimited proliferation, transformation and easy metastasis. In addition to uncontrolled division (which can undergo multipolar division), cancer cells can locally invade surrounding normal tissues and even metastasize to other organs via the systemic circulatory system or lymphatic system. The development history of cancer treatment shows that the traditional cancer treatment methods such as surgical treatment, chemotherapy, radiotherapy, immunology therapy, hormone therapy, bone marrow/stem cell transplantation and other treatment means have certain defects, for example, the surgical treatment has the problems of easy recurrence, difficult operation of part of tumors and the like, and chemotherapy can generate serious side reaction on patients to cause ineffective treatment. The difficulty of cancer treatment is caused by the complex and changeable etiology, and not only the change of the gene level of the organism exists, but also the change of the external environment is one of the important factors for the development of the cancer. The conventional therapies such as long-term radiotherapy, chemotherapy and immunotherapy have the disadvantages that the treatment schemes not only cause serious toxicity to normal tissues and organs, but also cause multiple drug resistance of cancer cells and cannot completely eliminate the cancer cells. In recent years, various researches show that gene therapy, noninvasive radio frequency cancer therapy, insulin-enhanced therapy, diet therapy and bacterial therapy can not only prevent cancer cells from generating multidrug resistance, but also enhance the curative effect of traditional therapies. Among them, bacterial therapy is a promising cancer treatment method to overcome the disadvantages of the conventional treatment methods.
The history of cancer treatment with live bacteria dates back over 150 years. In 1868, the german physician w.bush first applied bacteria to treat a surgically untreatable sarcoma and the patient had a half-reduced tumor volume and a smaller cervical lymph node volume within one week of treatment. Unfortunately, however, the patient died after 9 days from sepsis caused by bacterial infection. In 1883, the German surgeon Friedrich Fehleisen identified erysipelas as being caused by Streptococcus pyogenes infection. Subsequently, Friedrich Fehleisen and Willian B Coley, a surgeon from New York Hospital, each performed independently experiments demonstrating that Streptococcus pyogenes could regress tumors in patients. However, the results are subject to controversy because of the difficulty in duplicating the experimental results and the failure to meet the clinical standards at the time. Connell observed in 1935 that the filtrate from clostridial enzyme could resolve metastases. In 1947 scientists injected spores of C.histolyticum for the first time into mice transplanted with sarcoma, observed cancer cell lysis and tumor tissue regression. However, the survival rate of mice is low due to acute toxic reactions caused by bacteria. Bcg (attenuated mycobacterium bovis) was successfully used for cancer immunotherapy in 1959. A phase I clinical test is carried out on attenuated salmonella VNP20009(msbB-, purI-) in 2002, and the result shows that the strain can be planted in tumor tissues, but the effect on tumor treatment is not obvious.
Although VNP20009 has not achieved good clinical results, researchers believe that salmonella may be amenable to tumor treatment by a variety of means of modification, given the tumor-aggregating growth and immunoregulatory function of salmonella. The reason why the salmonella needs to be modified is that the wild salmonella has toxicity, can cause symptoms such as fever, vomiting, diarrhea, abdominal colic and the like, and can cause bacteremia to endanger life in severe cases. Along with the rapid development of molecular biology technology, salmonella can be modified by different strategies to be suitable for tumor treatment. The salmonella and virulence related genes can be knocked out, and the attenuated strain can be used for treating tumors early by constructing auxotrophic strains, regulating bacterial growth through gene loops and the like.
Bin Yu et al published a protocol for constructing strictly anaerobic Salmonella strains in journal SCIENTIFIC REPORTS in 2012 entitled Explicit hypoxia targeting with promoter depletion by culturing an "obligate" anaerobic Salmonella Typhimurium strain research paper. The prior art constructs a salmonella typhimurium SL7207 knockout key gene asd strain, asd gene deletion can influence the generation of bacterial cell walls, and an intermediate metabolite DAP (diaminopimelic acid) at the downstream of the asd gene is added into an LB culture medium, so that the bacteria can normally synthesize the cell walls. And on the basis, an anaerobic strain YB1 is constructed, wherein a gene loop (the gene loop is inserted into the position of the original asd gene) of which the Cm-pept-asd-sodA is controlled by anaerobic is inserted into the genome of the SL7207 knockout asd strain. FNR is a transcription regulator that is regulated by oxygen. Under the anaerobic condition, the FNR is in an activated state and can regulate and control a positive promoter Pept to enable the asd gene to be transcribed, so that bacteria can generate complete cell walls. The reverse promoter PsodA may block the leakage of the asd gene product from the forward promoter under aerobic conditions. The design can ensure that the YB1 strain can only grow under anaerobic condition, and DAP must be added into a culture medium to grow under aerobic condition.
Bin Yu et al characterize the viability of its YB1 strain under different oxygen conditions: under aerobic conditions, YB1 can not grow in LB (DAP-) culture medium and can grow in LB (DAP +) culture medium; YB1 can grow in LB (DAP +) and LB (DAP-) media under anaerobic conditions. The YB1 strain is distributed in a tumor-bearing mouse and is characterized by the effect of treating the tumor: after 26 days of tail vein injection of YB1 strain, the strain is cleared in normal tissues and organs, and bacteria exist in tumor tissues (because the oxygen concentration of the tumor tissues is very low and the tumor tissues are in an immunosuppressive environment). Compared with the PBS group, the YB1 strain has the ability of inhibiting tumor growth.
