CN114507647A

CN114507647A - Spartina alterniflora salt-tolerant protein P5CS2 and coding gene and application thereof

Info

Publication number: CN114507647A
Application number: CN202210102463.3A
Authority: CN
Inventors: 曲长凤; 缪锦来; 赵阳; 何英英
Original assignee: First Institute of Oceanography MNR
Current assignee: First Institute of Oceanography MNR
Priority date: 2022-01-27
Filing date: 2022-01-27
Publication date: 2022-05-17

Abstract

The invention discloses spartina alterniflora salt-tolerant protein P5CS2, and a coding gene and application thereof. The spartina alterniflora salt-tolerant protein P5CS2The amino acid sequence is shown as SEQ ID NO.1, and the coding gene thereofSaP5CS2The nucleotide sequence of (A) is shown in SEQ ID NO. 2. The invention also prepares the gene containing the coding geneSaP5CS2The recombinant expression vector and the engineering strain. The spartina alterniflora salt-tolerant protein P5CS2 and the coding gene thereof can promote the synthesis of proline under the stress of salinity, improve the salt tolerance of plants, are used for improving the salt tolerance of the plants or screening and cultivating salt-tolerant plant varieties, and have wide prospects.

Description

Spartina alterniflora salt-tolerant protein P5CS2 and coding gene and application thereof

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to spartina alterniflora salt-tolerant protein P5CS2, and a coding gene and application thereof.

Background

Salinity is one of the important abiotic factors that limit plant development and growth. The ion content in the soil is increased under the salt stress, the water potential in the soil is reduced, and the plants have difficulty in absorbing water or seriously cause water outflow. Various organic or inorganic substances are actively accumulated in some plants to improve the concentration of cell sap, reduce osmotic potential and improve the water absorption or retention capacity of cells, so that the plants are suitable for the water stress environment. Excessive accumulation of proline is considered an osmoprotectant of exposure to high osmotic stress.

Spartina alterniflora (Spartina alterniflora) belongs to Poaceae/Gramineae and Setaria (Sporoblolus/Spartina), and is a typical halophyte growing in saline ponds along the sea. The spartina alterniflora has wide salt adaptability from fresh water to seawater, the salt adaptability range is 0% -3%, and the spartina alterniflora has high resistance to salt stress. The discovery and cloning of the related gene regulated by proline from spartina alterniflora is of great significance to the exploration of the salt tolerance mechanism of plants.

Disclosure of Invention

The invention provides spartina alterniflora salt-tolerant protein P5CS2, and a coding gene and application thereof. The protein and the coding gene thereof can promote the synthesis of proline under the condition of salinity stress and improve the salt tolerance of plants.

In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:

the invention provides spartina alterniflora salt-tolerant protein P5CS2, wherein the amino acid sequence of spartina alterniflora salt-tolerant protein P5CS2 is shown as SEQ ID No. 1.

The invention also provides a coding gene SaP5CS2 of the spartina alterniflora salt-tolerant protein P5CS2, wherein the coding gene SaP5CS2 has one of the following nucleotide sequences:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

(2) the nucleotide sequence which is identical to the nucleotide sequence from 139 th to 2325 th at the 5' end of the nucleotide sequence shown in SEQ ID NO.2 and can encode the amino acid sequence of spartina alterniflora salt-tolerant protein P5CS 2.

The invention also provides a primer of the encoding gene SaP5CS2 of the spartina alterniflora salt-tolerant protein P5CS2, and the nucleotide sequence of the primer is shown as SEQ ID NO.5 and SEQ ID NO. 6.

The invention also provides a recombinant expression vector containing the encoding gene SaP5CS2 of the spartina alterniflora salt-tolerant protein P5CS 2.

Further, the recombinant expression vector is pBWA (V) HS-PC1300-P5CS2, wherein the pBWA (V) HS is obtained by modifying a vector PCAMBIA 1300.

Furthermore, in constructing the recombinant expression vector, any enhanced promoter can be added before the transcription initiation nucleotide, and can be used alone or in combination with other plant promoters.

The invention also provides an engineering strain containing the recombinant expression vector.

Further, the engineering strain comprises agrobacterium EHA 105.

The invention also provides application of the spartina alterniflora salt-tolerant protein P5CS2 in preparation of a preparation for improving the salt tolerance of plants.

The invention also provides application of the encoding gene SaP5CS2 of the spartina alterniflora salt-tolerant protein P5CS2 in cultivation or screening of salt-tolerant plants.

Furthermore, the recombinant expression vector containing the coding gene SaP5CS2 is transferred into a target plant to obtain a transgenic plant with salt tolerance obviously higher than that of a wild type plant, and the proline amount of the transgenic plant is increased under the condition of salt stress so as to resist the salt stress.

Further, in order to identify or screen the salt-tolerant plants, antibiotic markers with resistance are added to the recombinant expression vector.

Furthermore, the recombinant expression vector is specifically a recombinant plasmid pBWA (V) HS-P5CS2 obtained by inserting the gene into a multiple cloning site of a plant expression vector, and contains elements such as LB element sequence complementation, nos terminal, hygromycin resistance gene UP, 35S and the like.

