CN114507694A

CN114507694A - Preparation method and application of stem cells for inducing insulin secretion

Info

Publication number: CN114507694A
Application number: CN202111682996.5A
Authority: CN
Inventors: 王冰; 李艳群; 张伟涛
Original assignee: Individual
Current assignee: Cantonbio Co ltd; Foshan Hanteng Biotechnology Co ltd
Priority date: 2021-12-27
Filing date: 2021-12-27
Publication date: 2022-05-17
Anticipated expiration: 2041-12-27
Also published as: CN114507694B

Abstract

The invention discloses a preparation method and application of stem cells for inducing insulin secretion. At present, recombinant insulin is mainly used for treating insulin-dependent diabetes clinically. The mesenchymal stem cell is a pluripotent stem cell, has all the commonalities of stem cells, namely self-renewal and multidirectional differentiation capacity, has a strong immunoregulation function, and has a treatment effect on pancreatic islet function reduction caused by autoimmune injury. The induced secretory insulin type umbilical cord mesenchymal stem cell capable of responding to the change of the glucose concentration has wide application prospect in treating diabetes.

Description

Preparation method and application of stem cells for inducing insulin secretion

Technical Field

The invention relates to the field of cell biology, in particular to a preparation method and application of stem cells for inducing insulin secretion.

Background

Diabetes Mellitus (DM) is a group of metabolic diseases characterized by long-term elevated blood glucose (abbreviated as blood sugar) levels, a chronic hyperglycemic state caused by the combined action of genetic factors and environmental factors. It is caused by absolute and relative insufficiency of insulin secretion, resulting in disorder of glucose metabolism, causing high blood sugar and urine sugar, and mainly clinically showing symptoms of polydipsia, polyphagia, diuresis, emaciation and the like. With the acceleration of the aging process of the population, the living standard of people is improved, the life style is changed, and the incidence rate of diabetes is rapidly increased. Currently, patients with DM worldwide have reached 40 billion, WHO predicts that by 2030, DM will account for the seventh place of human death (Mathers CD, et al (2006)). At present, the prevalence rate of diabetes in China is about 4%, the diabetes becomes a third chronic disease which is second to cardiovascular and cerebrovascular diseases and tumors and threatens human health, has the characteristics of high fatality rate, high disability rate and high medical cost, and becomes a public health problem facing all countries in the world at present.

Type I diabetes (Type 1 diabetes, T1D) is a rapid, nearly complete lack of insulin secretion due to an autoimmune response that results in islet beta cell damage; type 2 diabetes (T2D) is caused by decreased responsiveness of insulin effector cells to insulin, and initially shows increased insulin secretion to maintain stable blood sugar, and eventually, as the disease progresses, islet beta-cell failure and insulin secretion stop.

Insulin is the only hormone in the body that lowers blood glucose. The secretion of insulin is divided into two parts, wherein one part is insulin secreted to maintain normal fasting blood glucose, and is called basal insulin, and the concentration of the plasma basal insulin is 5-15 mu U/mL; the other part is insulin secreted to reduce postprandial blood glucose rise and maintain postprandial blood glucose normality, and is called as meal insulin. Prior to the definitive diagnosis of diabetes in patients with T1D, autoimmune destruction of the islet beta cells in a large proportion of patients occurs, resulting in a decrease in both prandial and basal insulin secretion. The abnormal function of the islet beta cells of a T2D patient progresses slowly, peripheral insulin resistance, hyperinsulinemia and euglycemia appear in the early stage, but the insulin secretion function is reduced, the insulin secretion is reduced, and the fasting blood sugar and the postprandial blood sugar are increased in the later stage of the disease due to the toxic effect of long-term hyperglycemia.