However, the YB1 bacterial strains of Bin Yu and the like need to be completely eliminated in normal tissues and organs for up to 26 days, so the time consumption is long and the safety is low; compared with the PBS group, the mice have significant weight reduction (more than 5%) after YB1 is injected into the tail vein of the tumor-bearing mice. As an important evaluation index for the health of mice, the weight is obviously reduced, which shows that the bacterium has stronger toxic effect on the mice.
There is also a need in the art for a method of construction that will produce a strain that can be easily cleared from normal tissues and organs in a shorter period of time, and that will reduce the toxic side effects on tumor-bearing mice due to the long-term persistence of the bacteria in the body, making the engineered strain safer and more reliable, and not affecting the efficacy of the bacteria in treating tumors.
Disclosure of Invention
In order to solve the problems of the prior art, the invention aims to provide a method for constructing strict anaerobic salmonella, the strict anaerobic salmonella constructed by the method and application thereof in tumor treatment.
In one aspect of the invention, a method for making facultative anaerobes into strictly anaerobic bacteria by hypoxia or strict anaerobically induced expression of essential gene expression loop, and the strict anaerobic bacteria can inhibit tumor growth and reduce tumor volume when applied to tumor therapy.
In one aspect of the present invention, in the above method, the facultative anaerobic bacterial genera comprise: bacteria of the Enterobacteriaceae family (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella, Shigella, etc.), Staphylococcus genus, Streptococcus genus, pneumococcus genus, Bacillus anthracis, and Corynebacterium diphtheriae.
In one aspect of the invention, in the above process, the facultative anaerobic bacteria are Salmonella species (Salmonella).
In one aspect of the invention, in the above method, the facultative anaerobic salmonella strain comprises strains derived from human, chicken, dog, cow, and the like.
In one aspect of the present invention, in the above method, the strictly anaerobic bacteria require additional addition of 2,6-Diaminopimelic acid (also known as 2, 6-diaminopyramic acid; 2,6-Diaminopimelic acid) and the like to the medium when cultured under aerobic conditions in vitro.
In one aspect of the present invention, in the above method, the essential gene is dapA or dapE but is not limited to the gene, and further includes one or more selected from dapB, dapD, argD, dapF, murE, murF, or lysA.
In one aspect of the present invention, in the above method, the strict anaerobic regulatory gene loop consists of an anaerobically activated promoter and an essential gene.
In one aspect of the invention, in the above method, the gene circuit of the essential gene for hypoxia or strict anaerobic induced expression regulation is present in a chromosome or other plasmid vector.
In one aspect of the invention, in the above method, the anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.
In one aspect of the present invention, in the above method, the transcription regulatory factor that regulates the promoter is Fnr or arcA. Wherein the Fnr-SP promoter is controlled by a transcription regulatory factor Fnr, and the Ptet-arcA promoter is controlled by a transcription regulatory factor arcA
In one aspect of the present invention, in the above method, the tumor cancer includes leukemia (chronic leukemia, acute leukemia), bone cancer, lymphoma (non-hodgkin lymphoma, hodgkin lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, stomach cancer, pelvic cancer (cervical cancer, ovarian malignancy, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, and the like.
In one aspect of the invention, methods are provided for treating cancer using anaerobic loop regulated bacteria comprising strictly hypoxia regulated essential gene expression.
In one aspect of the invention, the method of treatment further comprises: in combination with other therapies for the treatment of cancer.
In one aspect of the invention, the bacterium is Salmonella typhi (Salmonella typhi).
In one aspect of the invention, the method of treatment, wherein the facultative anaerobic bacteria are Salmonella typhimurium.
In one aspect of the invention, the facultative anaerobic salmonella strain includes strains derived from human, chicken, dog, cow, and the like, in the method of treatment.
In one aspect of the invention, in the method of treatment, the facultative anaerobic bacteria genera comprise: enterobacteriaceae bacteria (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, pneumococcus, Bacillus anthracis, and Corynebacterium diphtheriae, etc.
In one aspect of the invention, the method of treatment wherein the other cancer treatment is used in combination comprises: (a) bacterial therapy of anaerobic strains in combination with surgical therapy; (b) bacterial therapy of anaerobic strains in combination with radiation therapy; (c) bacterial therapy of anaerobic strains in combination with chemicals: chemotherapeutic agents include alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, narcistine, etc.), antimetabolites (doxifluridine, 6-mercaptopurine, cytarabine, fluoroguanosine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, eufordine, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, epirubicin, mitomycin, pelomycin, pingomycin, pirarubicin, etc.), phyto-type anticancer drugs (irinotecan, cephalotaxine, hydroxycamptothecin, vinorelbine, taxol, taxotere, topotecan, vincristine, vindesine, vinblastine, etc.), hormones (atamestane, anastrozole, brumidt, letrozole, fulvestrant, megestrol, tamoxifen, etc.), immunosuppressive agents, and other anticancer drugs such as asparaginase, etc, Carboplatin, cisplatin, dacarbazine, oxaliplatin, levofloxacin, coplatin, mitoxantrone, procarbazine, and the like; (d) bacterial therapy of anaerobic strains in combination with biological treatment; (e) the bacterial therapy of the anaerobic strain is combined with the traditional Chinese medicine treatment.