Further, the plant comprises arabidopsis thaliana.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the salt-tolerant protein P5CS2 and the encoding gene SaP5CS2 thereof are obtained by screening from salt-tolerant spartina alterniflora and can be used for improving the salt tolerance of plants, the protein and the encoding gene thereof have important significance for the research on the proline metabolism molecular mechanism of the plants, and an effective way is provided for improving the salt tolerance of the crops by cultivating the salt-tolerant crops through transgenic engineering, so that the salt-tolerant protein P5CS2 and the encoding gene thereof have wide application and market prospects in the agricultural field.

Drawings

FIG. 1 is an agarose gel electrophoresis of the first RACE amplification, wherein M: marker 2000; 1: p5CS 25' -RACE product; 2: p5CS 23' -RACE product.

FIG. 2 is an agarose gel electrophoresis of the second RACE amplification, wherein M: marker 2000; 1: p5CS 25' -RACE product; 2: p5CS 23' -RACE product.

FIG. 3 shows the expression level change of SaP5CS2 in Spartina alterniflora under different salinity stress.

FIG. 4 is a restriction enzyme analysis diagram, in which the lengths of the bands of the DNA Marker are 6000, 4000, 3000, 2000, 1500, 1000, 750, 500, 250 and 100bp from top to bottom respectively; the lengths of the EcorV enzyme cutting bands from top to bottom are 5324 bp, 2788 bp, 2691 bp and 1134bp respectively.

FIG. 5 shows the constructed plant recombinant vector pBWA (V) HS-PC1300-P5CS 2.

FIG. 6 shows that after the plasmid is extracted from the plant recombinant vector, whether the target gene is inserted or not is detected, and the amplification primer ORFP5CS2F/R and the coding region 2187bp are used.

FIG. 7 shows the expression difference of transgenic Arabidopsis SaP5CS2 gene under 24% salinity stress.

FIG. 8 shows the growth status of WT and transgenic SaP5CS2 Arabidopsis S5, S9 plants treated with 24% salinity for 2 days.

FIG. 9 shows color changes measured by 24% salinity stress for 2 days WT and transgenic SaP5CS2 Arabidopsis S5 and S9 plant proline.

FIG. 10 shows the change of proline accumulation in WT and transgenic SaP5CS2 Arabidopsis S5 and S9 plants treated with 24% salinity for 2 days.

Detailed Description

The following examples are provided to illustrate and explain the present invention, and it should be understood that the examples described herein are only for the purpose of illustration and explanation and are not intended to limit the present invention.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Example 1: spartina alterniflora salt-tolerant protein P5CS2 and obtaining and cloning of coding gene thereof

Firstly, taking spartina alterniflora as a material to extract total RNA, taking partial RNA as a template, carrying out reverse transcription to obtain cDNA, taking the DNA as the template, and carrying out amplification of an intermediate sequence by using P5CS2-F/R, wherein the specific steps are as follows:

1. extracting the total RNA of spartina alterniflora according to the instructions of Trizol (Beijing all-purpose gold) kit, and the specific method comprises the following steps:

(1) 1ml of Trizol was added to a 1.5ml sterilized EP tube;

(2) weighing 100mg of spartina alterniflora leaves, putting into a mortar containing 2/3 and precooled by liquid nitrogen, quickly grinding into powder, supplementing liquid nitrogen during the grinding to fully grind the plant leaves, quickly transferring into the EP tube with the volume of 1.5ml, uniformly mixing by vortex, and keeping the room temperature for 5 min;

(3) adding 0.2mL of chloroform, performing vortex oscillation for 15s, and standing at room temperature for 3 min;

(4) centrifuging at 4 deg.C for 15min at 10000 g;

(5) transferring about 0.5mL of the supernatant into a new sterilized EP tube, avoiding protein precipitation absorbed into the middle layer, adding 0.5mL of precooled isopropanol, turning upside down, mixing well, and standing at room temperature for 10 min;

(6) centrifuging at 10000g and 4 ℃ for 15min, wherein white precipitates are formed at the bottom and the wall of the tube;

(7) carefully discard the supernatant, add 1mL of 75% pre-cooled ethanol to the EP tube, vortex and shake to float the white precipitate;

(8) centrifuging at 4 deg.C for 10min at 10000g, and removing ethanol;

(9) blowing air in a ventilated superclean bench to volatilize ethanol as completely as possible, wherein the time is about 5 min; adding 20 μ L of RNA dissolving solution to dissolve the white precipitate completely;

(10) the integrity and concentration of the extracted RNA were detected by nucleic acid gel electrophoresis and NanoVue ultramicro spectrophotometer, respectively, and stored at-80 ℃ for further use.

2. Reverse transcription synthesis of spartina alterniflora cDNA first chain

The first strand of the Spartina alterniflora cDNA was synthesized according to the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit from TransGen, Inc., and the specific steps were as follows:

(1) the following solutions were mixed:

(2) incubating in a PCR instrument at 65 ℃ for 5min, and immediately carrying out ice bath for 2 min;

(3) the following reagents were mixed:

(4) reacting at 42 deg.C for 30min in PCR instrument, heating at 85 deg.C for 5s, and storing at-20 deg.C.