At present, the treatment of T1D clinically mainly adopts a treatment method of exogenous insulin supplementation, mainly aims at controlling blood sugar, but cannot radically treat diabetes; moreover, frequent detection of blood sugar and injection of insulin increase the psychological and physiological burden of patients; while the use of an insulin pump can reduce the pain of frequent injections by the patient, it can increase the risk of fatal accidents when the device fails mechanically/electronically; in addition, long-term use of exogenous insulin injection is easy to generate insulin antibodies, which results in reduced curative effect, poor blood sugar control, and severe complications such as cardiovascular diseases, retinopathy, nervous system diseases, renal failure and the like caused by chronic hyperglycemia. In addition to insulin therapy, pancreas/islet transplantation is one of the effective methods for treating T1D. However, the wide clinical application of this technology is limited by the problems of limited donor sources and barriers to islet isolation and purification technology, microencapsulation of islets to reduce immune rejection, and lifelong administration of immunosuppressive agents to prevent immune rejection after transplantation (Scharp DW, Marchetti P. (2014)). Therefore, various scholars are continuously exploring other treatment schemes, so as to relieve the pain of patients and improve the treatment effect. For example, researchers have studied the possibility and clinical application value of directed differentiation of embryonic stem cells and Induced pluripotent stem cells (iPSCs) into islet β -like cells, but there are ethical disputes in the application of embryonic stem cells; iPSCs, although inducible to differentiate into islet β -like cells using patient's own cells, autologous β -like cells may still be attacked by the autoimmune system in T1D (Jeffrey R Millman, et al (2017)). In addition, the proliferation of β -like cells in vitro is very slow, and how to produce large amounts of β -like cells with high efficiency and high yield is also the first issue to be considered for clinical application (Jeffrey R millman. et al (2017)).

Mesenchymal Stem Cells (MSCs) are important members of the stem cell family, are derived from early-developing mesoderm and ectoderm, are pluripotent stem cells, and have all the commonalities of stem cells, namely, the ability to self-renew and differentiate in multiple directions. MSCs were originally found in bone marrow, but in recent years umbilical cord mesenchymal stem cells (UC-MSCs) were found to be a good substitute for bone marrow MSCs. The UC-MSCs have the advantages of convenient material acquisition, simplicity and no pain; the number of cells in the umbilical cord is rich, and the proliferation capacity is strong (1 part of umbilical cord can be cultured to more than 100 parts of cells for clinical use); the embryonic stem cell is more similar to the embryonic stem cell, has the capability of differentiating various histiocytes of three germ layers of the inner, middle and outer germ layers, and still has multidirectional differentiation potential after continuous subculture and cryopreservation; the immunogenicity is low, the immune regulation function is unique, and the abnormal immunoreactivity can be reduced; the method does not relate to social, ethical and legal disputes and other advantages, thereby having wide application prospect.

At present, the technology of inducing differentiation of MSCs into islet β -like cells in vitro is mature, and the differentiated islet β -like cells theoretically can secrete insulin for treatment of T1D, but with differentiation of MSCs, various cell differentiation markers, especially MHC molecules, are also up-regulated, and are easily recognized and eliminated by the immune system of a human body after being reinfused into the body, resulting in MSC transplantation failure (Swijnenburg RJ, et al 2005); drukker M, et al (2002); beatriz Su-Alvarez, et al (2010)), another important issue is that the differentiation efficiency of UC-MSCs into islet beta-like cells is far from the clinical requirement, and the clinical application of the technology is difficult.

Disclosure of Invention

The invention aims to provide a preparation method of UC-MSCs (dendritic cells-derived mesenchymal stem cells) capable of responding to blood glucose concentration change and inducing insulin secretion and application of the UC-MSCs in insulin-dependent diabetes mellitus.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the preparation method of the UC-MSCs comprises the steps of constructing a lentiviral vector by adopting an inducible insulin promoter and an insulin gene, and infecting umbilical cord mesenchymal stem cells after packaging lentiviruses to obtain the UC-MSCs for inducing insulin secretion;

the inducible Insulin Promoter and the lentiviral vector of the Insulin gene are a Promoter for inducing Insulin secretion with the sequence shown in SEQ ID NO.1 and a signal peptide and Insulin gene nucleotide sequence shown in SEQ ID NO.2 inserted into the multiple cloning site of the lentiviral vector pCDH-CMV-MCS-EF1-Puro to obtain a recombinant lentiviral vector pCDH-glucose responsive Insulin Promoter-Insulin for inducing Insulin secretion.