In one aspect of the invention, there is provided a vector which is a prokaryotic cell comprising the following elements: (a) hypoxia or strict anaerobic activated promoter; and (b) an essential gene regulated by the promoter of (a); wherein the promoter in (a) has a binding site for an anaerobically activated transcription regulatory factor.
In one aspect of the invention, in the vector, the anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.
In one aspect of the present invention, in the vector, the essential gene is dapA or dapE; and/or, wherein the transcriptional regulator is Fnr, arcA. Wherein, the Fnr-SP promoter is regulated by a transcription regulating factor Fnr; the Ptet-arcA promoter is regulated by a transcription regulatory factor arcA
In one aspect of the invention, culturing in a carrier under aerobic conditions in vitro requires the addition of 2,6-diaminopimelic acid to the culture medium.
In one aspect of the invention, there is provided the use of a strictly anaerobic salmonella expressing drug or as a carrier for a drug for the treatment of cancer.
In one aspect of the invention, in the use, the medicament comprises: (a) expressing a protein substance or a polypeptide substance having a cancer treatment effect; (b) expressing an RNA having a cancer treatment effect; (c) as a carrier to carry the modified RNA drug.
Drawings
FIG. 1 is a schematic diagram of construction of R1074 strain.
FIGS. 2A-2G are electrophoretograms of the construction of 9 strains (SL7207 (. DELTA.dapA) -promoter-BBa _ B0033-dapA).
FIGS. 3A, 3B and 3C are in vitro experiments with 9 strains, FIGS. 3A and 3B are photographs of 9 strains (shown as abbreviations for the strains on the left side of the photographs) cultured under aerobic conditions for 24 to 144h, FIGS. 3B and 3B are photographs of 9 strains (shown as abbreviations for the strains on the left side of the photographs) cultured under anaerobic conditions for 24h, FIGS. 3C are photographs of 9 strains (shown as abbreviations for the strains on the ordinate) cultured under anaerobic conditions for 24h, and the values of OD600 were measured.
FIGS. 4A-4E show the results of in vivo experiments with 9 constructed strains.
FIGS. 5 (A) - (E) are electrophoretograms constructed from 5 strains (SL7207 (. DELTA.dapE) -promoter (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE).
FIGS. 6A, 6B and 6C are in vitro experiments with 5 strains, FIGS. 6A are photographs of 5 strains (shown as the left strain abbreviation in the photographs) cultured under aerobic conditions for 24-72h, FIGS. 6B are photographs of 5 strains (shown as the left strain abbreviation in the photographs) cultured under anaerobic conditions for 24h, FIGS. 6C are photographs of 5 strains (shown as the left strain abbreviation in the photographs) cultured under anaerobic conditions for 24h, and the values of OD600 were measured.
FIG. 7 shows an in vivo experiment of SL7207 (. DELTA.dapE) -R1074-BBa _ B0033-dapE (abbreviation: R1074-1) strain.
Detailed Description
While the invention is susceptible to various modifications and alternative forms, specific examples will be described and illustrated in detail below. It should be understood, however, that these are not intended to limit the invention to the particular disclosure, and that the invention includes all modifications, equivalents, and alternatives thereof without departing from the spirit and technical scope of the invention.
Hereinafter, a method of constructing strictly anaerobic salmonella, strictly anaerobic salmonella constructed using the same, and use thereof in tumor treatment according to embodiments of the present invention will be explained in more detail.
In one or more embodiments of the invention, the vector of the invention is a prokaryotic cell comprising the following elements: (a) hypoxia or strict anaerobic activated promoter; and (b) an essential gene regulated by the promoter of (a), wherein the promoter of (a) presents a binding site for an anaerobically activated transcription regulatory factor.
In one or more embodiments of the invention, (a) the hypoxia or strict anaerobic activated promoter may be, for example, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, YsgAP.
In one or more embodiments of the present invention, the transcriptional regulator is Fnr or arcA.
In one or more embodiments of the present invention, the essential gene (b) regulated by the promoter of (a) may be, for example, dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular dapA or dapE.
The present invention provides a method for making facultative anaerobic bacteria into strictly anaerobic bacteria by means of hypoxia or a circuit for strictly anaerobically inducing expression of essential genes.
In one or more embodiments of the invention, the strict anaerobic regulatory gene loop consists of an anaerobically activated promoter and essential genes.
In one or more embodiments of the invention, anaerobically activated promoters may be, for example, Pept, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, YsgAP.
In one or more embodiments of the present invention, the essential gene may be dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular dapA or dapE.
When the essential gene is dapA or dapE gene, the vector of the present invention requires additional addition of 2,6-Diaminopimelic acid (also known as 2, 6-diaminopyramic acid; 2,6-Diaminopimelic acid) or the like to the medium when cultured under aerobic conditions.
When the strict anaerobe is applied to in-vivo tumor treatment, the growth of tumors can be inhibited and the tumor volume can be reduced.
The facultative anaerobe may be any of the species from any of the genera enterobacteriaceae (e.coli, pneumococcus, proteus, enterobacter, typhoid bacillus, salmonella, shigella, etc.), staphylococcus, streptococcus, pneumococcus, anthrax bacillus, diphtheria bacillus, etc.
The origin of the facultative anaerobic salmonella strain is not limited as long as it is facultative anaerobic, and examples thereof include facultative anaerobic salmonella strains derived from humans, chickens, dogs, cattle, and the like.
The facultative anaerobic bacteria are Salmonella typhimurium (Salmonella typhimurium).