3. PCR reaction system

(1) A25. mu.L PCR reaction was prepared as follows:

(2) the PCR amplification primer sequence is as follows:

P5CS2-F：ATGGCGGTCACAGCCAGG(SEQ ID NO.3)；

P5CS2-R：TCATTCCAAAGGAAGATCCTTGTGG(SEQ ID NO.4)；

(3) PCR reaction, procedure is:

after the reaction, the product was removed, detected by electrophoresis on a 1% agarose gel and sequenced.

Secondly, taking the spartina alterniflora as a material to extract total RNA, taking the RNA as a template, and carrying out PCR amplification by using a 5'-RACE primer and a 3' -RACE primer.

1. Specifically, 5'-RACE and 3' -RACE Amplification were performed according to the instruction of Single Cell Full Length mRNA-Amplification Kit N712 of Novowed corporation.

2. Primer sequences used for cloning spartina alterniflora SaP5CS2 gene:

ORFP5CS2-F：ATGGGAAGGGGAGGGATCGG(SEQ ID NO.5)；

ORFP5CS2-R：TCATTCCAAAGGAAGATCCTTGTGG(SEQ ID NO.6)；

5-P5CS2：CACTCCCTTGTCACCGTTCACT(SEQ ID NO.7)；

3-P5CS2：GGCGGTCACAGCCAGGGATT(SEQ ID NO.8)；

UPM：CTAATACGACTCACTATAGGGC(SEQ ID NO.9)。

3. RACE amplification results

The extracted high quality RNA was amplified by 5'-RACE and 3' -RACE using Single Cell Full Length mRNA-Amplification Kit N712 to obtain cDNA templates. The electrophoresis results after the first RACE are shown in FIG. 1, and the bands are unclear. A second RACE was then performed using the first product as template and the result is shown in figure 2, where clear bands were seen.

The amplified product of FIG. 2 was sent to a sequencing company for sequencing, and the sequencing results of the intermediate sequence, 5'-RACE and 3' -RACE were spliced to obtain the complete sequence of the Spartina alterniflora SaP5CS2 gene, as shown in SEQ ID NO.2, and the amino acid sequence of the encoded Spartina alterniflora protein P5CS2 as shown in SEQ ID NO. 1.

Example 2

The spartina alterniflora seedlings in this example (3-5 leaf stage) were from the Qingdao coast marshland (36 ° N15'48 "; 120 ° E19' 0").

Spartina alterniflora seedlings were transferred to plastic pots (with drain holes at the bottom) and filled with a sludge and sand mixture (3: 1) and allowed to acclimate for two weeks prior to experimental treatment. The cultivation condition is 16h/8h, the cultivation is carried out in a light/black period, the temperature is 24 +/-2 ℃, and the relative air humidity is 60%. Three seedlings with approximately the same growth vigor are arranged in each flowerpot and are irrigated with tap water regularly every three days. After two weeks, the salinity of the seedlings is irrigated for 12h by respectively using seawater of 0, 10 per mill, 24 per mill and 32 per mill, the RNA of the spartina alterniflora leaves under different salinity is respectively extracted and is reversely transcribed into cDNA, the alpha-tubulin gene of the spartina alterniflora is taken as the internal reference gene, the expression analysis under different salinity is carried out by using Real-time PCR, and each treatment is repeated for three times.

The primer sequences used for Real-time PCR were as follows:

qP5CS2-F：ATGGATGTTGAGGCGGCACAAG(SEQ ID NO.10)；

qP5CS2-R：TCAGCAATGGCACGAATGGATCTC(SEQ ID NO.11)；

alpha-tublin-F：CCCTACCCCAGGATCCACTT(SEQ ID NO.12)；

alpha-tublin-R：GGCCTTCTCGGCAGATATCA(SEQ ID NO.13)。

the total RNA extraction and reverse transcription steps were as in example 1. According to the general formula of gold

Green qPCR Supermix (+ Dye I) fluorescent quantitative PCR was performed. Each gene amplification has internal reference simultaneous amplification, Ct value is read under default condition, each sample is repeated three times, and relative quantification 2 is adopted^-ΔΔCTThe method determines the relative expression level of each gene.

The fluorescent quantitative PCR reaction system is as follows:

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 30 s; denaturation at 94 ℃ for 5 s; annealing at 60 ℃ for 10s, extending at 72 ℃ for 10s, and circulating for 45 cycles;

the dissolution curve is: 94 ℃, 60 s; 15s at 55 ℃; 94 ℃ for 30 s.

The real-time fluorescence quantitative detection of SaP5CS2 gene is carried out on the spartina alterniflora material processed by different salinity stress on a Roche LightCycler 96 fluorescence quantitative instrument.