The cells used in the present invention are UC-MSCs. MSCs are mesoderm-derived pluripotent stem cells, and UC-MSCs derived from umbilical cords are used in the present invention. The induced insulin secretory UC-MSCs have the following advantages: (1) the UC-MSCs still maintain the characteristics of the MSCs after gene editing and still have multidirectional differentiation potential, the inductive insulin secretory UC-MSCs which are homing and colonized on local parts of the pancreatic islets can have the potential of directionally differentiating into the pancreatic islet beta cells under the induction of the microenvironment of the local parts of the pancreatic islets, not only can be used as seed cells to supplement the pancreatic islet beta cells with reduced number caused by various factors, but also can be differentiated into supporting cells around the pancreatic islet beta cells, or can regulate the functions of the pancreatic islet beta cells and the supporting cells thereof through paracrine action, thereby improving the residual pancreatic islet function; (2) MSCs have stronger immunoregulation function and have treatment effect on diabetes caused by islet beta cell injury due to autoimmune factors (beta cells excessively express MHC I-type molecules under an inflammatory state to cause the activation of autoimmune cells so as to generate immune attack, while MSCs inhibit abnormally enhanced immune reaction through various ways, and the immunoregulation function of MSCs/iPSCs directionally differentiated into islet beta cells in vitro is greatly reduced or even disappears); (3) the characteristics of the induced insulin secretory UC-MSCs are still maintained after the UC-MSCs are subjected to passage amplification for multiple times, and a large amount of MSCs can be rapidly amplified in vitro; the large-scale engineering of islet beta-like cells induced and differentiated from MSCs/iPSCs is not realistic, and is mainly limited by low differentiation efficiency and very slow beta-like cell in-vitro amplification; (4) the immunogenicity is extremely low, the possibility of causing xenotransplantation rejection is extremely low, and the requirement of tissue matching is avoided; however, the technical route of in vitro directional differentiation of MSCs/iPSCs into islet beta-like cells and then transplantation is adopted, and because the cell differentiation markers are up-regulated, how to prevent immune attack of the immune system of the recipient on the transplanted cells is still an unsolved problem, particularly for patients with T1D: in patients with T1D, transplanted allogeneic beta cells may be cleared immunologically within days if the recipient's immune system is not suppressed; (5) can be ectopically expressed. Compared with the common clinical research of transplanting the MSCs to treat diabetes, even if the induced secretory insulin UC-MSCs are not transplanted through pancreatic artery intubation (stem cells are transplanted through intravenous injection, only about 5 percent of MSCs can reach pancreas, most of MSCs are blocked in a pulmonary capillary network, and after the MSCs pass through lung, reach organs such as liver, kidney, spleen and the like, the number of MSCs really homing to the pancreas is very small, but only a very small part of the MSCs can be divided into islet beta-like cells, the MSCs implanted in local pancreas can be greatly increased through the MSCs perfused through the pancreatic artery intubation), only through routine venous infusion, the induced insulin UC-MSCs can be secreted without considering the homing efficiency of the MSCs, even if most of cells are implanted in other parts outside the pancreas, the ectopic secretory induced insulin-UC-MSCs can also express insulin under the induction of postprandial blood sugar fluctuation in vivo, thereby greatly increasing the success rate of treatment; (6) the UC-MSCs can not secrete insulin under the normal blood sugar state, so that serious side effects of hypoglycemia, even shock, death and the like of a patient possibly caused by continuous insulin secretion of insulin UC-MSCs expressed constitutively are avoided. In conclusion, the clinical application of the insulin gene with the glucose-inducible promoter introduced into the UC-MSCs can achieve better effect than the simple application of the UC-MSCs.

The stem cells of the induced secreted insulin are prepared by amplifying the UC-MSCs successfully obtained by the invention in vitro, transplanting the cells into a mouse diabetes model, transplanting the UC-MSCs into a mouse, wherein the UC-MSCs can be planted in vivo and inducibly secrete insulin under the influence of blood sugar concentration, transplanting the UC-MSCs into the mouse diabetes model, and displaying obvious blood sugar reduction effect (P is less than 0.001) from the fifth day to the 30 th day, wherein the UC-MSCs still maintain biological activity.