The invention also provides bacterial therapies for treating cancer using the strains of the invention that do not grow under both aerobic and anaerobic conditions.
The cancer includes leukemia (chronic leukemia, acute leukemia), bone cancer, lymph cancer (non-Hodgkin lymphoma, Hodgkin lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, gastric cancer, pelvic cancer (cervical cancer, ovarian malignant tumor, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.
In one or more embodiments of the invention, the vector of the invention as a prokaryotic cell, or the strictly anaerobic bacteria obtained by the method of the invention, may be used as a bacterial therapy for anti-tumor or cancer therapy.
In one or more embodiments of the invention, the bacterial therapy of the invention may be used in combination with other cancer treatment methods.
In one or more embodiments of the invention, the combined use of bacterial therapy with other cancer treatment methods includes, for example: (a) bacterial therapy of anaerobic strains in combination with surgical therapy; (b) bacterial therapy of anaerobic strains in combination with radiation therapy; (c) bacterial therapy of anaerobic strains in combination with chemicals: chemotherapeutic agents include alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, narcotine, etc.), antimetabolites (doxifluridine, doxycycline, 6-mercaptopurine, cytarabine, fluoroguanosine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, efadine, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, epirubicin, mitomycin, pellomycin, pingomycin, pirarubicin, etc.), phytocarcinoid (irinotecan, cephalotaxine, hydroxycamptothecin, vinorelbine, taxol, taxotere, topotecan, vincristine, vindesine, vinblastine, etc.), hormones (atamestane, anastrozole, aminoglutethimide, letrozole, fulvestramustine, medroxyprogesterone, tamoxifene, etc.), immunosuppressive agents, and other anticancer drugs such as asparaginase, Carboplatin, cisplatin, dacarbazine, oxaliplatin, levofloxacin, coplatin, mitoxantrone, procarbazine, and the like; (d) bacterial therapy of anaerobic strains in combination with biological treatment; (e) the bacterial therapy of the anaerobic strain is combined with the traditional Chinese medicine treatment.
The vector of the invention, which is a prokaryotic cell, or the strict anaerobe obtained by the method of the invention can also be used for inducing and expressing a drug in vitro or carrying a drug as a vector for cancer treatment.
In embodiments of the invention, the drugs that may be carried in the carrier include: (a) expressing a protein substance or a polypeptide substance having a cancer treatment effect; (b) expressing an RNA having a cancer treatment effect; (c) as a carrier to carry the modified RNA drug.
The invention has the advantages that:
(1) the anaerobic regulation and control module for strain reconstruction is simpler, the regulation and control system is more rigorous, and the problem of background leakage does not exist under the aerobic condition;
(2) the modified strain can be completely removed in a short time in normal tissues and organs;
(3) the modified strain has almost no influence on the body weight of a mouse in the process of treating a tumor-bearing mouse, has small toxic and side effects and improves the safety.
The strain construction scheme is shown in FIG. 1 and FIG. 5: on the basis of SL7207 (delta dapA) and SL7207 (delta dapE) which have already been constructed in the laboratory, the Fnr-SP, Hip1, I14018, Pept, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, YsgAP-BBa _ B0033-dapA anaerobic gene loop is integrated into the SL7207 (delta dapA) genome (original dapA position); the anaerobic gene loop of Fnr-SP, Hip1, Pept, R1074, YsgAP-BBa _ B0033-dapE was integrated into the SL7207 (. DELTA.dapE) genome (original dapA position). dapA and dapE genes are key genes on a lysine metabolic pathway, and bacteria cannot form a normal cell wall by knocking out any one of the two genes, so that the internal and external osmotic pressures of the bacteria are unbalanced, and the bacteria cannot survive after being broken. The promoter is an anaerobically activated promoter that initiates transcription of dapA or dapE genes under anaerobic or hypoxic conditions, thereby allowing DAP to be produced by downstream DAP proteins. Bacteria can form an intact cell wall. Under aerobic conditions, 9 promoter-BBa _ B0033-dapA or 5 promoter-BBa _ B0033-dapE gene loops are in an inactivated state, and the bacteria cannot generate complete cell walls. Culturing SL7207 (. DELTA.dapA) -Promoters (9 Promoters, as shown in Table 1) -BBa _ B0033-dapA strain or SL7207 (. DELTA.dapE) -Promoters (5 Promoters) -BBa _ B0033-dapE strain under aerobic conditions, requires DAP (diaminopimelic acid) addition and can compensate for the deletion of dapA or dapE genes leading to the failure of the bacterium to form an intact cell wall.