The results are shown in FIG. 3: under different salt stresses, the relative expression quantity of the spartina alterniflora SaP5CS2 gene is obviously increased compared with that of 0 per thousand salinity, and the highest expression quantity appears in 24 per thousand salinity. Thus, it is demonstrated that the high-salt treatment can improve the expression of SaP5CS2 gene in the spartina alterniflora having salt tolerance, and thus the spartina alterniflora can improve the salt tolerance of the spartina alterniflora by improving the expression of SaP5CS2 gene. Therefore, the SaP5CS2 gene is related to salt tolerance, and the encoded P5CS2 protein is salt-tolerant protein.

Example 3

The open coding box of the SaP5CS2 gene in example 1 was obtained by NCBI website (http:// www.ncbi.nlm.nih.gov/gorf. html), and Primer Premier 5 was used to design a pair of primers with the sequence:

ORFP5CS2-F：ATGGGAAGGGGAGGGATCGG(SEQ ID NO.5)；

ORFP5CS2-R：TCATTCCAAAGGAAGATCCTTGTGG(SEQ ID NO.6)。

PCR amplification was performed using cDNA reverse transcribed from Spartina alterniflora RNA as a template, and the procedure was as in example 1. After the PCR product was detected by 1% agarose Gel electrophoresis, the electrophoretic fragment of the objective band SaP5CS2 was excised under an ultraviolet lamp, recovered and purified according to the Easypure Quick Gel Extraction Kit, and the recovered DNA (the recovered product was labeled as rDNAP1) was dissolved in 20. mu.L of water, and ligated to a vector after sequencing without errors.

Construction of plant expression vector pBWA (V) HS-P5CS2

1. The vector was cleaved as follows:

the enzyme digestion reaction is carried out in water bath at 37 ℃ for 1 h.

2. rDNAP1 enzyme cleavage

The enzyme digestion connection system is as follows:

the vector enzyme cut and rDNAP1 cut were pooled and purified using the easy pure PCR purification kit, labeled P-rDNAP1, for the next ligation reaction.

3. And (3) connection reaction: the system is as follows:

ligation was performed at 20 ℃ for 1 h.

4. PCR identification of bacterial plaque

5 mu.L of the ligation product was transformed into Escherichia coli competent transformation and plated on (kanamycin) resistant plates, cultured at 37 ℃ for 12h, 10 plaques were picked while 1.5mL of EP tube inoculation and PCR identification were performed, and the primer sequences were as follows:

35S-seq：TTCATTTGGAGAGAACACGGGGGAC(SEQ ID NO.14)；

Oseq-R：CAAGACCGGCAACAGGATTCAATC(SEQ ID NO.15)；

P5CS2-1R：CGTTACAAGCTGCTGGAT(SEQ ID NO.16)；

P5CS2-2R：TGCATCTTGTGCCGCCTC(SEQ ID NO.17)；

P5CS2-3R：TAGAGCTGATGGCGTCAT(SEQ ID NO.18)。

and (3) PCR system: 10 PCR reactions were performed in a 25. mu.L system:

PCR procedure:

the target band is a fragment of about 2187 bp. Taking bacterial liquid corresponding to 3 positive bands, sucking 100 mu L of the bacterial liquid by a pipette gun, feeding the bacterial liquid for sequencing, inoculating the sequencing primer NOseq-R, P5CS2-1R, P5CS2-2R, P5CS2-3R to LB containing 5mL (kanamycin) resistance, shaking the bacterial liquid in a test tube, after a sequencing result to be detected comes out, carrying out enzyme digestion identification on the bacterial liquid with EcorV, wherein the sequencing primer is NOseq-R, P CS2-1R, P CS2-2R, P CS 2-3R. Three bands can be seen in the electrophoresis detection, as shown in FIG. 4, and the band size is correct, which indicates that the recombinant expression vector is successfully constructed. The successfully constructed recombinant expression vector was named pBWA (V) HS-PC1300-P5CS2, as shown in FIG. 5. The recombinant vector was extracted into a plasmid, and the electrophoretogram is shown in FIG. 6, indicating that the gene of interest has been inserted into the vector.

Secondly, the expression vector pBWA (V) HS-P5CS2 transforms the agrobacterium competent cells

1. Plasmid transformation

Adding 1 mu L of plasmid into 50 mu L of agrobacterium EHA105 competent cells, fully and uniformly mixing, absorbing into an electric rotating cup for electric rotation, adding 1mL of LB liquid culture medium after electric rotation, absorbing into a 1.5mL of EP tube after fully and uniformly mixing, carrying out shaking culture at 30 ℃ and 180rpm of a shaking table for 30min, absorbing 50 mu L of activated agrobacterium liquid, inoculating on an LB solid culture medium, and carrying out dark culture at 30 ℃ for 48 h.