Drawings

FIG. 1 is a map of recombinant lentiviral vector plasmid pCDH-glucose responsive element Promoter-element

FIG. 2 shows the flow detection results of the detection of UC-MSCs VS-induced insulin secretion type UC-MSCs cultured to P5 generation intracellular insulin

FIG. 3 is a morphological diagram of UC-MSCs VS-induced insulin-secreting UC-MSCs cultured to P5 generation

FIG. 4 shows the flow detection results of UC-MSCs VS induced insulin secretion type UC-MSCs cultured to P5 generation

FIG. 5 shows the differentiation of UC-MSCs VS-induced secreted insulinotropic UC-MSCs into P5 generation three lines

FIG. 6 shows the detection of UC-MSCs VS-induced insulin-secreting UC-MSCs embryonic stem cell marker expression

FIG. 7 shows the content detection of UC-MSCs VS-induced insulin secretion type UC-MSCs under the culture conditions of glucose with different concentrations

FIG. 8 shows the results of the diabetes model mouse experiment-random blood glucose assay

FIG. 9 shows the results of the diabetes model mouse experiment-serum human insulin detection

Detailed Description

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described in the following combined with the specific embodiments. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 insertion of inducible insulin promoter and insulin Gene fragment into Lentiviral vector pCDH-CMV-MCS-EF1-Puro

The inducible Promoter (glucose responsive Insulin Promoter) and human Insulin gene (including signal peptide) (Insulin) sequences were synthesized by Beijing Hua Dai Gene technology Limited, and ligated to PUC57 cloning vector, primers (Table 1) were designed to bring the front and rear ends of the gene fragment sequence with the cleavage sites of snaBI and BamHI, respectively, PCR amplified, double-cleaved, inserted into the double-cleaved pCDH-CMV-MCS-EF1-Puro vector of snaBI and BamHI, transformed into E.coli (stbl3), and the plasmid was extracted and purified using the plasmid purification kit of OMEGA to obtain the recombinant lentiviral vector plasmid shown in FIG. 1. Adding double enzyme cutting sites to a plasmid target fragment, linearizing and amplifying, after double enzyme cutting of snaBI and BamHI, connecting a glucose responsive Insulin Promoter-signal peptide-Insulin fragment with a linearized empty load under the action of T4 ligase with slow virus empty load pCDH-CMV-MCS-EF1 after double enzyme cutting of snaBI and BamHI, replacing the CMV Promoter of the original vector with the glucose responsive Insulin responsive recombinant vector pCDH-glucose responsive Insulin secretion (shown in figure 1).

TABLE 1

Primer name	Primer sequences
		INS-F	5’TACGTAGCTGCAGGCAGCAGGGCT3’
INS-R	5’CGCGGATCCGCGCTAGTTGCAGTAGTTCTCC3’

Example 2 preparation of induced insulin-secreting UC-MSCs

Preparation of UC-MSCs

The umbilical cord of a healthy newborn is delivered to a GMP cell preparation laboratory aseptically in a cold chain within 3 hours after the placenta is delivered. After the Fahrenheit glue tissues are separated bluntly, UC-MSCs are separated and cultured by using a wall attaching method, and after the UC-MSCs are amplified to the third generation (P3), the UC-MSCs are subjected to flow detection of cell surface markers and detection of cell viability, bacteria, fungi, endotoxin, mycoplasma and the like.

(II) Lentiviral packaging

1. The frozen 293T cells are taken out from the liquid nitrogen tank and quickly placed into a water bath kettle at 37 ℃ to dissolve cell suspension ice cubes. After the ice cubes were thawed, the cell suspension was slowly added dropwise to pre-warmed 5mL fresh complete medium (DMEM/10% FBS), centrifuged at 1000rpm for 5 min. After centrifugation, the supernatant was discarded, 1mL of fresh complete medium was added to resuspend the cells, counted, and 3X 10⁶The density of the flask is inoculated into a T75 culture flask, and the flask is placed at 37 ℃ and 5% C0₂And an incubator at 95% relative humidity. Observing cell survival rate the next day, after the cell growth condition is good and passage is 2 times, according to 5X 10⁶The culture dish is inoculated in a 10cm culture dish and placed in an incubator for culture overnight.