TABLE 1 promoters useful in the invention
Promoter name Sequence of
Fnr-SP 5’GATCCGCCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCTTGCAGGTGAATGCAACGTCAAGCGAT 3’
Hip1 5’GATCGGATAAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTAATAATGTTGTCA 3’
I14018 5’GATCTGTAAGTTTATACATAGGCGAGTACTCTGTTATGG 3’
Pept 5’GATCGCAGGGGTAAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTCTTAATAATGTTGTCACAAAAAGTGAGGGTGACTACATGG 3’
Ptet-arcA 5’GATCGTTAATAAAATGTTATTGACAGTTAATAAAATGTTATACTGAGC 3’
Ptet-Fnr 5’GATCAAAATTGATCTGAATCAATATTTTGACAAAAATTGATCTGAATCAATATTTACTGAGC 3’
R1074 5’GATCTTAAATTTCCTCTCGTCAGGCCGGAATAACTCCCTATAATGCGCCACCACACTGATAGTGCTAGTGTAGATCAC 3’
Ssbp1 5’GATCAACCGAGGTCACAACATAGTAAAAGCGCTATTGGTAATGGTACAATCGCGCGTTTACACTTATTCAGAACGATTTTTTTCAGGAG 3’
YsgAP 5’GATCTCAGAAGAAGCAAAAAGACACTTTACCGAAGGGTTTAACATTTTTTCGTGATACTCATCACCATGACGCAAATGCGTTGCATAAA 3’
TABLE 2 primers used for cloning of the present invention
Figure BDA0002762642560000091
Figure BDA0002762642560000101
Example (b):
example 1: 9 strictly anaerobic strains (SL7207 (. DELTA.dapA) -Promoters-BBa _ B0033-dapA) were constructed (the primers used in the following experiments are shown in Table 2)
1. Construction of pSC101-BBa _ B0033-dapA plasmid
a. Taking pSC101-FbFp-KnaR-loxp + promoter plasmid as a template, and taking a vector forward primer and a vector reverse primer as primers, and carrying out PCR to obtain a linearized vector fragment 1;
b. performing PCR by using a salmonella SL7207 genome as a template and a dapA gene forward primer and a dapA gene reverse primer as primers to obtain a target fragment 1;
c. the plasmid pSC101-BBa _ B0033-dapA is obtained by a one-step cloning method.
2. Construction of pSC101-R1074-BBa _ B0033-dapA plasmid
Carrying out enzyme digestion on pSC101-BBa _ B0033-dapA plasmid through BsaI to obtain a linearized vector fragment 2;
b. obtaining an R1074 promoter fragment by a primer annealing method;
c. the plasmid pSC101-R1074-BBa _ B0033-dapA was obtained by ligase ligation.
3. Construction of SL7207(Δ dapA) -R1074-BBa _ B0033-dapA Strain
a. PCR was performed using pSC101-R1074-BBa _ B0033-dapA plasmid as a template and dapA homologous recombination forward primer and dapA homologous recombination reverse primer as primers to obtain homologous recombination fragment 2;
b. the homologous recombination fragment 2 was integrated at the position of the original dapA gene of SL7207(Δ dapA) by the lambda-red homologous recombination method to obtain SL7207(Δ dapA) -R1074-BBa _ B0033-dapA target strain.
The other 8 target strains (see below) were constructed in a manner similar to that of SL7207 (. DELTA.dapA) -R1074-BBa _ B0033-dapA strain, and the primer annealing fragment B in step 2 was replaced with the promoter fragments Hip1, I14018, Ptet-Fnr, PepT, Ptet-arcA, Ssbp1, Fnr-SP and YsgAP, respectively.
1.SL7207(ΔdapA)-Fnr-SP-BBa_B0033-dapA；
2.SL7207(ΔdapA)-Hip1-BBa_B0033-dapA；
3.SL7207(ΔdapA)-I14018-BBa_B0033-dapA；
4.SL7207(ΔdapA)-Pept-BBa_B0033-dapA；
5.SL7207(ΔdapA)-Ptet-arcA-BBa_B0033-dapA；
6.SL7207(ΔdapA)-Ptet-Fnr-BBa_B0033-dapA；
7.SL7207(ΔdapA)-Ssbp1-BBa_B0033-dapA；
8.SL7207(ΔdapA)-YsgAP-BBa_B0033-dapA。
The 9 strains were each abbreviated as (Fnr-SP; Hip 1; I14018; Pept; Ptet-arcA; Ptet-Fnr; R1074; Ssbp 1; YsgAP), and the results of electrophoresis were shown in FIGS. 2A to 2G.
Example 2: in vitro characterization of 9 strains
Characterization under aerobic conditions: 1 monoclonal was picked and added to LB (DAP +) medium containing kanamycin; 3 clones were picked and added to LB (DAP-) medium containing kanamycin, respectively. Incubated on an air shaker (37 ℃ C., 220rpm) for a period of time.
Characterization under anaerobic conditions: 3 single clones were picked and added to LB (DAP +) medium containing kanamycin. The culture was carried out overnight on an air shaker (37 ℃ C., 220 rpm). The overnight cultured broth was placed in an anaerobic incubator at a rate of 1: switching is carried out at a ratio of 100. Adding 20 mul of bacterial liquid into 2ml of LB (DAP +) culture medium containing kanamycin; mu.l of the bacterial suspension was added to 2ml of LB (DAP-) medium containing kanamycin, and 3 replicates were used. The initial OD600 values of the samples after transfer were measured. And (5) standing and culturing for 24h at 37 ℃ in an anaerobic box. OD600 values of the samples after 24h of incubation were measured.
Experimental results (as in fig. 3A-3C):
(1) under aerobic conditions: 9 strains are cultured in LB (DAP +) medium for 144h, and the strains can grow normally. 9 strains were cultured in LB (DAP-) medium for 144h, and these strains failed to grow.
(2) Under anaerobic conditions: 9 strains are cultured in LB (DAP +) medium and LB (DAP-) medium for 24 h. These strains can grow in both LB (DAP +) medium and LB (DAP-) medium.
And (4) experimental conclusion: tests on the strain under aerobic and anaerobic conditions show that the facultative anaerobic strain SL7207 is successfully transformed into a strict anaerobic strain.