2. Agrobacterium detection

The following primers were synthesized:

Hyg-F：ACGGTGTCGTCCATCACAGTTTGCC(SEQ ID NO.19)；

Hyg-R：TTCCGGAAGTGCTTGACATTGGGGA(SEQ ID NO.20)。

PCR amplification System:

PCR procedure

3. Agrobacterium tumefaciens-mediated genetic transformation of Arabidopsis thaliana

1) Sowing: after the Columbia wild type arabidopsis is sown, the effect of heat preservation is achieved by covering the Columbia wild type arabidopsis with a preservative film;

2) transplanting: transplanting when two main leaves grow out from arabidopsis thaliana, keeping the transplanted seedling wet for 3-4 days by using a preservative film, removing the preservative film, covering the plastic cup with rosette leaves for about one month, and watering the seedling in a moderate amount;

3) removing the catkins: removing the first-time germination floral grouping of arabidopsis thaliana, so that more floral groupings can be obtained, allowing arabidopsis thaliana to grow nutritionally under the condition of short sunlight, and placing the arabidopsis thaliana under long sunlight about one week before infection;

4) infection with Agrobacterium

Selecting agrobacterium, preparing agrobacterium resuspension with OD600 of 0.8-1.2, adding silwet-77 to 0.02%, dipping all inflorescences of arabidopsis thaliana material in the bacterial liquid for 2-3s, sealing the membrane and keeping the humidity to be more than 90%, and carrying out dark culture at 25 ℃ for 24 h. The dip dyeing cycle was 7 days, 3 times total dip dyeing. Removing grown siliques before the first infection, infecting the siliques once every week after the first infection for two to three times, and avoiding water shortage of plants after infection.

5) Harvesting seeds

Growing the soaked seedlings under the conditions of 23 ℃ and 16h of illumination/8 h of dark illumination until the seedlings are seeded; the ripe fruit pods are gently kneaded on clean white paper, wrapped and dried for 24 hours at 37 ℃. After drying, the seeds are sieved by a 60-mesh sieve, and the clean seeds are stored at 4 ℃.

6) Sterile screening

Sterilizing the seeds with 95% ethanol for 10min, sterilizing with 75% ethanol for 10min, washing with sterile water for 2-3 times, 1 min/time, uniformly spreading on screening culture medium with corresponding resistance, and standing at 4 deg.C for 2-3 days; the plate was taken out and cultured at 23-25 ℃ under 16h light/8 h dark conditions for 10-14 days.

7) Screening and transplanting seedlings

Transplanting the screened and surviving seedlings into nutrient soil, and culturing at 23 ℃ under 16h light/8 h dark condition.

8) Positive seedling detection

After the seedlings grow for about 20 days, extracting arabidopsis genome DNA by adopting a CTAB method, carrying out PCR detection by adopting a detection method and agrobacterium bacteria detection, and using T3 generation arabidopsis transfected with spartina alterniflora SaP5CS2 gene for the next stress experiment.

Example 4

1. Fluorescent quantitative analysis of T3 generation arabidopsis thaliana transfected with spartina alterniflora SaP5CS2 gene under salinity stress

Randomly extracting RNA of 2 transgenic arabidopsis thaliana S5 and S9, performing reverse transcription to obtain cDNA, taking actin gene of arabidopsis thaliana as an internal reference gene, and analyzing expression quantity of a target gene SaP5CS2 under 24 per thousand salinity, wherein the treatment time is respectively as follows: 0h, 3h, 6h, 12h, 24h, each treatment was repeated three times.

Primers used in Real-time PCR

qP5CS2-F：ATGGATGTTGAGGCGGCACAAG(SEQ ID NO.21)；

qP5CS2-R：TCAGCAATGGCACGAATGGATCTC(SEQ ID NO.22)；

actin-F：GCATGAAGATCAAGGTGGTTGCAC(SEQ ID NO.23)；

actin-R：ATGGACCTGACTCATCGTACTCACT(SEQ ID NO.24)。

The total RNA extraction and reverse transcription and fluorescence quantification were performed as in example 2.

Real-time fluorescent quantitative detection is carried out on the transgenic SaP5CS2 Arabidopsis materials treated by different stress time on a Roche LightCycler 96 fluorescent quantitative instrument.

The results are shown in FIG. 7: the relative expression level of the SaP5CS2 gene in transgenic Arabidopsis thaliana showed a tendency to decrease after increasing with the increase of the salt stress treatment time, while the expression level of the SaP5CS2 gene in wild Arabidopsis thaliana was suppressed due to the salt stress treatment. Shows that the expression quantity of the arabidopsis thaliana seedling SaP5CS2 which is transfected with SaP5CS2 of spartina alterniflora is increased, and the proline synthesis can be promoted.

2. Salt tolerance of T3 generation Arabidopsis thaliana transfected with spartina alterniflora SaP5CS2 gene was compared with that of wild type Arabidopsis thaliana

As shown in FIG. 8, after 2 days of 24% salt stress treatment, two leaves of wild-type and SaP5CS 2-transfected Arabidopsis were taken respectively, and it was observed that the wild-type Arabidopsis showed wilting and slight withering, while the Arabidopsis of SaP5CS2 gene transfected by two strains S5 and S9 showed good growth. The salt tolerance of the arabidopsis transfected with spartina alterniflora SaP5CS2 gene is higher.

Example 5: accumulation amount of proline under 24 per mill stress of S5 and S9 transgenic arabidopsis thaliana

Stress the transgenic Arabidopsis strains S5 and S9 and the wild Arabidopsis of 1 strain in example 3 for 2 days, respectively measuring the Proline content change before and after stress, wherein the Proline measuring method is strictly operated according to the instructions of the line Assay Kit of Nanjing institute of bioengineering.

Results as shown in fig. 9 and 10, the proline content of wild type arabidopsis thaliana and transgenic SaP5CS2 arabidopsis thaliana S5 and S9 were not significantly different without salinity stress. After seawater with 24 per mill of salinity is stressed for 2 days, the proline content of wild plants and plants with transferred target genes are obviously increased. The overexpression SaP5CS2 gene promotes the synthesis of proline in the transgenic arabidopsis thaliana, improves the concentration of cell sap, resists salinity stress and improves the salt tolerance of the transgenic arabidopsis thaliana.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described in the foregoing embodiments, or equivalents may be substituted for some of the features thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> department of natural resources first oceanographic institute

<120> spartina alterniflora salt-tolerant protein P5CS2, and coding gene and application thereof

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 728

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gly Arg Gly Gly Ile Gly Gly Arg Pro Val Ala Val Asp Met Glu

1 5 10 15

Thr Val Asp Ser Thr Arg Ala Phe Val Arg Asp Val Lys Arg Ile Val

20 25 30

Ile Lys Val Gly Thr Ala Val Val Thr Gly Gln Asp Gly Arg Leu Ala

35 40 45

Met Gly Arg Leu Gly Ser Leu Cys Glu Gln Ile Lys Gln Leu Asn Phe

50 55 60

Gln Gly Tyr Glu Val Ile Leu Val Thr Ser Gly Ala Val Gly Val Gly

65 70 75 80

Arg Gln Arg Leu Gln Tyr Arg Lys Leu Ile His Ser Ser Phe Ala Asp

85 90 95

Leu Gln Asn Pro Gln Met His Phe Gly Gly Lys Ala Cys Ala Ala Val

100 105 110

Gly Gln Ser Gly Leu Met Ala Ile Tyr Asp Thr Leu Phe Ser Gln Leu

115 120 125

Asp Ile Thr Ser Ser Gln Leu Leu Val Thr Asp Arg Asp Phe Lys Asp

130 135 140

Pro Asn Phe Gly Asp Gln Leu Arg Glu Thr Ile Phe Ser Leu Leu Asp

145 150 155 160

Leu Lys Val Val Pro Leu Phe Asn Glu Asn Asp Ala Ile Ser Ser Arg

165 170 175

Arg Gln Pro His Glu Asp Pro Ser Phe Trp Asp Asn Asp Ser Leu Ala

180 185 190

Ala Leu Leu Ala Ala Glu Leu Asp Ala Asp Leu Leu Val Ile Leu Ser

195 200 205

Asp Val Asp Gly Leu Tyr Ser Gly Pro Pro Ser Asp Pro Gln Ser Lys

210 215 220

Ile Ile His Thr Tyr Ile Asn Glu Lys His Gly Lys Leu Ile Asn Phe

225 230 235 240

Gly Glu Lys Ser Ser Val Gly Arg Gly Gly Met Glu Ala Lys Val Ala

245 250 255

Ala Ala Ala Asn Ala Ala Ser Lys Gly Val Pro Val Val Ile Ala Ser

260 265 270

Gly Phe Glu Pro Glu Arg Ile Ile Lys Val Leu Lys Gly Glu Lys Ile

275 280 285

Gly Thr Leu Phe His Asn Ala Ala Asn Ser Trp Glu Ala Ser Lys Glu

290 295 300

Ala Thr Ala Arg Glu Met Ala Val Thr Ala Arg Asp Cys Ser Arg Arg

305 310 315 320

Leu Gln Lys Leu Ser Ser Asp Glu Arg Lys Lys Ile Leu Leu Asp Ile

325 330 335

Ala Asp Ala Leu Glu Ala Asn Glu Asp Leu Ile Arg Ser Glu Asn Glu

340 345 350

Met Asp Val Glu Ala Ala Gln Asp Ala Gly Tyr Glu Lys Ser Leu Val

355 360 365

Ala Arg Met Arg Leu Lys Gln Gly Lys Ile Thr Asn Leu Ala Arg Ser

370 375 380

Ile Arg Ala Ile Ala Asp Met Glu Asp Pro Ile Ala His Thr Leu Lys

385 390 395 400

Arg Thr Glu Val Ala Lys Asp Leu Val Phe Glu Lys Thr Tyr Cys Pro

405 410 415

Leu Gly Val Leu Leu Ile Ile Phe Glu Ser Arg Pro Asp Ala Leu Val

420 425 430

Gln Ile Ala Ser Leu Ala Ile Arg Ser Gly Asn Gly Leu Leu Leu Lys

435 440 445

Gly Gly Lys Glu Ala Met Arg Ser Asn Ala Ile Leu His Lys Ile Ile

450 455 460

Thr Gly Ala Ile Pro Asp Val Val Gly Lys Lys Leu Ile Gly Leu Val

465 470 475 480

Thr Ser Lys Asp Glu Ile Ala Asp Leu Leu Met Leu Asp Asp Val Ile

485 490 495

Asp Leu Val Ile Pro Arg Gly Ser Lys Asn Leu Ile Ser Gln Ile Lys

500 505 510

Glu Ser Thr Lys Ile Pro Val Leu Gly His Ser Asp Gly Ile Cys His

515 520 525

Val Tyr Ile Asp Lys Ser Ala Asp Met Glu Met Ala Lys Arg Ile Val

530 535 540

Met Asp Ala Lys Val Asp Tyr Pro Ala Ala Cys Asn Ala Met Glu Thr

545 550 555 560

Leu Leu Val His Lys Asp Leu Asn Lys Ser Glu Gly Leu Asp Asp Leu

565 570 575

Leu Val Glu Leu Glu Lys Glu Gly Val Val Ile Tyr Gly Gly Pro Val

580 585 590

Ala His Asn Lys Leu Lys Val Pro Lys Val Asp Ser Phe His His Glu

595 600 605

Tyr Ser Ser Met Ala Cys Thr Leu Glu Phe Val Asp Asp Val Gln Ser

610 615 620

Ala Ile Asp His Ile Asn Arg Tyr Gly Ser Ala His Thr Asp Cys Ile

625 630 635 640

Ile Thr Thr Asp Glu Lys Ala Ala Glu Ala Phe Leu Gln Gln Val Asp

645 650 655

Ser Ala Ala Val Phe His Asn Ala Ser Thr Arg Phe Cys Asp Gly Thr

660 665 670

Arg Phe Gly Leu Gly Ala Glu Val Gly Ile Ser Thr Gly Arg Ile His

675 680 685

Ala Arg Gly Pro Val Gly Val Asp Gly Leu Leu Thr Thr Arg Cys Ile

690 695 700

Leu Arg Gly Ser Gly Gln Val Val Asn Gly Asp Lys Gly Val Val Tyr

705 710 715 720

Thr His Lys Asp Leu Pro Leu Glu

725

<210> 2

<211> 2650

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aagcagtggt atcaacgcag agtacggggg cgccgcagcg gcattccatc tctgaaactc 60

ggcgacggcc ctctgcacac ccctgccttg cctaaccgcc tcgcgctgcg ctcgcctcac 120

accgacggcg aagaggcaat gggaagggga gggatcgggg gacggcccgt ggcggtcgac 180

atggagaccg tcgactccac cagggcgttc gtcagggatg tcaagcgcat cgtcatcaag 240

gttggcacag ctgttgtcac tgggcaggat ggccgattgg cgatgggcag gctgggatct 300

ctatgtgaac agattaaaca actaaatttt caagggtatg aagtaattct ggtcacgtcg 360

ggagctgttg gtgtcgggag gcagaggctc caataccgca agctgatcca cagcagcttc 420

gctgatctgc agaacccgca gatgcacttt ggtggaaagg cctgtgctgc ggttggtcaa 480

agtggcttga tggctatcta tgacacacta tttagtcaac ttgatataac atcatctcaa 540

cttcttgtga ccgaccgtga ttttaaggat cctaattttg gggaccagct tcgtgagact 600

attttttcat tattagatct caaagtagta ccactattta atgagaatga cgccatcagc 660

tctaggagac aaccacatga ggatccatca ttctgggata acgacagttt ggcagctctt 720

ttggcggcag aacttgacgc ggatcttctt gtcattctta gcgatgtgga cggactctat 780

agtggtcctc caagtgatcc tcaatcaaag attatccaca catacattaa tgaaaaacat 840

gggaagctaa ttaatttcgg agaaaaatct agtgtcggga gagggggaat ggaagctaaa 900

gttgcggctg ctgccaatgc tgcatcaaaa ggcgtacctg tcgtgattgc aagtggtttt 960

gaaccagaga gaattattaa agttctcaaa ggagagaaaa taggtacgct attccacaat 1020

gcagcgaatt cgtgggaagc ttccaaggaa gctactgccc gagagatggc ggtcacagcc 1080

agggattgtt caaggcgttt acagaagttg tcatcagatg aacgtaagaa gattttgctg 1140

gatattgctg atgctttaga agcaaatgag gatctaatta gatctgaaaa tgaaatggat 1200

gttgaggcgg cacaagatgc aggttatgaa aaatctttgg ttgctagaat gagactaaag 1260

caaggaaaga taacaaacct tgcgagatcc attcgtgcca ttgctgacat ggaggaccct 1320

atcgcccaca cgttgaaaag aacagaggtt gctaaagatc tggtttttga gaaaacatat 1380

tgcccattgg gcgttctcct gattattttt gagtctcgtc cagatgcatt ggtgcagatc 1440

gcttcattgg caatacgtag tggaaatggg cttcttttga aaggaggaaa agaagctatg 1500

agatcgaacg caattttaca taagatcata actggcgcga ttccagatgt tgttggcaaa 1560

aagctaattg gccttgtaac tagcaaagat gaaatagctg atttgctaat gcttgatgat 1620

gtgatcgatc ttgttattcc aagaggcagt aagaatctta tttctcaaat caaagaatca 1680

accaagattc cagttctagg tcactccgat ggcatctgcc atgtttatat tgataaatca 1740

gctgacatgg aaatggcaaa gcgtatagta atggacgcca aggttgatta tccagcagct 1800

tgtaacgcaa tggaaactct acttgtccat aaagatctaa acaagagtga gggccttgat 1860

gatctattgg tggaacttga aaaggaaggg gtagtgattt atggtggacc tgtggcacac 1920

aacaaattga aagtaccaaa ggttgattca tttcatcatg aatatagttc aatggcttgc 1980

acccttgagt ttgttgatga tgtacaatca gcgatagatc atataaatcg ttatggaagt 2040

gcccatacgg attgtattat tacaactgat gaaaaagctg cagaggcctt tttgcagcaa 2100

gttgatagtg ctgctgtgtt tcataatgca agcacaaggt tctgtgatgg aactcgcttt 2160

ggtctaggtg cagaggttgg cataagtaca gggcgcatac atgctcgtgg acctgtaggt 2220

gttgacgggc ttcttacaac acgatgcatt ctacgtggga gtggtcaagt agtgaacggt 2280

gacaagggag tggtatacac ccacaaggat cttcctttgg aatgaggcta caatatgagg 2340

caaggtattt cacttctatg ctgtgcgacg aaggctgcac ctaagtgcca ttagaatctg 2400

gaaaaaggag gtgaccgaat gatatatgtt gttcagtgat gctcctattt ttgtacgaca 2460

atgattatta ttcggagtac aaggctacca gtgagttgta attgtaaaca gagcgcttct 2520

ttcgctacat ctgtactaag aggcgagaga gatgtgcggt gtgtgaagta tgagtctgtt 2580

ttaagcgtat gataaaaagt actagtactg tgataatcaa attatgatga gctcctgaaa 2640

aaaaaaaaaa 2650

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggcggtca cagccagg 18

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcattccaaa ggaagatcct tgtgg 25

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgggaaggg gagggatcgg 20

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcattccaaa ggaagatcct tgtgg 25

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cactcccttg tcaccgttca ct 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggcggtcaca gccagggatt 20

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctaatacgac tcactatagg gc 22

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggatgttg aggcggcaca ag 22

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcagcaatgg cacgaatgga tctc 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ccctacccca ggatccactt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggccttctcg gcagatatca 20

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttcatttgga gagaacacgg gggac 25

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caagaccggc aacaggattc aatc 24

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgttacaagc tgctggat 18

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgcatcttgt gccgcctc 18

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tagagctgat ggcgtcat 18

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

acggtgtcgt ccatcacagt ttgcc 25

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ttccggaagt gcttgacatt gggga 25

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atggatgttg aggcggcaca ag 22

<210> 22

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tcagcaatgg cacgaatgga tctc 24

<210> 23

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gcatgaagat caaggtggtt gcac 24

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atggacctga ctcatcgtac tcact 25

Claims

1. The spartina alterniflora salt-tolerant protein P5CS2 is characterized in that the amino acid sequence of the spartina alterniflora salt-tolerant protein P5CS2 is shown as SEQ ID No. 1.

2. The gene encoding spartina alterniflora salt-tolerant protein P5CS2 of claim 1SaP5CS2Characterized in that the coding geneSaP5CS2Has one of the following nucleotide sequences:

(1) a nucleotide sequence shown as SEQ ID NO. 2;

(2) the nucleotide sequence which is the same as the nucleotide sequence from 139 th position to 2325 th position at the 5' end of the nucleotide sequence shown in SEQ ID NO.2 and can encode the amino acid sequence of spartina alterniflora salt-tolerant protein P5CS 2.

3. The gene encoding spartina alterniflora salt-tolerant protein P5CS2 of claim 2SaP5CS2The primer of (1), wherein the nucleotide sequence of the primer is shown as SEQ ID NO.5 and SEQ ID NO. 6.

4. The salt-tolerant protein P5CS2 of spartina alterniflora as claimed in claim 2SaP5CS2The recombinant expression vector of (1).

5. An engineered strain comprising the recombinant expression vector of claim 4.

6. Use of the spartina alterniflora salt-tolerant protein P5CS2 of claim 1 for the preparation of a formulation for increasing the salt tolerance of plants.

7. The gene encoding spartina alterniflora salt-tolerant protein P5CS2 of claim 2SaP5CS2The application of the strain in cultivating or screening salt-tolerant plants.

8. The use of claim 7, wherein the encoded gene is to be includedSaP5CS2The recombinant expression vector is transferred into a target plant to obtain a transgenic plant with salt tolerance obviously higher than that of a wild type plant, and the proline amount of the transgenic plant is increased under the condition of salt stress so as to resist the salinity stress.

9. Use according to claim 7, wherein the plant comprises Arabidopsis thaliana.