2. Two 5mL sterile centrifugation EP tubes were taken, 1mL serum-free MEM medium was added to each tube, 60. mu.g transfection-assisting reagent (PEI) was added to one tube, 20. mu.g total DNA, packaging plasmid and envelope plasmid were added to the other tube, recombinant insulin lentiviral plasmid: viral packaging plasmid (psPAX 2): the ratio of the viral envelope plasmid (pMD2G) was 1: 1. The two tubes were vortexed and mixed together and allowed to stand for 5 minutes. After 5 minutes the PEI diluent was added to the DNA mixture diluent and after vortexing, the mixture was allowed to stand at room temperature for 20 minutes. After 20 minutes the mixture was added dropwise uniformly to 10cm petri dishes seeded yesterday with 293T cells.

3. Harvesting culture medium supernatant of transfected cells 48-72 hours after transfection, centrifuging the culture medium supernatant containing the lentiviral particles at a super high speed, concentrating (20000g, 4 ℃, 2 hours), discarding the supernatant, re-suspending the lentiviral particles by precooled normal saline, subpackaging to 0.1 mL/tube, and freezing and storing at-80 ℃; after one tube of lentivirus was infected into 293T cells for 72 hours, the titer of lentivirus was determined by RT-PCR using the primer sequences in Table 2, and the recombinant lentivirus carrying the insulin-encoding gene was found to have a titer of 4.48E +08 TU/mL as shown in Table 3.

TABLE 2

Primer name	Primer sequence (5 '-3')
		LVINSF1	5’CCAGCGGGGGCCCA 3’
LVINSR1	5’GACGGGCACCGGAGC3’

TABLE 3

(III) Lentiviral infection umbilical cord mesenchymal stem cells and amplification culture of infected umbilical cord mesenchymal stem cells

The generation of P3 UC-MSCs with good state is passaged according to the ratio of 4.4 multiplied by 10⁵Inoculating at a density of/cm 2 in 10cm dish to obtain cell fusion degree of 70-80%, adding CO₂The culture was carried out overnight in an incubator.

The next day, 0.5mL of virus solution was removed from-80 ℃, thawed on ice and immediately centrifuged, and the total amount of lentivirus required was calculated as MOI 10, and the virus solution was added to 8mL of UltraCUL TURE medium and 10. mu.g/mL of polybrene at final concentration and gently mixed.

Removing culture medium supernatant of UC-MSCs in 10cm culture dish, slowly adding the above lentivirus diluent into 10cm culture dish, and continuously placing 10cm culture dish into 37 deg.C, 5% CO₂Culturing in an incubator. After 24 hours, the medium was changed with 15mL of fresh UltraCUL TURE medium. After 48 hours, the UC-MSCs in a 10cm culture dish reach over 90 percent confluency, and then the cells are subjected to passage: digesting UC-MSCs infected with lentivirus, neutralizing, and culturing at 5 × 10³The mixture was inoculated into a T75 flask at a density of/cm 2, supplemented with 10mL of medium, and placed at 37 ℃ in 5% CO₂Continuously culturing in the incubator for 48-72h to reach a confluency degree of more than 90%, and culturing again according to the ratio of 5 × 10³Density of/cm 2Inoculating to T175 culture flask, adding 5% CO at 37 deg.C₂After the culture is continued in the incubator for 48-72h to reach more than 90% confluency, a large number of UC-MSCs of the inductive secretory insulin type P5 are harvested, sample reservation is carried out for flow detection of cell surface markers, RT-PCR is carried out for detecting the copy number of the insulin gene inserted in the cell genome of the inductive secretory insulin type UC-MSCs, cell survival rate, bacteria, fungi, endotoxin, mycoplasma and other detection, three-line differentiation and other experiments.

(IV) detecting the expression rate of insulin in the UC-MSCs by flow cytometry:

digesting and neutralizing induced secreted insulin type UC-MSCs in T175 culture flask, and collecting 2 × 10⁶Dividing UC-MSCs infected with recombinant insulin lentivirus into two groups, one group is an experimental group, and the other group is a positive control group (only secondary antibody is added when the group is dyed, and the rest experimental steps are the same as the experimental group); take 2X 10 at the same time⁶The UC-MSCs not infected with lentivirus as negative control cells were also divided into two groups and treated in the same manner as the above two groups. Each group of cells was fixed with 4% paraformaldehyde at room temperature for 15 minutes, then treated with 0.5% saponin for transmembrane treatment, and stained intracellularly (1X 10)⁶Diluting the primary antibody by InsulinAntibody according to the ratio of 1: 100 for each experimental group of cells/negative control cells, then incubating for 1 hour at room temperature, washing the cells, diluting the secondary antibody by secondary antibody according to the ratio of 1: 500, and then staining for 30 minutes at room temperature; 1X 10⁶After each positive control cell/negative control cell is stained with only a secondary antibody as an isotype control, the expression rate of insulin in the cell is detected by flow cytometry, and the result is shown in fig. 2, the infection efficiency of the lentivirus is as high as 99.1%, the infection efficiency of the lentivirus is high, and insulin is not expressed in UC-MSCs cells which are not infected with the lentivirus.

(V) RT-PCR detection of copy number of insulin gene inserted in genome of UC-MSCs cell of induced insulin secretion type

Taking 1X 10⁶And (3) preparing a PCR system according to the following steps after extracting total DNA (deoxyribonucleic acid) according to the instruction of the tissue cell genome DNA extraction kit by using UC-MSCs/UC-MSCs infected with recombinant insulin lentiviruses:

meanwhile, the system is prepared by using a recombinant Insulin lentiviral plasmid pCDH-glucose responsive Insulin Promoter-Insulin with known concentration to prepare a standard curve;

after the preparation is finished, the 8-row PCR tubes are placed in an RT-PCR instrument, the program is operated for 10min at 95 ℃ (15 s at 95 ℃, 1min at 60 ℃), the step is circulated for 35 times, and a melting curve program is added; the results are shown in Table 4, and 21-24 copies of insulin gene were inserted into the genome of each induced insulin-secreting UC-MSCs cell on average.

TABLE 4

The normal UC-MSCs and the induced insulin-secreting UC-MSCs cultured to the P5 generation are subjected to morphological detection, stem cell surface marker detection and three-line differentiation capability verification conventionally, and the results are shown in figures 3, 4 and 5, the UC-MSCs after gene editing have no change compared with the unedited UC-MSCs in morphology, the induced insulin-secreting UC-MSCs have no change compared with the unedited UC-MSCs in cell surface markers, and have no up-regulation of HLA-DR, the induced insulin-secreting UC-MSCs still have low immunogenicity, the induced insulin-secreting UC-MSCs still maintain three-line differentiation capability, and the detection results of the cell surface markers are combined to meet the minimum standard of stem cell identification.

(VI) comparison of expression of UC-MSCs VS-induced insulin-secreting UC-MSCs cell embryo sternness genes

1. Respectively taking UC-MSCs and induced insulin-secreting UC-MSCs cells at 5.0 × 10⁶Then using the kit to extract total RNA according to the instruction steps, and immediately carrying out the next step of experiment after determining the concentration;

2. taking 2 mu g of RNA, carrying out reverse transcription into cDNA by using a reverse transcription kit according to the instruction, and immediately carrying out the next step of experiment after the concentration is determined;

3. the cDNA obtained in step 2 above was subjected to PCR amplification of the corresponding gene fragment using the primer sequences in Table 5:

TABLE 5

The reaction system is as follows:

the running procedure was as follows:

after the PCR was completed, 1.8% agarose gel electrophoresis was performed. The results are shown in FIG. 6, and the induced insulin-secreting UC-MSCs cells still maintained the expression of embryonic stem cell markers Oct-4, Nanog and Sox-2.