Example 3: in vivo characterization of 9 strains
C57BL/6 mice were inoculated subcutaneously with 1X 106Mouse bladder cancer cell (MB 49)/mouse, and establishing mouse bladder cancer subcutaneous tumor model. The experiments are divided into a PBS group, a SL7207 strain group, a Fnr-SP group, a Hip1 group, an I14018 group, a Pept group, a Ptet-arcA group, a Ptet-Fnr group, a R1074 group, a Ssbp1 group and a YsgAP group. Tail vein inoculation of 1X 107One mouse per each of the bacteria of the present invention. Detecting the distribution of bacteria in normal tissues, organs and tumors of the tumor-bearing mice, the change of tumor volume, the change of mouse weight and the survival rate of the mice within 6 days. Experimental results (as in fig. 4A-4E):
(1) the bacteria were distributed in tumor-bearing mice (fig. 4A-4E, left column): the strain in the Fnr-SP group has a slow clearance speed in vivo, and a large amount of bacteria exist in normal tissues and tumor tissues; hip1, I14018, R1074 and Ssbp1 strains cleared faster in vivo. The bacteria in heart, liver, lung, kidney and blood are less, and 10 bacteria exist in spleen and tumor tissue4(CFU/g). The bacteria of the Pept group and the YsgAP group only have a small amount of residues in the liver and the spleen, and no bacteria exist in other tissues, organs and tumors. The Ptet-arcA group bacteria only exist in small amount in heart, liver and lung, and in spleen, kidney and bloodNeither the fluid nor the tumor tissue was free of bacteria. The Ptet-Fnr group bacteria only exist in liver and tumor tissues, and no bacteria exist in other organs.
(2) Tumor volume change (fig. 4A-4E, middle column): compared with the PBS group, the 9 strain groups have the effect of inhibiting the growth of the tumor within 6 days.
(3) Mouse body weight change (fig. 4A-4E, right column): mice in the 9 strain group had less weight loss compared to the SL7207 group, slightly lower than the PBS group.
(4) Survival rate of mice: all mice in the SL7207 group died within 6 days. No death occurred between the 9 strain groups and the PBS group mice in the experimental period.
And (4) experimental conclusion: within 6 days, the distribution of the 9 modified strains in normal tissues and organs in vivo is not completely the same as that in tumors. Compared to the SL7207 group, the 9 bacteria of the present invention were largely eliminated in vivo. The tumor volumes of the 9 strain groups of the invention are all reduced. Mice of 9 strains had a slightly lower body weight than the PBS group during the experimental period and did not die. The results show that compared with the prior art, the 9 strains of the invention have improved safety and tumor inhibition effect.
Example 4: construction of 5 strictly anaerobic strains (SL7207 (. DELTA.dapE) -Promoters-BBa _ B0033-dapE)
1. Construction of pSC101-Promoters-BBa _ B0033-dapE plasmid
a. PCR was performed using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapA plasmid as a template and vector forward primer 3 and vector reverse primer 4 as primers to obtain 5 linearized vector fragments (results are shown in FIG. 5 (A));
b. using a salmonella SL7207 genome as a template, a dapE gene forward primer and a dapE gene reverse primer as primers, and carrying out PCR to obtain a target fragment 2 (the result is shown as (A) in figure 5);
c. the plasmid pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE was obtained by the one-step cloning method (the results are shown in FIG. 5 (B)).
3. Construction of SL7207(Δ dapE) -Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE Strain
a. 5 homologous recombination fragments were obtained by PCR using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE plasmid as a template and dapE homologous recombination forward primer and dapE homologous recombination reverse primer as primers (results are shown in FIG. 5 (C));
b. the 5 homologous recombination fragments were integrated into SL7207 (. DELTA.dapE) at the position of the original dapE gene by the lambda-red homologous recombination method to obtain SL7207 (. DELTA.dapE) -Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE as the target strain (results are shown in (D), (E) in FIG. 5).
The 5 strains are respectively abbreviated as (R1074-1, YsgAP-1, Fnr-SP-1, Pept-1 and Hip 1-1).
Example 5: in vitro characterization of 5 strictly anaerobic strains (SL7207 (. DELTA.dapE) -Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1) -BBa _ B0033-dapE)
Characterization under aerobic conditions: 3 clones were picked and added to LB (DAP +) medium containing spectinomycin and cultured overnight on an air shaker (37 ℃ C., 220 rpm). The overnight culture was incubated at a temperature of 1: switching is carried out at a ratio of 100. Adding 20 mul of bacterial liquid into 2ml of LB (DAP +) culture medium containing spectinomycin; mu.l of the bacterial suspension was added to 2ml of LB (DAP-) medium containing spectinomycin, and the mixture was repeated 3 times. The strain was cultured for 72 hours on an air shaker (37 ℃ C., 220rpm) and the growth was observed.
Characterization under anaerobic conditions: 3 of the single colonies were picked up and added to LB (DAP +) medium containing spectinomycin and cultured overnight in an air shaker (37 ℃ C., 220 rpm). The overnight cultured broth was placed in an anaerobic incubator at a rate of 1: switching is carried out at a ratio of 100. Adding 20 mul of bacterial liquid into 2ml of LB (DAP +) culture medium containing spectinomycin; mu.l of the bacterial suspension was added to 2ml of LB (DAP-) medium containing spectinomycin, and 3 replicates were used. And (4) standing and culturing for 24h in an anaerobic box (37 ℃). OD600 values of the samples after 24h of incubation were measured.
