CN114507695B

CN114507695B - Recombinant vector and method for regulating neuron activity

Info

Publication number: CN114507695B
Application number: CN202210147829.9A
Authority: CN
Inventors: 周诚; 阳垚鑫; 邱静萱; 张东航; 欧梦婵
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2022-02-17
Filing date: 2022-02-17
Publication date: 2023-09-19
Anticipated expiration: 2042-02-17
Also published as: CN114507695A

Abstract

The invention belongs to the field of nerve regulation in neuroscience, and particularly relates to a recombinant vector and a method for regulating neuron activity. The recombinant vector of the invention carries NALCN genes and/or THIK-1 genes; the vector also carries a promoter. Transfection into neurons can increase the expression level of NALCN ion channels and/or THIK-1 ion channels on the cortical pyramidal neurons. The ion channel can change the electrophysiological property of the neuron, and realize the neuron activity regulation and control of the anesthetic, so that the ion channel can be used for researching the regulation and control of the central nervous system of the anesthetic, and has good application prospect.

Description

Recombinant vector and method for regulating neuron activity

Technical Field

The invention belongs to the field of nerve regulation in neuroscience, and particularly relates to a recombinant vector and a method for regulating neuron activity.

Background

How general anesthetic drugs exert an anesthetic effect is a fundamental scientific problem. Inhalation anesthetics are widely used in clinical anesthesia, and the beginning of modern anesthesia is derived from the clinical practice of inhalation anesthetics in the middle of the 19 th century. The inhalation anesthetic can produce sedative hypnotic, amnesia, consciousness disappearance, analgesic and other effects under the clinical relevant concentration, and the specific action mechanism of the inhalation anesthetic is not known at present. It is generally thought that inhalation anesthetics exert sedative hypnotic, reversible consciousness-loss effects by inhibiting the cortex-cortex loop and the cortex-thalamus loop, amnestic effects by inhibiting the hippocampus and the lateral amygdala, analgesic effects by acting on the spinal cord, the brain stem A5-7 nugget and the central amygdala. Among them, the most important pharmacological effect of inhalation anesthetics is the loss of reversibility consciousness. Although some important molecular targets for inhalation anesthetics to exert a vanishing effect on consciousness have been identified, the important nerve loops for their role in general are not yet fully understood.

Current techniques for studying the neural loop mainly include: electrostimulation, microdialysis or microinjection, optogenetics and chemogenetics. Neural electrical stimulation is primarily through direct activation or inhibition of specific brain regions to verify whether the brain regions mediate specific behavioral and neurophysiologic functions. Microinjection and microdialysis manipulate neuronal activity around the catheter or near the tip of the probe by infusing drugs or other substances. But neither of the above methods can modulate a particular type of neuron. Optogenetics activates or inhibits specific neurons or neuronucles by selectively expressing light-sensitive proteins. However, prolonged light stimulation heats the tissue, causing neurophysiologic effects unrelated to opsin activation or inhibition. Chemogenetics can selectively activate or inhibit specific neurons of a specific brain region, and its ligands can be administered systemically and can provide long lasting effects for up to several hours. However, the chemogenetic ligand drug clozapine-N-oxide (CNO) is metabolized to the sedative antipsychotic drug clozapine, potentially interfering with experimental results. In addition, both optogenetics and chemogenetics are to change the excitability of neurons by adopting exogenous methods (illumination and medicines), so that the sensitivity of nerve nuclei or nerve loops to inhalation anesthetics is indirectly studied, and therefore, the regulation of target points and nerve nuclei, even nerve loops, of inhalation anesthetics cannot be specifically realized.

Therefore, a new specific regulation technology still needs to be developed at present, so that full-time air control of anesthetic drugs is realized, the sensitivity of different brain regions and nucleus groups to inhalation anesthetic drugs can be specifically regulated and controlled according to specific neuron types, and a new method is provided for research on important targets and nerve loops of anesthetic drugs.

Previous studies by the team of the present invention demonstrated that NALCN (leak sodium channel) ion channels are one of the targets for excitatory regulatory neurons of inhalation anesthetics. Based on the recent findings of Douglas et al, isoflurane could be produced by inhibiting the brain stem plagiosome metacarpal THIK-1-like (TWIK-related halothane-inhibited K) ⁺ ) Background K ⁺ And (3) a channel, activating the RTN zone neuron. Thus, two targets of inhalation anesthetics playing an excitatory role, namely THIK-1 background K, can be screened out ⁺ Channel and NALCN background Na ⁺ A channel.

The research system is constructed by utilizing the relation between the activity of the ion channels and excitatory regulation neurons of the inhalation anesthetic, so that the research on the mechanism of the central nervous system regulated by the inhalation anesthetic (for example, determining the action site of the inhalation anesthetic) is realized. However, the regulation of ion channels in neurons by using the expression genes of the ion channels is a very complex process, and the problems of proper promoter selection and the like are related to different neurons, so that no related report is seen in the mechanism research system of the central nervous system for realizing the regulation of inhalation anesthetics by regulating the activity of the corresponding ion channels in the neurons through the expression genes of the ion channels at present.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a recombinant vector and a method for regulating and controlling the activity of neurons, and aims to provide a specific regulating and controlling system which can be controlled for a long time and can specifically regulate and control the sensitivity of different brain areas and nucleus groups to inhalation anesthetics aiming at specific neuron types, thereby providing a new regulating and controlling technology for researching important targets and nerve loops of inhalation anesthetics.

A recombinant vector for modulating neuronal activity, said recombinant vector carrying a NALCN gene and/or a THIK-1 gene; the recombinant vector also carries a promoter, wherein the promoter is at least one selected from CaMKII, mDlx, hSyn, SST, chAT, NSE, mecp, hGFAP, c-fos, gfaABC1D or EF1 a.

Preferably, the recombinant vector is labeled with a fluorescent protein.

Preferably, the recombinant vector is a lentivirus, adenovirus, adeno-associated virus or plasmid.

Preferably, the recombinant vector is pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) or AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry after construction;

the pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) is characterized in that a CaMKII promoter, EGFP and P2A are respectively inserted behind a lentivirus CMV-promter, a 5' LTR sequence and a central polypurine sequence, a mNACN sequence is inserted behind P2A, and a PA sequence is reversely inserted behind the mNACN sequence;

the AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry is characterized in that a CaMKII promoter, a Kcnk13 mRNA sequence, 3 repeated Flag sequences, a P2A sequence, an mCHerry fluorescent protein sequence and a PUC ori sequence are sequentially inserted after an AAV2 ITR sequence.

The invention also provides a method for regulating and controlling the activity of neurons, which is to transfect the recombinant vector on the neurons in vivo or ex vivo, so as to improve the expression level of NALCN ion channels and/or THIK-1 ion channels on the transfected neurons.

The vector modulates the activity of neurons, including but not limited to modulating Na on neurons ⁺ Conductivity, K ⁺ Electrical conductance.

The NALCN ion channels are often present in the form of channel complexes under bulk conditions, including NALCN channels, UNC79, UNC80, FAM155A, and the like. Thus, the vector modulates the activity of neurons, including modulating the activity of the NALCN ion channel complex; the invention also provides an animal model which is prepared by transfecting the vector into neurons which are originally sensitive to narcotics of animals in vivo.

Preferably, the method of transfecting the vector into neurons of an animal is injection.

Preferably, the neuron is a neuron that is otherwise sensitive to an anesthetic selected from the group consisting of cortical pyramidal neurons and hippocampal pyramidal neurons.

The invention also provides the application of the recombinant vector or the animal model in the research of the mechanism of the anesthetics regulation central nervous system.

Preferably, the anesthetic is an inhalation anesthetic.

Inhalation anesthetics can modulate the activity of NALCN ion channels and THIK-1 ion channels, thereby increasing neuronal excitability, including modulation of NALCN ion channels and THIK-1 ion channels themselves, as well as modulation of targets upstream or downstream of the channels, such as NK1 receptors, G protein-coupled receptors, calmodulin receptors, and the like. Therefore, the animal model can be used for the research of the mechanism of the central nervous system regulated by inhalation anesthetics. For example, when it is desired to study the effect of inhalation anesthetics on controlling different brain regions or nuggets, different animal models can be made by transfecting the recombinant vector of the present invention onto neurons of different brain regions or nuggets, and then studying how these animal models are affected by inhalation anesthetics.

The invention establishes a brand-new method for regulating and controlling the activity of neurons and the sensitivity of inhalation anesthetic, namely, NALCN ion channels and THIK-1 ion channels are expressed in nuclear group neurons, such as cortical cone neurons, hippocampal cone neurons and the like, which are originally sensitive to the inhalation anesthetic, so that the sensitivity of the neurons which are originally sensitive to the inhalation anesthetic is reduced, even can not be anesthetized, thereby constructing a nerve regulating and controlling system based on the inhalation anesthetic. The neuron regulation mode does not change the excitability of the expressed neuron, is based on the pharmacological action of the inhalation anesthetic, and uses the inhalation anesthetic as a specific regulation medicine to study the sensitivity of different brain areas or nerve nuclei to the inhalation anesthetic, thereby being beneficial to researching the mechanism of reversible consciousness disappearance of the inhalation anesthetic, further determining the action site of the anesthetic and providing a new theoretical basis and a new technical basis for researching the action mechanism of the general anesthetic.

The invention provides a new theoretical basis and a new technical basis for the research of the action mechanism of the general anesthetic, and has good application prospect.

It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

Drawings

Fig. 1: the principle schematic diagram of the recombinant vector of the invention for researching the action mechanism of inhalation anesthetic;

fig. 2: detection of NALCN ion channel expression levels in different tissues (prefrontal cortex, hippocampus, brain stem plagious metacarpus). RTN: the posterior nucleus of the brainstem plagiostroma; cortex: forehead cortex; hippocampus: hippocampus is provided. * P < 0.001 compared to RTN.

Fig. 3: detection of THIK-1 ion channel expression in different tissues (prefrontal cortex, hippocampus, brain stem plagiocarpus metacarpus). RTN: the posterior nucleus of the brainstem plagiostroma; cortex: forehead cortex; hippocampus: hippocampus is provided. n.s.: there was no statistical difference.

Fig. 4: electrophysiological recordings of sensitivity detection of prefrontal cortex pyramidal neurons to inhalation anesthetics. A: a legend for action potentials induced under asynchronous step currents; b: the number of action potentials at different currents; c: comparing the change in resting membrane potential of the prefrontal cortex neurons under baseline conditions and isoflurane anesthesia; d: under different conditions, a base current which induces the neurons to have action potentials; e: under different conditions, neurons exhibit threshold potentials for action potentials. MAC: alveolar minimum effective concentration; ISO: isoflurane; RMP: resting membrane potential; AP: action potential; * P < 0.05 compared with ISO; * P < 0.01 compared to ISO.

Fig. 5: sensitivity detection of the brain stem plagiosome metacarpal core Phox2b neurons to inhalation anesthetics. A: a legend for the firing frequency of RTN region Phox2b neurons; b: a change in the frequency of neuronal firing under isoflurane anesthesia compared to baseline; c: changes in neuronal resting membrane potential under isoflurane anesthesia compared to baseline; MAC: alveolar minimum effective concentration; ISO: isoflurane; RMP: resting membrane potential; * P < 0.01 compared to ISO.

Fig. 6: electrophysiological recording inhalation anesthetics against different tissue (prefrontal cortex and brainstem plagiosome metacarpus) background K ⁺ A change in the channel current-voltage curve. A: after administration of isoflurane as an inhalation anesthetic, prefrontal cortex neuronal background K ⁺ Channel current-electricityVariation of the pressure curve; b: RTN zone neuron background K following administration of inhalation anesthetic isoflurane ⁺ Variation of the channel current-voltage curve; mPFC: forehead cortex; RTN: the brainstem is oblique to the posterior nucleus. Isoflurane-sensitive current: i.e. isoflurane sensitive current, is I _isoflurane -I _control 。

Fig. 7: electrophysiological techniques record changes in current and conductance of the inhalation anesthetic to the brain stem plagiostroma metacarpal nucleus Phox2b neuron NALCN. A: under different conditions (isoflurane and substance P), the clamp current of the NALCN ion channel; b: under different conditions (isoflurane and substance P), the conductance of the NALCN ion channel; c: changes in the NALCN ion channel current-voltage curve before and after isoflurane administration. * P is less than 0.05; * P < 0.01, P < 0.001, P < 0.0001.

Fig. 8: THIK-1 over-expressed virus (AAV 2/9-CaMKII-Kcnk13-3 xFlag-P2A-mCherry) fluorescence (virus carries red fluorescent protein) in cortical neurons after frontal cortex injection.

Fig. 9: NALCN overexpressing viral vector (pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR)) fluorescence (viral carrying green fluorescent protein) in cortical neurons was detected after frontal cortex injection.

Fig. 10: changes in neuronal resting membrane potential were recorded electrophysiologically after the anterior cortex pyramidal neurons overexpressed the THIK-1 ion channel. RMP: resting membrane potential. * P < 0.0001.

Fig. 11: changes in sensitivity of neuronal neurons to inhalation anesthetics were recorded electrophysiologically after the anterior cortex pyramidal neurons overexpressed the THIK-1 ion channel. A: changes in neuronal resting membrane potential before and after administration of isoflurane; b: changes in the NALCN ion channel current-voltage curve before and after isoflurane administration; c: schematic of neuronal membrane potential changes following isoflurane administration. MAC: alveolar minimum effective concentration; RMP: resting membrane potential. * P < 0.001, P < 0.0001.

Fig. 12: electrophysiologically recording changes in neuronal resting membrane potential after the anterior cortex pyramidal neurons overexpress the NALCN ion channels. RMP: resting membrane potential. * P < 0.001.

Fig. 13: electrophysiologically recording changes in sensitivity of the neuronal neurons to inhalation anesthetics after the anterior cortex pyramidal neurons overexpress the NALCN ion channels. A: changes in neuronal resting membrane potential before and after administration of isoflurane; b: changes in the NALCN ion channel current-voltage curve before and after isoflurane administration. MAC: alveolar minimum effective concentration; RMP: resting membrane potential. * P < 0.01.

Fig. 14: electrophysiologically recording changes in neuronal resting membrane potential after simultaneous overexpression of the THIK-1 ion channel and the NALCN ion channel by the anterior cortex pyramidal neurons; RMP: resting membrane potential. * P < 0.01.

Fig. 15: electrophysiological recordings of changes in neuronal resting membrane potential under inhalation anesthetics after simultaneous overexpression of the THIK-1 ion channel and the NALCN ion channel by the anterior cortex pyramidal neurons. RMP: resting membrane potential. * P < 0.0001.

Fig. 16: changes in the orthotopic MAC values following the overexpression of the THIK-1 ion channel by the pyramidal neurons of the prefrontal cortex, mice inhale anesthetics. Lor: the specular reflection disappears; * P < 0.01.

Fig. 17: changes in the orthotopic MAC values following inhalation of anesthetics by mice after overexpression of NALCN ion channels by the anterior cortex pyramidal neurons. Lor: the specular reflection disappears; * P is less than 0.05.

Fig. 18: changes in orthotopic MAC values following simultaneous overexpression of THIK-1 and NALCN ion channels by the anterior cortex pyramidal neurons, mice inhale anesthetics. Lor: the specular reflection disappears; * P < 0.0001.

Detailed Description

In the examples below, all starting materials and reagents are commercially available or may be prepared as described in the prior art.

EXAMPLE 1 design, synthesis, screening of the THIK-1 Gene sequence the plasmid of interest and adeno-associated Virus packaging and titre detection

mRNA information (NM-146037.2) of the mouse THIK-1 (KCNK 13) Gene was queried by means of Gene Bank database and used as over-expression sequence (SEQ NO. 1).

The overexpressed gene was synthesized and introduced into a plasmid. In the plasmid containing the target gene, the target gene is fished by adopting a PCR method, the target vector is subjected to enzyme digestion, and the enzyme digestion products are subjected to electrophoresis recovery and then are exchanged, so that the products are transformed into bacterial competent cells. And (3) firstly carrying out colony PCR identification on the grown clone, and then sequencing and comparing and analyzing the clone positive to the PCR, wherein the comparison is correct, namely the objective plasmid which is successfully constructed. And then packaging by adopting adeno-associated virus as a vector, and detecting the virus titer.

EXAMPLE 2 NALCN Gene sequence design, synthesis, screening of plasmid of interest and adeno-associated Virus packaging and titre detection

mRNA information of the mouse NALCN Gene (NM-177393.4) was queried by means of the Gene Bank database and used as over-expressed sequence (SEQ NO. 2).

The overexpressed gene was synthesized and introduced into a plasmid. In the plasmid containing the target gene, the target gene is fished by adopting a PCR method, the target vector is subjected to enzyme digestion, and the enzyme digestion products are subjected to electrophoresis recovery and then are exchanged, so that the products are transformed into bacterial competent cells. And (3) firstly carrying out colony PCR identification on the grown clone, and then sequencing and comparing and analyzing the clone positive to the PCR, wherein the comparison is correct, namely the objective plasmid which is successfully constructed. Then, the lentivirus is used as a vector for packaging, and the titer of the lentivirus is detected.

EXAMPLE 3 recombinant vectors for modulating neuronal Activity

A viral vector for infecting in vivo or ex vivo primary neurons and carrying a gene of a channel of interest, the vector comprising a promoter, a gene of interest, a fluorescent protein marker. Wherein the promoter is CaMKII, so that the virus vector can only specifically express on vGLUT excitatory neurons; the vector can be selected from lentivirus, adenovirus adeno-associated virus, plasmid, etc.

The present example provides two vectors for modulating neuronal activity, the constructed viral vectors are:

pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) and AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry. Both were used to overexpress the NALCN ion channel and THIK-1 ion channel, respectively. Wherein pLenti represents a lentiviral vector; AAV2/9 is adeno-associated virus 2/9 as a vector; caMKII is calcium/calmodulin dependent protein kinase II, and can be used as a specific promoter of excitatory neurons; EGFP represents an enhanced green fluorescent protein, and mCherry represents a red fluorescent protein; mNALCN represents an over-expressed NALCN mRNA sequence, kcnk13 is an over-expressed THIK-1mRNA sequence; pA is a transcriptional tailing signal, used to terminate transcription; P2A is a short peptide sequence that will automatically jump off when the ribosome translates to it, continuing to translate the downstream reading frame.

Wherein, the CaMKII Gene sequence is NM_001286809 by inquiring the Gene Bank Gene library; the GFP fluorescent protein gene is numbered XM_015895652 in the gene library; the mCherry fluorescent protein gene is numbered XM_035803007 in the gene bank.

Wherein, the CaMKII Gene sequence is NM_001286809 by inquiring the Gene Bank Gene library; the EGFP fluorescent protein gene is numbered XM_015895652 in a gene library; the mCherry fluorescent protein gene is numbered XM_035803007 in the gene bank. The sequence of the 3xFlag tag protein is GATTACAAGGATGACGACGATAAGGGAGATTACAAGGATGACGACGATAAGATCGATTACAAGGATGACGACGATAAG (SEQ NO. 3); PA is PolyA, and has two sequences of AATAAA and ATTAAA. The gene sequence of P2A is: GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTATG (SEQ NO. 4).

The pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) is characterized in that a CaMKII promoter, EGFP and P2A are respectively inserted behind a lentivirus CMV-promoter, a 5' LTR sequence and a central polypurine sequence, a mNACN sequence is inserted behind P2A, and a PA sequence is reversely inserted behind the mNACN sequence;

AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry is a sequence in which the CaMKII promoter, kcnk13 mRNA sequence, 3 Flag sequences repeated, P2A sequence, mCHerry fluorescent protein sequence and PUC ori sequence are inserted sequentially after the AAV2 ITR sequence

EXAMPLE 4 preparation of recombinant AAV (adeno-associated Virus) vectors and recombinant pLenti (lentiviral) vectors

The preparation method of the vector pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) and AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry is as follows:

1) Linearizing CaMKII, EGFP, P2A, PA vector or CaMKII, mCherry, P A vector by Esp 3I cleavage: 10. Mu.g of CaMKII, EGFP, P2A, PA vector or CaMKII, mCherry, P A vector, 5. Mu.L of Esp 3I endonuclease and 10. Mu.L of 2 XBuffer Tango were taken, added with double distilled water to 100. Mu.L, mixed uniformly, reacted at 37℃for 1 hour, then subjected to agarose electrophoresis, and the linear vector fragment was recovered using AgaroseGel DNAPurification Kit Ver2.0 and diluted to a concentration of 50 ng/. Mu.L.

2) mu.L of linearized CaMKII, EGFP, P2A, PA vector or CaMKII, mCherry, P2A vector, 1. Mu.LshRNA template (100 nM), 1. Mu.LT 4DNA ligase (5 weiss. Mu.M/. Mu.L), 2. Mu.L of 10 XT 4 ligation buffer and 15. Mu.L of double distilled water were mixed and reacted at 22℃for 1h to form ligation products. 10. Mu.L of the ligation product was used to transform competent cells of E.coli Top10, and the cells were then spread evenly on LB medium plates containing Ampicillin (50. Mu.g/ml), and the medium plates were inverted into an incubator and cultured at 37℃for 16 hours. 5 colonies were picked on each plate and inoculated into LB medium containing Ampicillin (50. Mu.g/ml), and cultured at 37℃for 16 hours. Then, the plasmid is extracted by adopting an alkaline lysis method, and the obtained plasmid is subjected to single enzyme digestion identification by using SmaI, and simultaneously the recombinant plasmid is prepared after sequencing identification.

3) The recombinant plasmid prepared above was transfected into either Plenti-293 (providing the trans-acting factors required for lentiviral replication and packaging) or AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging), and the culture dish was gently shaken to mix the complexes. At 37℃under 5% CO ₂ Overnight in a saturated humidity incubator. 24h after transfection, 10% serum in DMEM medium (10 ml) was replaced at 37℃with 5% CO ₂ Culturing in a saturated humidity incubator, collecting and concentrating culture solution supernatant after 48h transfection, and adding 10ml of fresh culture solution for continuous culture; after 72 hours of transfection, the culture supernatant was collected again and concentrated to obtain virus particles containing the object.

4) Purifying the virus supernatant. The majority of cellular proteins and residual CsCl ions were removed by two CsCl density gradient centrifuges and 1 ultrafiltration.

5) Titers of pLenti virus or AAV virus particles (pLenti-CaMKII-EGFP-P2A-mNACN-pA (LTR) and AAV2/9-CaMKII-Kcnk13-3 xFlag-P2A-mCherry) containing the target NALCN or THIK-1 gene sequence were measured by a quantitative PCR method.

The two virus particles can be used for infecting neurons in vitro or in vivo, and achieve the purpose of over-expressing NALCN gene and THIK-1 gene.

Example 5 application of anesthetic-based neurological modulation methods in anesthetic research

This example uses the two viral vectors provided in example 4 to study the mechanism of action of inhalation anesthetics.

The experimental scheme of this embodiment mainly includes the following aspects: (1) PCR technology measures the expression levels of NALCN ion channel and THIK-1 ion channel in different tissues (cortex, hippocampus, brain stem plagiostroma metacarpal); (2) Recording the change of excitability of different tissues (cortical cone neurons and RTN zone neurons) by adopting an electrophysiological patch clamp technology under the action of inhalation anesthetic; further record inhalation anesthetic versus cortical neurons and RTN neuron background K ⁺ Channel and NALCN channel function. (3) Constructing a NALCN over-expression viral vector carrying a green fluorescent protein and a THIK-1 over-expression viral vector carrying a red fluorescent protein (i.e., the two viral vectors provided in example 1); (4) THIK-1 and NALCN over-expression virus vectors are successfully expressed in-vivo cortical cone neurons or primary cultured cortical neurons; (5) Recording the change of neuronal excitability after overexpression by electrophysiological patch clamp technology; (6) Recording the change of the sensitivity of the neurons to the inhalation anesthetic after over-expression by administering the inhalation anesthetic in an ex-vivo brain slice and adopting an electrophysiology patch clamp technology; (7) The changes in the inhalation anesthetic anti-specular MAC values of mice were recorded by in vivo transfection of an overexpressing viral vector in the cortex to regulate the activity of cortical neurons. The schematic diagram of the experiment is shown in figure 1. The specific implementation operation is as follows:

(1) The prefrontal cortex, hippocampus and brainstem plagiosome metacarpal nuclei in brain tissue of adult C57 mice are taken out respectively, and the expression levels of NALCN ion channel and THIK-1 ion channel in different tissues are determined by adopting a quantitative immediate polymerase chain technique (qRT-PCR).

The specific method comprises the following steps:

c57 mice were anesthetized with isoflurane, the chest was prepared to the skin, the chest was opened, left ventricular cannula was cut, the right atrial appendage was cut, normal saline was continuously infused, and infusion was stopped after the liver color was whitened. Rapidly breaking the head on ice, shearing off the skull, rapidly taking down the whole brain tissue, and immediately quick-freezing with liquid nitrogen at-80 ℃. And then taking out the bilateral hippocampal tissues and the prefrontal cortex, rapidly scraping brain tissues of the bilateral RTN region under a microscope, respectively placing the brain tissues in a freezing tube, and preserving the brain tissues at the temperature of minus 80 ℃ after marking and freezing in liquid nitrogen. The expression levels of NALCN and THIK-1 ion channels in tissues of different parts are compared by adopting qRT-PCR technology.

NALCN primer sequence:

NALCN forward：5’-GTCCTGACGAATCTCTGTCAGA-3’(SEQ NO.5),

NALCN reverse：5’-CTGAGATGACGCTGATGATGG-3’(SEQ NO.6)，

THIK-1 primer sequence:

THIK-1forward：5’-GTGGTTTCTACCATAGGGTTTGGG-3’(SEQ NO.7),

THIK-1reverse：5’-GTAGACCGAGTCATTGTAGCTCCA-3’(SEQ NO.8),

control sequence:

GAPDH forward：5’-GACATGCCGCCTGGAGAAAC-3’(SEQ NO.9)，

GAPDH reverse：5’-AGCCCAGGATGCCCTTTAGT-3’(SEQ NO.10)。

as shown in fig. 2, the level of THIK-1 ion channels on the brain stem plagiosome metacarpal neurons was significantly higher than that of the prefrontal cortex pyramidal neurons and hippocampal pyramidal neurons. As shown in fig. 3, NALCN ion channel levels on the brainstem plagiosome metacarpal neurons were significantly lower than those of the prefrontal cortex pyramidal neurons and hippocampal pyramidal neurons. The results show that there is a significant difference in the expression levels of NALCN ion channel and THIK-1 ion channel in different levels of mouse brain tissue.

(2) Different tissues (cortical pyramidal neurons and RTN zone neurons) were recorded using electrophysiological patch clamp techniques, and the change in neuronal excitability was observed under the action of inhalation anesthetics.

The specific method comprises the following steps:

1) Preparation of ex vivo brain tablets: the mice are anesthetized by isoflurane, and after the mice are turned over and the tail clamping reflection disappears, the mice are rapidly broken, the skull is carefully sheared off along the two sides of the skull by using spring scissors, the whole brain tissue is exposed, and the brain or brain stem tissue is reserved according to the requirement. Rapidly placing the extracted brain tissue into precooled slicing solution, and continuously introducing 95% O into the slicing solution ₂ /5％CO ₂ And (3) mixing the gases. Carefully lifting the tail of brain stem tissue with forceps, placing in a slicing groove of an oscillating slicer with 502 glue, covering brain tissue with 1.5% agar solution, fixing, and pouring slicing solution (260 cross, 3KCl,5 MgCl) ₂ ，1CaCl ₂ ，1.25NaH ₂ PO ₄ ，26NaHCO ₃ 10glucose,1ka, ph=7.4) and filled with 95% o ₂ /5％CO ₂ The mixed gas is sliced by using an oscillation slicer to conduct sagittal plane slicing of brain tissue, and the slicing thickness is set to be 300 mu m. After slicing, the brain slice is placed in a buffer containing aCSF (130 NaCl,3KCl,2 MgCl) ₂ ，2CaCl ₂ ，1.25NaH ₂ PO ₄ ，26NaHCO ₃ 10 Glucose) and continuous passage of 95% O ₂ /5％CO ₂ The mixed gas is placed in a water bath box at 37 ℃ for half an hour, and then the mixed gas is transferred to room temperature for half an hour for use.

2) Cell attachment recording: the incubated brain pieces were transferred to perfusion cells and the aCSF (95% O was introduced) was continuously perfused at room temperature ₂ /5％CO ₂ ) The speed was 2ml/min, and the mixture was fixed by placing a metal gauze on the surface of the brain slice. Glass microelectrode prefilled electrode inner liquid (120 KMeSO) ₄ ，4NaCl，1MgCl ₂ ，0.5CaCl ₂ 10HEPES,10EGTA,3ATP-Mg,0.3GTP-Na, units: mM, ph=7.2) and fixed on an electrode holder. After proper positive pressure is given, liquid is added, a glass electrode (5-6 MΩ) is placed on the surface of a neuron under a 40-fold microscope water mirror, clamping voltage is kept at-60 mV (10 mV liquid connection potential is adjusted), and proper negative pressure is given to achieve high-resistance sealing. After the electrode resistance compensation is completed, the spontaneous discharge of the cells starts to be recorded. Following baseline recordings of spontaneous discharges, inhalation anesthetics were administered and changes in neuronal discharge frequency were recorded.

3) Whole cell recording: after forming high-resistance seal, continue to giveThe neurons are appropriately pressurized to break the cell membrane, forming a whole cell recording pattern. Pre-charged electrode inner liquid in microelectrode (120 KMeSO) ₄ ，4NaCl，1MgCl ₂ ，0.5CaCl ₂ 10HEPES,10EGTA,3ATP-Mg,0.3GTP-Na, units: mM, ph=7.2), has a resistance of 5 to 6mΩ, and records neuronal excitability indices such as resting membrane potential, evoked action potential, basal current, threshold potential, and the like of neurons before and after administration of inhalation anesthetic in a current clamp whole cell recording mode.

As shown in fig. 4C, D, after administration of the inhalation anesthetic isoflurane to the anterior cortex pyramidal neurons, the resting membrane potential of the neurons increased significantly, inducing an increase in the basal current of the action potential, indicating a decrease in the excitability of the neurons. Figure 4 illustrates that the inhalation anesthetic isoflurane exhibited significant inhibition of the anterior cortex pyramidal neurons. As shown in FIG. 5, after administration of the inhalation anesthetic isoflurane to neurons in the RTN region, the spontaneous firing frequency of neurons increased significantly and the resting membrane potential decreased significantly, indicating increased excitability of neurons. Thus, isoflurane exhibits a differential modulation pattern for prefrontal cortex neurons and RTN zone neurons.

(3) Electrophysiological recording inhalation anesthetics against different tissue (prefrontal cortex and brainstem plagiosome metacarpus) background K ⁺ A change in channel current.

In whole-cell voltage clamp recording mode, electrode inner liquid (120 KMeSO) ₄ ，4NaCl，1MgCl ₂ ，0.5CaCl ₂ 10HEPES,10EGTA,3ATP-Mg,0.3GTP-Na, units: mM, ph=7.2) and isoflurane was administered in the perfusate, and cortical neuronal background K was recorded ⁺ Ion channel conductance and current variation.

As shown in FIG. 6, background K recorded in the prefrontal cortex ⁺ The current appears as a rectified potassium current, while the background K recorded in RTN area ⁺ The current appears as a potassium leakage current. Further, after administration of isoflurane, at the same voltage, the prefrontal cortex K ⁺ The current is obviously increased and is expressed as activation; while RTN region K ⁺ The current was significantly reduced and exhibited inhibition. The above results indicate that K expressed at different sites ⁺ Channels are inconsistent and sensitivity to isoflurane varies.

(4) Electrophysiological techniques record the effect of inhalation anesthetics on NALCN ion channels.

In whole-cell voltage clamp recording mode, the electrode is pre-charged with electrode inner liquid (104 CsCH ₃ SO ₃ ,1MgCl ₂ ,0.5CaCl ₂ 30TEA-Cl,10EGTA,3Mg-ATP,0.3GTP-Tris,10HEPES, units: mM, pH 7.2) and isoflurane was administered in the perfusate, and changes in RTN zone Phox2b neuronal NALCN ion channel conductance, clamp current and current-voltage curves were recorded.

As shown in fig. 7a, b, both the clamp current and conductance of the RTN zone neurons increased significantly after administration of inhalation anesthetics, further demonstrating that the channel is a NALCN ion channel by SP (an agonist of the NALCN ion channel); as shown in fig. 7C, following isoflurane administration, the current of neurons at the same voltage increased significantly, manifesting as isoflurane activation. The above results indicate that inhalation of the anesthetic isoflurane activates the NALCN ion channel.

(5) Constructing NALCN over-expression virus vector carrying green fluorescent protein and THIK-1 over-expression virus vector carrying red fluorescent protein, and expressing the NALCN over-expression virus vector and the THIK-1 over-expression virus vector respectively in forehead leaf cortex, and observing virus infection effect under a fluorescent microscope after 3-4 weeks.

The specific method comprises the following steps:

1) Viral vectors (pLenti-CaMKII-EGFP-P2A-mNALCN-pA (LTR) or titer 2X 10) carrying green fluorescent protein and NALCN gene ⁸ TU/ml) and viral vectors carrying the red fluorescent protein and THIK-1 gene (AAV 2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry, titre 2X 10) ¹³ /ml) was injected into the prefrontal cortex of adult C57 mice by stereotactic injection.

2) The virus aspirated using a glass electrode (with an inner diameter of about 25 μm) was tightly connected to a microinjector with silicone grease and placed in a syringe of a brain stereotactic apparatus. The mice were anesthetized with isoflurane, and after the specular reflection and tail-clamping reflection disappeared, the head hair was shaved off and fixed on a brain stereotactic apparatus in prone position. After disinfection, the median opening cuts the scalp of the mice and extends posteriorly exposing the medulla oblongata. The forehead cortex positioning coordinates are: anterior bregma 1.5mm, midline bypass + -0.8 mm, and needle depth 1.0mm. After the positioning is accurate, the skull is drilled, a glass electrode is pushed by using a pusher to reach the injection depth, then the needle is stopped for 2min, 200nl (200 nl/min) is injected, the needle is left for 10min after the injection is finished for waiting for virus diffusion, reverse osmosis of the virus along with a needle track is avoided, and then the needle is slowly withdrawn (1 mm/min). Then, contralateral virus injection was performed. After double-sided injection, the scalp was sterilized with iodophor, and the scalp was sutured and intraperitoneally injected with ampicillin (100 mg/kg), atepamezole (2 mg/kg) and ketoprofen (4 mg/kg) to prevent infection.

3) After 3-4 weeks of virus expression, mice were anesthetized with isoflurane, after the eversion and tail-clamping reflex of the mice disappeared, the chest was opened rapidly to expose the heart, the right auricle was cut after inserting a 22G needle through the apex, saline containing 25U/ml heparin and 4% paraformaldehyde (2 ml/min) were sequentially infused with peristaltic pump, after the mice were shaky with the tails, muscle twitches, and liver whitened, the brain tissue was rapidly broken, and was removed and placed in an EP tube containing 4% paraformaldehyde overnight at 4 ℃. Then put into PBS solution containing 30% sucrose for 48 hours, and carry out sugar precipitation and dehydration. And trimming the fixed brain tissue, embedding the brain tissue by using an OCT embedding agent, placing the brain tissue on a base of a slicing machine, and placing the brain tissue into a lycra frozen slicing machine for slicing. The slice thickness was 40. Mu.m. The obtained brain slice is placed on an adhesion glass slide, and after sealing, the expression and the range of fluorescence of NALCN virus and THIK-1 virus are observed under a fluorescence microscope.

As shown in FIG. 8, alexaFluor 647 fluorescence was observed under a fluorescence microscope, indicating that AAV-Kcnk13-mCheery prefrontal cortex injection was effective in infecting prefrontal cortex neurons. As shown in fig. 9, alexaFluor 488 fluorescence was observed under a fluorescence microscope, indicating that AAV-NALCN-EGFP frontal cortex injection can effectively infect frontal cortex neurons.

(6) Patch clamp electrophysiology techniques record changes in cortical neuron excitability that overexpress NALCN ion channels and/or THIK-1 ion channels:

in the whole-cell voltage clamp recording mode, the resting membrane potential of the neuron is recorded, and the change of the excitability of the neuron after the NALCN ion channel or/and the THIK-1 ion channel are expressed respectively or together is judged.

As shown in fig. 10, the resting membrane potential of the cortical cone neurons was significantly reduced after overexpression of the THIK-1 ion channel compared to the control group, showing a hyperpolarized state. As shown in fig. 12, the resting membrane potential of cortical pyramidal neurons was significantly increased, exhibiting depolarization, after overexpression of NALCN ion channels, compared to the control group; FIG. 14 shows that there is no significant change in resting membrane potential of cortical pyramidal neurons after coexpression of NALCN ion channel and THIK-1 ion channel compared to control.

Fig. 10, 12 and 14 show that overexpression of THIK-1 or NALCN ion channels in the pyramidal neurons of the prefrontal cortex significantly alters neuronal excitability and in opposite directions. Thus, there was no significant change in resting membrane potential of neurons after simultaneous overexpression of THIK-1 and NALCN ion channels as shown in FIG. 12. The results indicate that coexpression of NALCN and THIK-1 ion channels does not significantly alter the excitability of the neurons themselves. This result demonstrates that the system we constructed does not alter the function of neurons and the nucelal mass itself under in vivo conditions.

(7) Changes in sensitivity of the prefrontal cortex pyramidal neurons to inhalation anesthetics were recorded following overexpression of NALCN ion channels and/or THIK-1 ion channels by administration of inhalation anesthetics in ex vivo brain plates using electrophysiology patch clamp techniques.

1) In whole-cell voltage clamp recording mode, electrode inner liquid (120 KMeSO) ₄ ，4NaCl，1MgCl ₂ ，0.5CaCl ₂ 10HEPES,10EGTA,3ATP-Mg,0.3GTP-Na, units: mM, ph=7.2) and administration of an inhalation anesthetic in the perfusate, changes in resting membrane potential of cortical pyramidal neurons under the action of the inhalation anesthetic were recorded.

2) In whole-cell voltage clamp recording mode, electrode inner liquid (120 KMeSO) ₄ ，4NaCl，1MgCl ₂ ，0.5CaCl ₂ 10HEPES,10EGTA,3ATP-Mg,0.3GTP-Na, units: mM, ph=7.2) or (104 CsCH ₃ SO ₃ ,1MgCl ₂ ,0.5CaCl ₂ 30TEA-Cl,10EGTA,3Mg-ATP,0.3GTP-Tris,10HEPES, units: mM, pH 7.2) and in perfusionInhalation anesthetic was given in the fluid and cortical neuronal background K was recorded ⁺ Ion channel and background Na ⁺ Ion channel conductance and current variation.

As shown in FIG. 11, inhalation of anesthetics against background K after overexpression of THIK-1 ion channel ⁺ The ion channel shows obvious inhibition effect, and the resting membrane potential of the neuron is obviously increased, and the neuron is in a depolarization state, namely, the inhaled anesthetic isoflurane shows activation effect on the overall excitability of the cortical cone neuron. Thus, upon overexpression of the THIK-1 ion channel, the effects of the inhaled anesthetic isoflurane on cortical pyramidal neurons are converted from inhibition to excitation. As shown in fig. 13, after over-expressing the NALCN ion channel, the inhaled anesthetic also showed a significant activation of NALCN, and the resting membrane potential of neurons was significantly increased, which was a depolarized state, i.e., the inhaled anesthetic showed an activation of the overall excitability of cortical pyramidal neurons. Thus, after overexpression of NALCN ion channel, the action of inhalation anesthetic isoflurane on cortical cone neurons is also converted from inhibition to excitation. As shown in fig. 15, after coexpression of NALCN and THIK-1 ion channels, inhaled anesthetic isoflurane still showed significant activation of cortical cone neurons, with a significant increase in resting membrane potential of neurons. Thus, overexpression of THIK-1 and/or NALCN ion channels can convert neurons that are otherwise susceptible to the inhalation anesthetic isoflurane to neurons that are not anesthetized by isoflurane, thereby allowing "non-anesthetized" neurons to be obtained.

(8) The change in MAC value of the disappearance of the eversion and orthostatic reflex caused by inhalation of anesthetics in mice was evaluated by modulating the activity of cortical neurons by transfection of an overexpressing viral vector in the somatic cortex.

The specific method comprises the following steps:

mice were induced and maintained with isoflurane in 2L size sealed drums placed on a thermostated (33-34 ℃) blanket to maintain the body temperature of the mice during anesthesia (anal temperature after mice anesthesia is between 35.9-38.7 ℃). The oxygen flow was 2L/min, isoflurane was volatilized from the volatilizer pot, and the end-tidal carbon dioxide and isoflurane concentrations were monitored. And soda lime particles are placed at the bottom of the induction box, so that the concentration of carbon dioxide is kept below 0.3%. The initial isoflurane concentration was 0.7%, each time 0.05% was added, each concentration was equilibrated for 15 minutes, and then the mice were examined for their eversion and if they did not evert to the supine position within 30 seconds, they were considered to have disappeared, and the anesthetic concentration at that time was recorded.

Results of murine orthostatic reflex referring to fig. 16, 17 and 18, after cortical overexpression of NALCN ion channel and/or THIK-1 ion channel, the MAC value of murine inhalation anesthetic orthostatic reflex was significantly increased, indicating that the sensitivity of mice to inhalation anesthetics was reduced, reflecting that the activity of the mouse neurons was modulated. Based on this, we successfully constructed a nervous system regulatory system for inhalation anesthetics and demonstrated that the prefrontal cortex is one of the targets for inhalation anesthetics to exert sedation.

As can be seen from the above examples, the present invention provides a recombinant vector that can enhance the expression level of NALCN ion channels and/or THIK-1 ion channels in neurons, and activate ion channels based on inhalation anesthetics, thereby achieving modulation of neuronal activity. The carrier and the method can be used for researching the action mechanism of the anesthetic (for example, determining the action site of the inhalation anesthetic), and have good application prospect.

SEQUENCE LISTING

<110> Huaxi Hospital at university of Sichuan

<120> a recombinant vector and method for modulating neuronal activity

<130> GYKH2122-2021P0114540CCR4

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 3060

<212> DNA

<213> mice

<400> 1

gacctatctg ttaagcaacc actccaggga tctgcactcc ctggtagaag catcgctgtt 60

tagaggtcca ggcgagcgcc agcggaggag acctgagcag gagactggcc ctgaggccaa 120

ggggcgggta ccgggtggag tcgcctcggt tggcagctgc agagctccac ctgttgcagt 180

ttttgagcac tccacagaga aggcagctct gggcacggac ttctgctctc agccccactg 240

ggcagggcaa ggccacttga gaagggaagc caggaaccat cctgaacctg ttccacagag 300

cagcggtccg ccctcgtgct gccgtggagc ctgtgtgccc agcagagatc cgagccggct 360

gatctgcctc ttcgcactgt ccctgcgtcc gtgcgtctgc cccaaacccg ttccgacctc 420

tgagccctgg ttattctggt ggatagaggc tctcggcaga acattgtcac taatacgcaa 480

cacagatcca cctggagagg caccgaagac agagaacagc ccgtatccca gccatcacag 540

cttggaaagc aatgctccga ggaacccgga ccttgatgtg aagcttaccc gccgattctc 600

tctggaccca cgaccttttt tttcttcaag aggagttcaa gttctaggga gtttgccttg 660

aaggcacgcc acgccccctc cccaatctga gccgaattag gagctcgggt gaacccgggt 720

cgcccgcacc ctcgcaccaa gtcgaagcag attctgtgtc ccgaccctct ggtcttcagc 780

cttaaggaga actccagaga ggacagggag gcggcgacga caaagcggat tcgaaaccac 840

gagtccaggc ggacgtgggg agctggctac acaggaacca ccgaggaggc ggcggcggcc 900

gggagatcca cgccgccttg gggaacgcgc ggcgggcatg ggcgagcccg cacgcagagc 960

aggctaaggt cggcagagca catcctcccc ggggcgtggg cacaagtccg cgggcagcaa 1020

ccctcgcgga gctgtcctcc agtgccatgg ctggccgcgg ttgcggctgc agccccggcc 1080

acctgaacga ggacaacgcg cgcttcctgc tgctcgctgg gctcatcctg ctctacctgc 1140

tgggcggcgc cgcagtcttc tccgcgctgg agctagcgca ggagttgcag gccaagcagc 1200

gctgggaaga gcgcctggcc aacttcagcc ggggccacaa cctgagccgt gaagagctgc 1260

gaggtttcct ccgccactac gaggaagcca ccagggcggg catccgcatg gacagcgtgc 1320

gccctcgctg ggacttcacg ggcgccttct acttcgtggg tacagtggtt tctaccatag 1380

ggtttgggat gacaacacca gccacaacgg gagggaagat ttttctgatc ttttatggtc 1440

tcattggatg tgcaagtacc atcctcttct tcaacctttt cctggagcgg ctgatcactg 1500

tcatcgcctg tgtcatgaga tcctgtcacc agcagcagct gcgcagacgt ggggcggtga 1560

cccaggacaa catgaaggct cctgaaaagg gggaggcaga cagcctgact ggctggaagc 1620

cctctgtgta ctacgtcatg ctgatcctat gcttggcatc agtggccatc tcctgcggag 1680

cctctgctct gtacaccacc atggagggct ggagctactt tgactcggtc tacttctgtt 1740

ttgtggcttt cagcaccatt ggcttcgggg acctggtgag cagccagaat gctcagtatg 1800

agagccaagg actctaccgc ttcttcaatt tcttcctcat cctcatgggt gtctgctgca 1860

tctactcttt gtttaacgtc atctccatcc tgatcaaaca gactgtgaac tggatcctga 1920

ggaaactgga tagcgggtgc ttcccaccat gccaaagagg actcctgcgg tccaggagga 1980

atgtggtgat gccgggtaac atccggaaca ggtgcaacat ctccatagag acagacgggg 2040

tgatggaaag tgacactgat ggacgacgtc tctcggggga gatgatctcc atgaaggaca 2100

ccaacaaggt ctccctggcc atcctgcaga agcagttgtc cgagatggcc aatgggggac 2160

cccaccagaa cagtgcatcc tcccgggatg atgagttctc agggggagtg ggagcctttg 2220

cagtaatgaa taacaggttg gcagagacca gtggagatag gtaggaacca gaagtagctg 2280

ctatatgaag aaaaccaggg catgtgggga ataagacact gttacaccac tggtaagctc 2340

agctgtgcct ctggctgttg caattaatat ctccagtcca ggttttgaaa tctgaccttg 2400

gcctcaggca agagtagcct ctcacagttg agggctggag cctctttccc tggctcttac 2460

tttacttttg aattccaagt ttgacatttg gaactgctaa gggccttgcc ttcttccaga 2520

gttgtaatgg tctgagggag actggtccag ttttggtttc tccaccatga tccattctta 2580

ggaagggaga gcccccaaaa agcctgcttc tgtcctggaa cgtgagtggc tgaacttcac 2640

ccagcccctc aagaaaaggc aacaaacatt ccagagtgtc tctgggcctt ctgtttgctg 2700

gacttccttc caaacatatc tattgttggt tccattgatg gggacactat ctcatcttct 2760

cttatacctg cttctctgtt tgggagtctt ggtttctttt tgttttgttt cctgtttgac 2820

taatatatct tttggatctt atgtgataag aaaactaaat ccaccttcaa acctttaagc 2880

ttggcagtga gtagaggaag agggaaactc catcttgtaa ctaaagccca cagcttacta 2940

tgtcctctct gaatggttac acggatcgtg tcattttacc agggcttgga gcctggtgca 3000

gaggcaactg actatttatt agagttgaac atttaataaa ttctcatttt gttaactacg 3060

<210> 2

<211> 7115

<212> DNA

<213> mice

<400> 2

gagagaggga agccacctgc aagtacggac cctggcactg gccaccagct gcggcggcgc 60

tgccttgagc atcctccgta gctcgcgcag caaagccaac agcaaaaggc aagcgaataa 120

acgcaaggcc aggactcctg cagctctctc cgtgcccctc gctcgtgcgg cagatgctag 180

tgcagaacca gcacggagct gactgagccg ccataggtga ggggccgcgt ccccacccgc 240

tcaggccggc gcgccccgca cggatcccgc ttgccgccgc cgccgctgca gcctcagcac 300

catgactact ccgcgcgctg cggttacaga ctgtggtttt gtacctgcct cccaaagcta 360

acttcagcat gctcaaaaga aagcagagtt ccagggtgga agcccagcca gttactgact 420

ttggtcctga tgaatctctg tcagacaatg ctgacatact ctggattaat aagccatggg 480

tgcactctct gctgcgcatc tgtgccatca tcagcgtcat ctcagtgtgc atgaacacac 540

ctatgacctt tgagcactat cctcctcttc agtatgtgac cttcaccttg gacactttat 600

tgatgttcct ctacactgca gaaatgatag caaagatgca catacgggga attgtcaagg 660

gtgatagctc ctatgtgaag gatcgctggt gtgtttttga tggattcatg gtcttttgcc 720

tttgggtatc tcttgtgtta caggtgtttg aaatagctga catagttgat cagatgtcac 780

cttggggcat gctgcggatc ccacggccac tcattatgat ccgggctttc aggatttatt 840

tccgattcga actgccaagg acaagaatta caaacatttt aaagcggtca ggagaacaaa 900

tatggagtgt ttccattttc ctccttttct tccttcttct gtatgggatt ttaggagttc 960

aaatgtttgg aacatttacc taccactgtg tagtcaatga cacaaagcca ggaaatgtaa 1020

cctggaatag cttagctatt ccagatacgc actgctcccc agagctagaa gaaggctatc 1080

aatgcccgcc aggatttaaa tgcatggacc tggaagacct gggacttagc aggcaagagc 1140

tgggctacag tggctttaat gagataggca cgagtatatt cacagtctat gaggcttcat 1200

ctcaggaagg ctgggtattc ctcatgtaca gagcaatcga cagctttccc cgctggcgct 1260

cctacttcta cttcatcaca ctgattttct tccttgcttg gcttgtcaag aatgtgttta 1320

ttgctgtcat cattgagaca tttgcagaaa tcagagtaca atttcaacaa atgtggggaa 1380

ctcggagcag cacaacttct acagccacca cacagatgtt ccatgaagat gccgctggtg 1440

gttggcagct ggtagctgtg gatgtcaaca agccccaggg acgtgcccca gcctgcctac 1500

agaaaatgat gcggtcatcg gttttccaca tgtttatcct gagcatggtg actgtggatg 1560

taatagttgc tgccagcaat tactacaagg gagagaactt cagaaggcag tatgatgaat 1620

tctaccttgc agaggtggct tttacagtcc ttttcgacct ggaagcactc ctgaagatat 1680

ggtgtttggg gtttactggc tacatcagct catctctcca caagtttgaa ctattgcttg 1740

ttattgggac gacgcttcat gtgtacccag atctttatca ttctcagttc acatacttcc 1800

aggttctgcg ggtagtccgg cttattaaga tttccccagc attggaagac tttgtgtaca 1860

agatatttgg tcctgggaaa aaacttggaa gcttggtggt gttcactgcc agcctcctga 1920

tagttatgtc agccatcagt ttgcagatgt tctgttttgt cgaagaactg gacagattca 1980

ccacttttcc aagggcattt atgtctatgt tccagatcct cacccaggaa ggatgggtgg 2040

atgtgatgga tcagactctg aatgctgtgg ggcatatgtg ggcaccactg gttgccatct 2100

atttcatcct ctatcatctc tttgcaactt tgatcctcct gagtttgttt gttgctgtta 2160

ttttggacaa cttagaactt gatgaagatc taaagaagct caaacaacta aagcaaagtg 2220

aagcgaacgc ggacaccaaa gaaaaactcc ctttgcgctt gagaatcttc gaaaaatttc 2280

caaacagacc gcaaatggtg aaaatctcaa aacttccttc agattttaca gttcctaaaa 2340

tcagggaaag cttcatgaag cagttcattg accgccagca acaggacacc tgctgtctct 2400

tcagaatcct cccctctacc tcttcctcat catgtgacaa ccccaagaag cccacagctg 2460

aagacaacaa atacattgat caaaaactcc gcaagtctgt tttcagcata agggcgagga 2520

acctactgga aaaggagact gcagtcacaa aaatcttaag agcttgcact cgacagcgca 2580

tgctgagcgg atcattcgag gggcagccag caaaggagag gtcgatcctc agcgtgcagc 2640

atcacatccg ccaggagcgc aggtcactaa gacatggatc caacagccag aggatcagca 2700

gggggaaatc tcttgaaact ttaactcaag accattcaaa tacagtgcgc tacagaaatg 2760

cacaaagaga agacagtgaa ataaaaatga ttcaggagaa gaaggaacaa gccgagatga 2820

aaaggaaggt gcaagaagag gaactgcggg agaaccaccc atactttgac aagcctctct 2880

tcatcgtggg gcgggagcac aggttcagaa acttctgccg cgtggtggtt cgagcacgct 2940

tcaatgcatc caaaacagac cctgtcacgg gagctgtgaa aaatacaaag taccaccaac 3000

tttatgattt gctgggactt gtcacctacc tggactgggt catgatcact gtaaccatct 3060

gctcttgcat ttctatgatg ttcgaatccc ccttccgaag agtcatgcat gcacccactt 3120

tacagatcgc agaatatgtg tttgtaatat tcatgagcat tgagcttaat ctgaagatta 3180

tggcagatgg cttgtttttc actccaactg ctgtcatcag ggactttggt ggcgtcatgg 3240

acatatttat ctatcttgtg agtttgatat ttctttgttg gatgcctcaa aatgtacctg 3300

ccgagtcagg agcccagcta ctgatggttc ttcggtgcct aagacctctt cggatattca 3360

aacttgtgcc ccaaatgagg aaagttgttc gagaactttt cagtggtttc aaggaaatat 3420

ttttggtctc cattctgttg ttgacgttaa tgcttgtttt tgcaagcttt ggggttcagc 3480

tctttgctgg aaagttagcc aagtgcaacg accccaacat tatcagaagg gaagactgta 3540

atggcatctt cagaattaat gtaagtgtgt ccaagaactt aaatttaaaa ctaagacctg 3600

gagagaaaaa acctggattt tgggtgcccc gtgtttgggc aaatcctcgg aactttaact 3660

tcgacaatgt gggaaatgcc atgctggcat tatttgaagt tctgtccttg aaaggctggg 3720

tagaagtgag ggatgtcatt attcatcgtg tggggccgat ccacggaatc tatattcatg 3780

ttttcgtatt cctgggttgc atgatcggac tgacgctttt tgtcggtgta gttattgcta 3840

acttcaatga aaacaagggg acagccctgc tgacggtaga tcagagacga tgggaagatc 3900

tcaagagcag actgaagatc gcacagcctc ttcatctccc tcctcggccg gataatgatg 3960

gttttagagc taaaatgtat gacataaccc agcatccatt ttttaagagg acaattgcat 4020

tgctggttct ggcccagtct gtgttgctat ctgtcaagtg ggatgttgac gatcctgtga 4080

cggttccttt ggcaacaatg tcagttgtct tcaccttcat ctttgtctta gaggttacaa 4140

tgaagattat agcaatgtca ccagctggat tctggcaaag cagaagaaac cgatatgatc 4200

tcttggtgac atctcttggt gttgtgtggg tggtgctcca ttttgctctg ctgaatgcat 4260

acacctacat gatgggagcc tgcgtgattg tctttagatt tttctccatc tgtgggaagc 4320

atgtgacatt aaagatgctc cttctgactg tggttgtcag catgtacaag agctttttta 4380

tcatcgtagg aatgtttctc ttgctgctgt gctatgcctt tgctggagtt gttctgtttg 4440

gtaccgtaaa gtatggtgag aacattaaca ggcatgccaa tttttcctca gctggcaaag 4500

ccattactgt attgtttcga attgtcacag gtgaagactg gaacaagatt atgcatgatt 4560

gtatggttca acctccattt tgtactccag atgaatttac atactgggca acagactgtg 4620

gcaattatgc aggggcactt atgtacttct gctcattcta tgtcatcatt gcctacatca 4680

tgctgaatct gcttgtagcc ataattgtgg agaatttctc tttgttttat tccactgaag 4740

aggaccagct tttgagttac aatgatcttc gccattttca aatcatatgg aacatggtag 4800

atgataaaag agagggtgtg atccccactt tccgagtgaa gttcctgcta cggctgctgc 4860

gtgggaggct ggaagtggat cttgataaag acaagctcct gtttaagcat atgtgctatg 4920

agatggagag gctgcacaat ggtggtgatg tcaccttcca tgatgtctta agcatgctct 4980

cctatcgctc tgtagacatc agaaaaagcc tgcagctaga ggagctgctg gcaagggagc 5040

agctagaata caccatagag gaggaggtgg ctaagcagac tattcgcatg tggctgaaga 5100

agtgcttgaa acgcatccgg gctaaacaac agcagtcgtg cagcatcatc cacagcctga 5160

gagagagcca ggagcaagag cggagccggc tattcctgaa tcctcccagc attgagacca 5220

cccagccaag tgaggacagc aacgccaaca gccaggacca cagtatgcaa cctgagacaa 5280

gcagtcagca gcagctctta agccctactc tgtcagacag aggaggaagc cgacaggatg 5340

cagcagatac tggaaaaccc caaaggaaga ttgggcaatg gcgtctgccc tcagccccca 5400

aaccaataag ccattctgta tcttcggtta acctacggtt tggaggaagg acaacgatga 5460

agactgtggt gtgcaagatg aaccccatgc cagacacagc ttcctgtggc tctgaagtta 5520

aaaagtggtg gaccagacag ctgaccgtgg agagtgacga gagtggagat gacctcctgg 5580

atatttagat gggaagcaag gcatagggag tcctagggtg aaaactatag ctaatagttt 5640

ctttcatcat tgggagagag caaactgtaa ttgctaaacc ctaaattcca cccaagcatg 5700

ggtttttcag aattgatttt tgttcatttg ttggaatggt ctctcagagt atgttttgga 5760

ttattgtcat gtattaaaaa aatgtggggc ttgggagata agtcagtgaa agacctcttg 5820

ctcaacctgt gccaacccct atgtttgaat cccagaaata caaggaaaga aagaaaatat 5880

gtataaagca gtattgataa tattagaagc tgcatcaaca gtagagtata ttatatattc 5940

atgtattctg tctgtgtaaa ctaagctgta ttcatctgca ctctcatatg ttattactac 6000

ccctctcaaa gagtgctgag cccaaactgg tccatattta tagtacagga gttatagcta 6060

tagttcactt ttttccccat ttccaataga aatacttccc ttgggagaaa ttatttatga 6120

ttgatctgaa aaggtcagta ctgtgcttgt gctaaaatga tagcagcttc aaaactatag 6180

attctgaagt ttttaaaagc atattctttt tctttgtgtt atttttttaa aaaatgctta 6240

atgttaaaaa aaatcaggcc cgttttattt ctgttttcaa gtactccaat aaaattgttg 6300

cctgcttctg agaaagttat gtgtgtaggt accatgtaaa ggatttggct acagatgtat 6360

tggtatataa catacttgta ggtgtattac ttcatgaact tgatgagacg aaaatgtctt 6420

gaaaccttta aaaattcttt aaacaactca gtttagaaaa cagaatagac gtgttagggt 6480

caacttggct aaaagtttac acttgagaga ttattgtgga cttcatgact tgtccttgct 6540

gtagccattt tgctatgaat gaacaggaac attatgggtt ggctttaata caccgtttct 6600

atgctagatt caaaataatt tccctgctcc caggattaac tattgaaata acagaagggt 6660

gcaaaaacct cactctaaac cccattggaa ataccacaat gtaattgtat attttcccac 6720

atgccaatgg tccatgtcct ctgggaaaaa gtggatatac aatactattg gaaagcactg 6780

atggaccctg gctggggagg gtctcccttg agttatcaat ttcatatctg ataatcagat 6840

tattttaaga gattgagtgt gtaaaaattc cctgatgcct aggttgcttt atgatatcct 6900

tttctctatt taaccttgct taaatagcca aacatcacat ccttcctaca cagaagtaat 6960

gatgtaatgt gcccatctac tgcttatatg attacttgtg actactagac aataggcaat 7020

tcaagtttgt gcagccaagg ggaattttta ttgggtttta tgtttgttca gaatttgatt 7080

tttgaatata aaaacaaaat aaaaatctga tttgt 7115

<210> 3

<211> 78

<212> DNA

<213> Synthesis

<400> 3

gattacaagg atgacgacga taagggagat tacaaggatg acgacgataa gatcgattac 60

aaggatgacg acgataag 78

<210> 4

<211> 69

<212> DNA

<213> Synthesis

<400> 4

ggaagcggag ccacgaactt ctctctgtta aagcaagcag gagatgttga agaaaacccc 60

gggcctatg 69

<210> 5

<211> 22

<212> DNA

<213> Synthesis

<400> 5

gtcctgacga atctctgtca ga 22

<210> 6

<211> 21

<212> DNA

<213> Synthesis

<400> 6

ctgagatgac gctgatgatg g 21

<210> 7

<211> 24

<212> DNA

<213> Synthesis

<400> 7

gtggtttcta ccatagggtt tggg 24

<210> 8

<211> 24

<212> DNA

<213> Synthesis

<400> 8

gtagaccgag tcattgtagc tcca 24

<210> 9

<211> 20

<212> DNA

<213> Synthesis

<400> 9

gacatgccgc ctggagaaac 20

<210> 10

<211> 20

<212> DNA

<213> Synthesis

<400> 10

agcccaggat gccctttagt 20

Claims

1. A recombinant vector for modulating neuronal activity, characterized in that: the recombinant vector carries NALCN gene and THIK-1 gene;

the recombinant vector is pLenti-CaMKII-EGFP-P2A-mNACN-pA and AAV2/9-CaMKII-Kcnk13-3xFlag-P2A-mCherry after construction;

the pLenti-CaMKII-EGFP-P2A-mNACN-pA is characterized in that a CaMKII promoter, EGFP and P2A are respectively inserted behind a lentivirus CMV-promoter, a 5' LTR sequence and a central polypurine sequence, a mNACN sequence is inserted behind P2A, and a PA sequence is reversely inserted behind the mNACN sequence;

2. The recombinant vector according to claim 1, wherein: the recombinant vector is provided with fluorescent protein markers.

3. The recombinant vector according to claim 1, wherein: the recombinant vector is a lentivirus, an adenovirus, an adeno-associated virus or a plasmid.

4. A method of modulating neuronal activity, comprising: a recombinant vector according to any one of claims 1-3 transfected in vivo or ex vivo onto a neuron, thereby increasing the expression level of NALCN ion channels and THIK-1 ion channels on said transfected neuron.

5. Use of the recombinant vector of any one of claims 1-3 for narcotic regulation of central nervous system mechanism research.

6. Use according to claim 5, characterized in that: the anesthetic is an inhalation anesthetic.