(VII) detection of insulin content in supernatant of UC-MSCs VS-induced insulin secretion type UC-MSCs cell culture medium

And (3) determining the content of insulin in the supernatant of the culture medium under the stimulation of glucose with different concentrations by UC-MSCs/induced insulin secretion type UC-MSCs: will be 8X 10⁵The UC-MSCs/induced insulin-secreting UC-MSCs cells of P5 generation were seeded in 6-well plates and the following experiments were performed after overnight culture attachment:

1. the stem cell medium was aspirated, each well was washed twice with KRBH buffer, 2ml KRBH buffer was added to each well, and the cells were placed in CO₂Culturing for 30 minutes in an incubator;

2.30 minutes later, 2.5mM D-glucose is added into each hole of the UC-MSCs/induced insulin secretion type UC-MSCs; adding 20mM D-glucose into another hole; the other well did not have any treatment as a blank; place the cells in CO₂Incubate in incubator for 30 min. After 30 minutes, the wells with 20mM D-glucose were excluded, and the other wells were used to collect supernatant and terminate the experiment; collecting supernatant from 20mM D-glucose well, gently rinsing the cells with KRBH buffer 2 times, changing to KRBH buffer +2.5mM D-glucose, and mixing the fine powderCellularized in CO₂After 30 minutes of incubation in the incubator, the supernatant was collected and the cells were terminated. Repeating the experiment 3 times by making 3 repeated wells for each experimental condition;

3. collecting the supernatant of each hole at the corresponding time point of each hole, carrying out centrifugation at 2600rpm for 5 minutes at room temperature, and taking the supernatant to carry out ELISA (enzyme-linked immunosorbent assay) to detect the insulin content;

4. digesting and neutralizing each well cell, centrifuging, removing supernatant, washing twice by PBS, extracting total DNA by using a genome DNA rapid extraction kit, measuring the DNA concentration (ng/mu L) by using a spectrophotometer, and multiplying the DNA concentration (ng/mu L) by the volume (mu L) of eluent to obtain the total DNA (ng) of each well cell;

5. insulin calculation formula: insulin concentration (. mu.IU/mL) x volume of supernatant (. mu.lU/mL) of each well divided by total amount of DNA (ng) in μ IU/μ g DNA assay results were statistically analyzed using SIGAPLOT software, comparisons in UC-MSCs/induced insulin-secreting UC-MSCs supernatant insulin content groups were statistically analyzed using the method of Kruskal-Wallis One Way Analysis of Variance on Ranks, comparisons in group data of insulin content at the same glucose concentration were statistically analyzed using the method of Mann-Whitney Rank Sum Test, P < 0.05 was statistically significant, and the results are shown in FIG. 7, where the measurement results (ELISA) of insulin concentration in supernatant of culture medium after culturing the induced insulin-secreting UC-MSCs of the present invention in culture medium at different glucose concentrations showed no significant insulin secretion from MSC at baseline level (2.5 mM), when the glucose concentration is increased (20mM), insulin is secreted in an inducing way, and when the glucose concentration in a culture medium is returned to a baseline level, the insulin secretion amount is also rapidly reduced (30 minutes) to the baseline level, so that the serious hypoglycemia reaction and even death of a patient caused by stem cells which express insulin constitutively in the treatment process are avoided.

Example 3 therapeutic Effect of induced insulin-secreting UC-MSCs cells on diabetic model mice

(1) Experimental animals: half of Balb/c mice with the age of 6 weeks are female and male mice, the weight of the Balb/c mice is 15-20 g, the Balb/c mice are purchased from the animal experiment center of Guangdong province, and the mice arrive at a laboratory and are adapted for 2 weeks before the test is started; hyperglycemia generally occurs after 3-5 days after a single intraperitoneal injection of 250mg/kg body weight of Streptozotocin (STZ), freshly dissolved in 114mmol/L, pH ═ 4.5 sodium citrate. The random blood sugar is more than 300mg/dL after 2 times of continuous measurement, and the mouse accompanied with polydipsia, polyphagia and polyuria symptoms is a model animal which is successfully modeled; 21 model mice were randomly divided into 3 groups of 7 PBS control group, UC-MSCs group, and induced insulin-secreting UC-MSCs group.

(2) Induced secreted insulinotropic UC-MSCs were prepared as described in example 2;

(3) the 5 th generation UC-MSCs/induced insulin secreting UC-MSCs cells were prepared with PBS to a density of 1X 10⁷After each 0.2mL of cell suspension was injected into the tail vein, 2X 10 cells per mouse⁶One cell, control group was injected with 0.2mL PBS only. All procedures were performed under sterile conditions as required by the surgical procedure.

(4) Functional detection:

1. random blood sugar detection: after transplantation, the mice in each group were randomly blood-sugar-measured by tail vein blood using a rapid glucometer every 5 days until day 30.

2. And (3) detecting the content of serum insulin: each group of mice was tested at 31d after cell transplantation: after the random blood sugar of the diabetic mouse on the 30 th day is collected, fasting is carried out for 16 hours, D- (+) -glucose is injected into the abdominal cavity according to the dose of 2g/kg body weight, the blood sugar concentration is respectively measured 0 minute and 30 minutes after the glucose is injected, blood is taken from the eye socket, after serum is separated, the standard substance is diluted, sample adding and color developing are carried out according to the instruction of a human insulin ELISA kit, and after an enzyme-linked immunosorbent assay instrument is used for measuring absorbance, the human insulin concentration in the sample is calculated through a standard curve.

3. Statistical treatment: statistical treatment is carried out by adopting SPSS 13.0 software, the blood sugar and insulin level values are expressed by mean plus or minus SE, statistical Analysis is carried out by comparing the blood sugar and insulin values of three groups of mice by a method of Kruskal-Wallis One Way Analysis of Variance on Ranks, and P < 0.05 has statistical significance. The results showed that after cell transplantation, from the fifth day (see fig. 8), the induced secreted insulin type UC-MSCs began to show significant hypoglycemic effect (P < 0.001), and to the observation end (day 30), as shown in fig. 9, the induced secreted insulin type UC-MSCs still maintained biological activity; UC-MSCs also showed hypoglycemic effects (P < 0.001) on day 30.

Claims

1. The preparation method and the application of the stem cell for inducibly secreting the Insulin are characterized in that the umbilical cord mesenchymal stem cell for inducibly expressing the Insulin is obtained by modifying the umbilical cord mesenchymal stem cell of P3 generation with a recombinant lentiviral vector plasmid pCDH-glucose responsive Promoter-Insulin through replacing a CMV Promoter with an inducible Insulin Promoter (glucose responsive Promoter) sequence, wherein the downstream of the CMV Promoter is a nucleotide sequence of the Insulin and a signal peptide thereof.

2. The method for preparing the stem cell capable of inducing insulin secretion according to claim 1 and the application thereof, wherein the inducible insulin promoter sequence is a nucleotide sequence shown in a sequence table SEQ.ID.NO.1.

3. The method for preparing the stem cell capable of inducing insulin secretion according to claim 1 and the application thereof, wherein the nucleotide sequences of the insulin and the signal peptide thereof are shown in a sequence table SEQ.ID.NO.2.

4. The method for preparing the stem cell capable of inducing insulin secretion according to claim 1, wherein the umbilical cord mesenchymal stem cell of the P3 generation is prepared by the following steps: collecting umbilical cord of newborn, separating Fahrenheit jelly tissue, and cutting into pieces of 0.5mm²The size of the capsule is determined by the size of the capsule,subcultured in UltraCUL TURE medium and passed to P3 for this experiment.

5. The method for preparing the stem cell capable of inducing Insulin secretion according to claim 1, wherein the method for modifying the umbilical cord mesenchymal stem cell of P3 generation by the constructed recombinant lentiviral vector pCDH-glucose responsive Promoter-Insulin is as follows: after the constructed recombinant lentiviral vector pCDH-glucose responsive Promoter-Insulin plasmid and the lentiviral packaging plasmid are cotransfected with 293T cells, the 293T cells release lentiviral particles, supernatant is collected, the virus titer is determined after concentration, and the lentiviral particles are infected into P3 umbilical cord mesenchymal stem cells according to MOI (10).

6. The method for preparing the stem cell capable of inducing insulin secretion according to claim 1 and the application thereof, which are used for treating insulin-dependent diabetes mellitus.

7. A medicament for treating insulin-dependent diabetes mellitus, comprising: a method of making a stem cell comprising induced insulin secretion according to claim 1 for the treatment of insulin-dependent diabetes mellitus.