Experimental results (fig. 6A, 6B, 6C):
(1) under aerobic conditions: 5 strains are cultured in LB (DAP +) medium for 72h, and the strains can grow normally. The 5 strains were cultured in LB (DAP-) medium for 72 hours, and these strains failed to grow.
(2) Under anaerobic conditions: 5 strains are cultured in LB (DAP +) medium and LB (DAP-) medium for 24 h. These strains can grow in both LB (DAP +) medium and LB (DAP-) medium.
And (4) experimental conclusion: tests of 5 strains under aerobic and anaerobic conditions show that the facultative anaerobic strain SL7207 is successfully transformed into a strict anaerobic strain.
Example 6: in vivo characterization of R1074-1 Strain
C57BL/6 mice were inoculated subcutaneously with 1X 106Mouse bladder cancer cell (MB 49)/mouse, and establishing mouse bladder cancer subcutaneous tumor model. The experiment was divided into PBS group and R1074-1 group. Tail vein inoculation of 1X 107One bacterium of the invention per mouse. And detecting the change of tumor volume, the change of mouse weight and the survival rate of the mouse within 14 days. Experimental results (as in fig. 7):
(1) tumor volume change (a in fig. 7): compared with the PBS group, the R1074-1 strain group has the effect of inhibiting the growth of tumors in the experimental period.
(2) Mouse weight change (B in fig. 7): compared with the PBS group, the R1074-1 strain group has no significant difference in the body weight of mice in the test period
(3) Survival rate of mice in the experimental period, the mice in the PBS group and the R1074-1 strain group survive.
And (4) experimental conclusion: in an experimental period, the R1074-1 strain can inhibit the growth of mouse tumor; meanwhile, compared with the PBS group, the weight of the mice has no significant difference and the mice survive, which indicates that the strain is safe.

Claims (10)

1. A method for making facultative anaerobes into strictly anaerobic bacteria by inducing a loop expressing essential genes through hypoxia or strict anaerobe, and the strictly anaerobic bacteria can inhibit tumor growth and reduce tumor volume when being applied to tumor treatment.
2. The method of claim 1, wherein the facultative anaerobic bacterial genera comprise: bacteria of the family enterobacteriaceae (escherichia coli, pneumococcus, proteus, enterobacteriaceae, typhoid bacillus, Salmonella, shigella, etc.), staphylococcus, streptococcus, pneumococcus, anthrax bacillus and diphtheria bacillus, preferably the facultative anaerobic bacteria are Salmonella species (Salmonella), preferably the facultative anaerobic Salmonella strains include strains from human, chicken, dog, cattle; and/or
Wherein the strict anaerobe is cultured under the aerobic condition in vitro, and 2,6-Diaminopimelic acid (alias: 2, 6-diaminopyramic acid; 2,6-Diaminopimelic acid) or analogues thereof is required to be additionally added into a culture medium; and/or
Wherein the essential gene includes dapA or dapE but is not limited to the gene, and further includes one or more selected from dapB, dapD, argD, dapF, murE, murF, or lysA; and/or
Wherein the strict anaerobic regulatory gene loop consists of an anaerobically activated promoter and an essential gene; and/or
Wherein the gene circuit of the essential gene for hypoxia or strict anaerobic induced expression regulation is present in the chromosome or other plasmid vector.
3. The method of claim 1, wherein the anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, and YsgAP.
4. A method of treating cancer using anaerobic loop regulated bacteria comprising strictly hypoxia regulated essential gene expression; and/or
Preferably, the method further comprises: in combination with other cancer therapies; and/or
Preferably, wherein said other cancer treatment methods comprise, in combination: (a) bacterial therapy of anaerobic strains in combination with surgical therapy; (b) bacterial therapy of anaerobic strains in combination with radiation therapy; (c) bacterial therapy of anaerobic strains in combination with chemicals: chemotherapeutic agents include alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, narcotine, etc.), antimetabolites (doxifluridine, doxycycline, 6-mercaptopurine, cytarabine, fluoroguanosine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, efadine, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, epirubicin, mitomycin, pellomycin, pingomycin, pirarubicin, etc.), phytocarcinoid (irinotecan, cephalotaxine, hydroxycamptothecin, vinorelbine, taxol, taxotere, topotecan, vincristine, vindesine, vinblastine, etc.), hormones (atamestane, anastrozole, aminoglutethimide, letrozole, fulvestramustine, medroxyprogesterone, tamoxifene, etc.), immunosuppressive agents, and other anticancer drugs such as asparaginase, Carboplatin, cisplatin, dacarbazine, oxaliplatin, levofloxacin, coplatin, mitoxantrone, procarbazine, and the like; (d) bacterial therapy of anaerobic strains in combination with biological treatment; (e) the bacterial therapy of the anaerobic strain is combined with the traditional Chinese medicine treatment; and/or
Preferably, the tumor cancer includes leukemia (chronic leukemia, acute leukemia), bone cancer, lymph cancer (non-hodgkin lymphoma, hodgkin lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, stomach cancer, pelvic cancer (cervical cancer, ovarian malignant tumor, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.
5. A vector, which is a prokaryotic cell comprising the following elements: (a) hypoxia or strict anaerobic activated promoter; and (b) an essential gene regulated by the promoter of (a); wherein the promoter in (a) has a binding site for an anaerobically activated transcription regulatory factor.
6. The vector of claim 5, wherein the anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, and YsgAP.
7. The vector according to claim 5, wherein the essential gene comprises dapA or dapE but is not limited to the gene, and further comprises one or more selected from dapB, dapD, argD, dapF, murE, murF, or lysA.
8. The vector according to claim 5, wherein the culture under aerobic conditions in vitro requires the addition of 2,6-diaminopimelic acid to the culture medium.
9. Use of strictly anaerobic salmonella for expressing a drug or as a carrier for a drug for the treatment of cancer.
10. The use of salmonella strictly anaerobic for the expression or as a vector for carrying a drug according to claim 9, wherein the drug comprises: (a) expressing a protein substance or a polypeptide substance having a cancer treatment effect; (b) expressing an RNA having a cancer treatment effect; (c) as a carrier to carry the modified RNA drug.
CN202011222747.3A 2020-11-05 2020-11-05 Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof Pending CN114525295A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011222747.3A CN114525295A (en) 2020-11-05 2020-11-05 Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011222747.3A CN114525295A (en) 2020-11-05 2020-11-05 Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof

Publications (1)

Publication Number Publication Date
CN114525295A true CN114525295A (en) 2022-05-24

Family

ID=81619480

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011222747.3A Pending CN114525295A (en) 2020-11-05 2020-11-05 Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof

Country Status (1)

Country Link
CN (1) CN114525295A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229338A1 (en) * 1999-10-04 2004-11-18 Vion Pharmaceuticals, Inc. Compositions and methods for tumor-targeted delivery of effector molecules
US20090220459A1 (en) * 2008-01-29 2009-09-03 Aeterna Zentaris Gmbh Non-pathogenic and/or attenuated bacteria capable of inducing apoptosis in macrophages, process of manufacturing and uses thereof
CN104471057A (en) * 2012-05-04 2015-03-25 香港大学 Modified bacteria and uses thereof for treatment of cancer or tumor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229338A1 (en) * 1999-10-04 2004-11-18 Vion Pharmaceuticals, Inc. Compositions and methods for tumor-targeted delivery of effector molecules
US20090220459A1 (en) * 2008-01-29 2009-09-03 Aeterna Zentaris Gmbh Non-pathogenic and/or attenuated bacteria capable of inducing apoptosis in macrophages, process of manufacturing and uses thereof
CN101965395A (en) * 2008-01-29 2011-02-02 阿特纳赞塔里斯有限公司 Non-pathogenic and/or attenuated bacteria capable of inducing apoptosis in macrophages, process of manufacturing and uses thereof
CN104471057A (en) * 2012-05-04 2015-03-25 香港大学 Modified bacteria and uses thereof for treatment of cancer or tumor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DANUTA M. GILLNER等: "Lysine biosynthesis in bacteria: a metallodesuccinylase as a potential antimicrobial target", 《J BIOL INORG CHEM》, vol. 18, no. 2, 28 February 2013 (2013-02-28) *

Similar Documents

Publication Publication Date Title
Lambin et al. Colonisation ofClostridiumin the body is restricted to hypoxic and necrotic areas of tumours
Lemmon et al. Anaerobic bacteria as a gene delivery system that is controlled by the tumor microenvironment
Yi et al. Antitumor effect of cytosine deaminase/5‐fluorocytosine suicide gene therapy system mediated by Bifidobacterium infantis on melanoma 1
Yu et al. Explicit hypoxia targeting with tumor suppression by creating an “obligate” anaerobic Salmonella Typhimurium strain
CN102741407B (en) Transformation plasmid
EP2844736A1 (en) Modified bacteria and uses thereof for treatment of cancer or tumor
CN1918298B (en) Pharmaceutical composition and method of treatment of human malignancies with arginine deprivation
US20170233750A1 (en) Heterologous Hosts
CN107574138A (en) One plant of Escherichia coli antineoplastic target engineered strain and its construction method and application
CN102747074B (en) Method of constructing gene transport support
CN114438111B (en) Construction of PP2 strict anaerobic salmonella strain and application thereof in tumor treatment
Jain Use of bacteria as anticancer agents
WO2022094865A1 (en) "autolytic" salmonella strain, preparation method therefor and application thereof in tumor treatment
WO2005054477A1 (en) Method of regulating heterologous protein expression controlled by salicylic derivatives in micro-organisms associated with higher organisms
CN114525295A (en) Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application thereof
CN114456992B (en) Salmonella strain capable of being automatically cracked, preparation method thereof and application thereof in tumor treatment
WO2022094864A1 (en) Method for constructing strictly anaerobic salmonella, constructed strictly anaerobic salmonella and application thereof
CN116240231A (en) Nano enzyme cascade reaction system and preparation method and application thereof
WO2022094867A1 (en) Construction for pp2 obligate anaerobic salmonella strain and application of same in tumor treatment
CN115820645A (en) Method for preparing NK (natural killer) cells capable of silencing NKG2A genes and application of NK cells
CN106632686B (en) anti-IL-4R single-chain antibody and snake venom L-amino acid oxidase fusion protein and application thereof
CN114522184B (en) Cell lysate of engineering bacteria and application thereof in tumor treatment
WO2022094847A1 (en) Cell lysis solution of engineering bacterium and use thereof in tumor therapy
EP4077359A1 (en) Genetically modified clostridium strains and uses thereof
CN110272855B (en) Bacillus CCPM7650 with strong anti-cancer activity and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination