CN114487419A

CN114487419A - Application of TJP3 gene coding protein in preparation of ovarian cancer detection reagent

Info

Publication number: CN114487419A
Application number: CN202210166408.0A
Authority: CN
Inventors: 罗敏; 卿晨; 张磊; 张玲; 周宏宇; 周轶平
Original assignee: Kunming Medical University
Current assignee: Kunming Medical University
Priority date: 2022-02-23
Filing date: 2022-02-23
Publication date: 2022-05-13

Abstract

The invention belongs to the technical field of biology, and discloses application of a TJP3 gene coding protein in preparation of an ovarian cancer detection reagent, wherein the effect of the TJP3 gene coding protein in the occurrence and development of ovarian cancer is verified through analysis, so that a good foundation can be laid for further deep exploration of TJP3 in the aspects of clinical diagnosis, typing, treatment, prognosis and the like of ovarian cancer. The experimental result of the invention shows that TJP3 is highly expressed in ovarian cancer patients, and plays an important role in ovarian cancer cell proliferation, apoptosis and EMT occurrence. The polypeptide has the potential and new biomarker of ovarian cancer, and the invention is expected to provide new and valuable basis and reference for the diagnosis and treatment of ovarian cancer. Meanwhile, the experimental result of the invention confirms the biological functions of TJP3 in promoting the proliferation activity and cell migration of ovarian cancer cells and cell invasion and inhibiting apoptosis by high expression, and shows that TJP3 has definite biological functions in the occurrence and development of ovarian cancer cells.

Description

Application of TJP3 gene coding protein in preparation of ovarian cancer detection reagent

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of a TJP3 gene encoding protein in preparation of an ovarian cancer detection reagent.

Background

At present, ovarian cancer is one of three malignant tumors of a female reproductive system, high mortality and low cure rate of ovarian cancer are a great problem in ovarian cancer treatment, and because the early stage of ovarian cancer has no clinical expression and is mostly in the late stage, a large number of patients cannot be treated in time. In addition, most of the existing therapeutic drugs lack targeting, which often results in poor therapeutic effect. Therefore, the occurrence and development mechanisms of ovarian cancer are deeply explored, a new action target capable of effectively intervening is searched, and basis and guidance can be provided for early diagnosis and treatment of ovarian cancer.

Although it is known that the development of ovarian carcinogenesis involves the activation of oncogenes and the inactivation of oncogenes, and that the activation of oncogenes and the inactivation of oncogenes makes it easier for ovarian cancer cells to evade the immune system or the action of anticancer drugs. However, in clinical practice, the role of existing molecular markers in evaluating ovarian cancer occurrence, progression and prognosis is still very limited. Therefore, the influence factors and related mechanisms of malignant biological behaviors of ovarian cancer are deeply researched, and new key genes and regulation pathways in the occurrence and development process of ovarian cancer are searched, so that the important effects on improving the treatment effect and the prognosis are achieved.

Tight-connected proteins (TJPs) are the first proven tight-connected attachment proteins belonging to the MAGUKs family and comprise three isoforms, i.e., TJP1, TJP2, and TJP 3. Studies have shown that TJP1 and TJP2 are critical to tightly connecting the assembly of components and the permeability of the structure, respectively, without TJP1 and TJP2, cells cannot form TJs. TJP1 and TJP2 are expressed in both epithelium and endothelium, whereas TJP3 is expressed only in epithelium. Despite serial studies on TJPs, an understanding of their function in vivo, particularly that of TJP3, remains fragmentary. The TJP3 knockout mouse model is reported to be constructed, the survival of the mouse is not obviously influenced and is fertile in a short term, and no obvious abnormality is found in strict phenotypic analysis, which shows that the TJP3 has no obvious effect in normal mice, is not lethal without TJP1 and TJP2, but still has the research value due to the particularity of the TJP3 knockout mouse model in tissue localization.

With the gradual completion of the human genome project, genetic studies have progressed to the functional genomics stage. This project is aimed at studying gene function, regulation of expression of the genome and function of protein products. The gene function is realized in a multilayer complex organism consisting of cells, so that the establishment of a cell model for researching the gene function is a basic idea. Currently, the study of the function of a protein product encoded by a gene at the cellular level is usually to detect the change of cell behavior such as proliferation, apoptosis, migration, invasion and the like of a cell or the change of drug sensitivity, hypoxia tolerance and the like of the cell by knocking down or over-expressing a target gene through a gene editing technology, so as to determine the function and action of the gene in the cell or an organism.

Transcriptome sequencing analysis was performed on 31 tumor and normal ovarian tissues of epithelial ovarian cancer patients by using Next Generation Sequencing (NGS) method to find the differentially expressed gene TJP 3. On the basis, the expression conditions of TJP3 in the mRNA and protein levels of a normal ovarian epithelial cell strain and an epithelial ovarian cancer cell strain are further verified through molecular biology experiments, so that the reliability of early-stage high-throughput data is proved. And a TJP3 overexpression and knock-down type ovarian cancer cell model is constructed, and the biological functions of TJP3 high expression, promotion of ovarian cancer cell proliferation activity, cell migration and cell invasion and inhibition of cell apoptosis are determined through a series of cell proliferation activity, cell apoptosis, cell migration and cell invasion experiments.

Common tumor markers currently used clinically for early detection of ovarian cancer include CA125 and human epididymis protein (HE 4).

CA125 was first discovered from Bast in epithelial ovarian cancer, is one of the most widely studied serum tumor markers at present, is the most common index for diagnosing epithelial ovarian tumor, and has low serum content in healthy people. At present, the clinical use of the serum CA125 level of more than 35U/ml is taken as the critical value for judging malignant ovarian tumor. In most epithelial ovarian cancers, CA125 is present in the serum in a detectable amount. However, the sensitivity to early ovarian cancer is low, and only 30% of patients with stage I ovarian cancer are raised. Moreover, the increase of CA125 can be detected in other female inflammatory diseases, such as chocolate ovarian cyst, follicular cyst, pregnancy, menstruation and the like, so that the accurate diagnosis of ovarian cancer is influenced, and the specificity and the sensitivity of the detection are not ideal.

HE4 is an acidic inhibitory protein, which is mainly expressed and secreted in the genital tract epithelium of normal women, and is not expressed in normal ovarian tissues, so HE4 can hardly be detected in normal human bodies, but HE4 is highly expressed in OC patients, and has the characteristic of differential expression in different types of OC patients, wherein 100% of the protein is expressed in endometrioid ovarian cancer, 93% of the protein is expressed in serous ovarian cancer, and only 50% of the protein is expressed in clear cell ovarian cancer. The existing clinical research shows that HE4 has lower sensitivity in detecting ovarian cancer than CA125, but has higher specificity than CA125, so that the two indexes are combined clinically to serve as screening indexes for early diagnosis of ovarian cancer.

Various tumor markers applied clinically at present have advantages and disadvantages, and the accuracy of OC diagnosis is gradually improved and the sensitivity of early diagnosis is improved to a certain extent by the combined application of multiple tumor markers. However, the limitations of the existing tumor markers are reflected in the application process, for example, some normal cells also produce tumor markers, and diseases or stress states other than cancer may also cause the level of the tumor markers to be significantly increased; the serum level stability of the tumor marker is poor and can change along with time, so that a consistent result is difficult to obtain; some tumors do not produce tumor markers detectable in the blood.

Through the above analysis, the problems and defects of the prior art are as follows:

(1) the existing ovarian cancer treatment medicines are poor in treatment effect due to the fact that most of the existing ovarian cancer treatment medicines lack targeting; meanwhile, molecular markers have limited effects on the evaluation of the occurrence, development and prognosis of ovarian cancer.

(2) The specificity and sensitivity of the existing tumor marker CA125 to early ovarian cancer are low; meanwhile, the sensitivity of detecting ovarian cancer by human epididymis protein HE4 is lower than that of CA 125.

(3) The limitation of the existing tumor marker is reflected in the application process, for example, some normal cells also generate tumor markers, and diseases or stress states except cancer can also obviously increase the level of the tumor markers; the serum level stability of the tumor marker is poor and can change along with time, so that a consistent result is difficult to obtain; some tumors do not produce tumor markers detectable in the blood.

The difficulty in solving the above problems and defects is:

because no safe and effective commercial detection means exists, the prevention and control of ovarian cancer mainly depends on measures such as regular health examination, conventional oncogene marker detection and the like. The difficulty of developing an ovarian cancer early prevention and treatment and detection kit is that research on the occurrence mechanism of ovarian cancer diseases is incomplete. Ovarian cancer is complicated in classification, complex in involved cell biological characteristics, numerous in oncogenes and cancer suppressor genes for regulating and controlling the occurrence and development of ovarian cancer, and limited in mechanism research; the related genome is huge, more than half of genes have unknown functions, and the research on the functions of the known genes is also very weak.

The significance of solving the problems and the defects is as follows:

more and more researches show that tumors are essentially gene-related diseases, and a plurality of genes participate in the process of occurrence and development of ovarian cancer, so that the research on the malignant biological related gene function of ovarian cancer cells has great significance for exploring the occurrence of the ovarian cancer, controlling the proliferation of tumor cells and improving the accuracy of early diagnosis of the ovarian cancer.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides an application of a protein coded by TJP3 gene in preparing an ovarian cancer detection reagent.

The invention is realized by the application of a protein coded by TJP3 gene in preparing an ovarian cancer detection preparation.

The invention also aims to provide an ovarian cancer detection kit which comprises a protein coded by the TJP3 gene.

Another object of the present invention is to provide a method for determining the function of an encoded protein, comprising the steps of:

detecting the expression level of TJP3 in normal ovarian epithelial cells and epithelial ovarian cancer cell strains;

constructing a knockdown and overexpression stable transgenic cell line;

step three, detecting the influence of TJP3 on the proliferation activity of the ovarian cancer Caov-3 cells;

step four, detecting the influence of TJP3 on migration and invasion of ovarian cancer Caov-3 cells;

step five, detecting the influence of TJP3 on the expression of the EMT-related protein of the ovarian cancer Caov-3 cells;

and step six, detecting the influence of TJP3 on apoptosis of the ovarian cancer Caov-3 cells.

Further, the method for detecting the expression level of TJP3 in the normal ovarian epithelial cells and epithelial ovarian cancer cell lines in the first step comprises the following steps:

1 normal ovarian epithelial cell strain, 4 epithelial ovarian cancer cell strains and 1 fibroblast ovarian cancer cell strain are respectively selected to carry out the detection of the TJP3 expression level.

Further, the method for constructing a knockdown and overexpression stable cell line in the second step comprises the following steps:

the knock-down vectors GV248 and GV248-TJP3 and the over-expression vectors GV365 and GV365-TJP3 are transferred into Caov-3 cells and respectively form two experimental groups with wild cells; the transfected cells are continuously screened for 3 weeks by puromycin selection pressure, whether the obtained stable transfected cell strain stably expresses TJP3 or not is verified from mRNA level and protein level, and then the influence of TJP3 on the biological functions of Caov-3 cell proliferation and apoptosis series related to tumorigenesis and development is analyzed.

Further, the experimental groups include NC, Ctrl-si, TJP3-si knock-down experimental group and NC, Ctrl-EO, TJP3-EO overexpression experimental group.

Further, the method for detecting the effect of TJP3 on the proliferation activity of the ovarian cancer Caov-3 cells in the third step comprises the following steps: MTT method is adopted to detect cell activity, and whether TJP3 has influence on Caov-3 cell proliferation is analyzed.

Further, the method for detecting the effect of TJP3 on migration and invasion of ovarian cancer Caov-3 cells in step four comprises the following steps: the effect of TJP3 knockdown and overexpression on Caov-3 cell migration and invasiveness was analyzed using a cell scratch assay and a transwell cell invasion assay, respectively.

Further, the method for detecting the influence of TJP3 on the EMT-related protein expression of the ovarian cancer Caov-3 cells in the step five comprises the following steps: western Blot was used to examine the effect of TJP3 on EMT-associated protein expression in Caov-3 cells of ovarian cancer.

Further, the method for detecting the effect of TJP3 on ovarian cancer Caov-3 apoptosis in the sixth step comprises the following steps: the influence of TJP3 on apoptosis was detected by Annexin V-FITC/PI double staining apoptosis assay.

By combining all the technical schemes, the invention has the advantages and positive effects that: so far, the related literature of TJP3 in the field of gynecological tumors has been reported to a small extent, and no report related to ovarian cancer is found. The invention verifies the effect of the TJP3 in the occurrence and development of ovarian cancer through analysis, and can lay a good foundation for further deep exploration of the TJP3 in the aspects of clinical diagnosis, typing, treatment, prognosis and the like of ovarian cancer.

The experimental result of the invention shows that TJP3 is highly expressed in ovarian cancer patients, plays an important role in ovarian cancer cell proliferation, apoptosis and EMT generation, and can be a potential and new biomarker of ovarian cancer. The invention is expected to provide new and valuable basis and reference for the diagnosis and treatment of ovarian cancer.

The experimental result of the invention confirms the biological functions of TJP3 in promoting the proliferation activity, cell migration and cell invasion of ovarian cancer cells and inhibiting apoptosis, and shows that TJP3 has definite biological functions in the occurrence and development of ovarian cancer cells.

The existing tumor markers reflect more limitations in the application process, for example, some normal cells also generate tumor markers, and diseases or stress states except cancer can also obviously increase the level of the tumor markers; the serum level stability of the tumor marker is poor, and the tumor marker can change along with time, so that a consistent result is difficult to obtain; some tumors do not produce tumor markers detectable in the blood. The new generation sequencing technology provides a new technical means for researching gene functions and provides reliable clues for searching tumor candidate target molecules and biomarkers, TJP3 functional research covers detection data of clinical tissue samples and in-vitro cell level verification, experimental data are reliable, and result analysis is reasonable.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a flow chart of a method for determining the function of an encoded protein according to an embodiment of the present invention.

FIG. 2 is a schematic diagram showing the expression of mRNA and protein of TJP3 in normal ovarian epithelium and ovarian cancer cell lines.

FIG. 3 is a schematic diagram of the expression of TJP3 mRNA and protein in the knockdown and over-expressed Caov-3 cell line provided by the example of the present invention.

FIG. 4 is a schematic diagram of MTT method provided in the embodiments of the present invention for detecting the proliferation capacity of TJP3 knockdown and over-expression group Caov-3 cells in vitro.

FIG. 5 is a graphical representation of the effect of TJP3 knockdown and overexpression on Caov-3 cell migration and invasion capacity as provided by an example of the present invention.

Fig. 5A to 5B are schematic diagrams illustrating the results of the cell scratch test provided in the embodiment of the present invention.

Fig. 5C to 5D are schematic diagrams showing the results of the Transwell cell invasion test provided in the example of the present invention.

FIG. 6 is a schematic diagram of the effect of TJP3 knockdown and overexpression on the expression of EMT-associated proteins in Caov-3 cells, which is provided by the examples of the present invention.

FIG. 7 is a schematic diagram of the effect of Annexin V-FITC/PI double-staining apoptosis detection TJP3 on Caov-3 apoptosis provided by the embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

In order to solve the problems in the prior art, the invention provides an application of a protein coded by TJP3 gene in preparing an ovarian cancer detection reagent, and the invention is described in detail below with reference to the accompanying drawings.

The invention provides an application of a protein coded by TJP3 gene in preparation of an ovarian cancer detection preparation.

Another object of the present invention is to provide an ovarian cancer detection kit comprising a protein encoded by the TJP3 gene

As shown in fig. 1, the method for determining the function of the encoded protein provided by the embodiment of the present invention comprises the following steps:

s101, detecting the expression level of TJP3 in normal ovarian epithelial cells and epithelial ovarian cancer cell lines;

s102, constructing a knock-down and overexpression stable transgenic cell line;

s103, detecting the influence of TJP3 on the proliferation activity of the ovarian cancer Caov-3 cells;

s104, detecting the influence of TJP3 on migration and invasion of ovarian cancer Caov-3 cells;

s105, detecting the influence of TJP3 on the expression of the EMT-related protein of the ovarian cancer Caov-3 cells;

s106, detecting the influence of TJP3 on apoptosis of the ovarian cancer Caov-3 cells.

The technical solution of the present invention is further described below with reference to specific examples.

The embodiment is as follows: biological effect of protein encoded by TJP3 gene in development of ovarian cancer

1 materials of the experiment

1.1 cell lines

1.2TJP3-Si and JPS3-OE and carrier information

1) Three TJP3 sh-RNA sequences were designed by a Predesigned siRNA designer on the sigma line based on the humanized TJP3 mRNA sequence (NM-001267560.2) in the Gene Bank database, and the sequence information is detailed in the following table:

the three TJP3 sh-RNA sequences include: TJP3-shRNA-1, TJP3-shRNA-2 and TJP 3-shRNA-3;

the sequence of TJP3-shRNA-1 is SEQ ID NO: 1: ggtgaacattcctcgagga, respectively;

the sequence of TJP3-shRNA-2 is SEQ ID NO: 2: gcagaagttctcgagaac, respectively;

the sequence of TJP3-shRNA-3 is SEQ ID NO: 3: gctactcgagtagcttccct are provided.

The sequence of TJP3-control is SEQ ID NO: 4: ttctccgaacgtgtcacgt are provided.

The method comprises the following specific steps:

NO.	ccession	Target Seq	GC％
				TJP3-shRNA-1	NM_001267560.2	ggtgaacattcctcgagga	52.6％
TJP3-shRNA-2	NM_001267560.2	gcagaagttctcgagaac	50％
				TJP3-shRNA-3	NM_001267560.2	gctactcgagtagcttccct	55％
TJP3-control		ttctccgaacgtgtcacgt

2) the over-expressed sequence was synthesized using a reverse transcription cDNA template.

3) The sequence information is submitted to a Kjeldahl gene to be a synthetic lentivirus knock-down and over-expression vector.

Knock-down vector GV248, in the order of elements: hU 6-MCS-Ubiquitin-EGFP-IRES-puromycin.

The overexpression vector GV365, the sequence of elements is: Ubi-MCS-3 FLAG-CMV-EGFP;

2 method of experiment

2.1 cell culture

The cells used in the experiment were cultured in DMEM or 1640 medium containing 10% newborn bovine serum, 100. mu.g/mL streptomycin and 100U/mL penicillin, and placed at 37 ℃ in a 5% CO atmosphere₂Culturing in an incubator.

(1) Cell recovery

8mL of DMEM medium containing 10% fetal bovine serum was placed in a 10mL centrifuge tube for use. The cells to be revived were taken out of the liquid nitrogen and placed in a thermostatic water bath at 42 ℃ for rapid thawing (complete within 1 min). The thawed cells were transferred to a centrifuge tube containing medium, centrifuged at 800rpm for 5min, and the supernatant discarded. 2mL of 20% fetal calf blood was addedClear DMEM cell culture, resuspend cells, and 5% CO at 37 deg.C₂Culturing in an incubator. After the cells were fully attached (about 24h), they were replaced with DMEM medium containing 10% fetal bovine serum.

(2) Passage of cells

The medium in the cell culture flask was discarded and the cell surface was washed 1-2 times with D-Hanks. Adding about 1mL of 0.25% trypsin, observing while digesting, after the cell morphology is changed, quickly removing the trypsin, adding 2mL of DMEM culture medium containing 10% fetal calf serum, blowing adherent cells with a blowing tube to peel off, placing the cells at 37 ℃, and adding 5% CO₂Passaging in incubator at appropriate cell density.

(3) Cell cryopreservation

Discarding culture solution in recovered well-grown cultured cells, flushing culture medium on the cell surface with D-Hanks for 1-2 times, adding 0.25% trypsin to digest cells, observing cell morphology under a mirror, discarding cell digestion solution after cell morphology is changed, and stopping digestion with a small amount of DMEM culture solution containing 10% fetal calf serum. Centrifuge at 800rpm for 5min, and discard the supernatant. Adding about 1mL of the cryopreservation solution, blowing to resuspend the cells, transferring to a cryopreservation tube, sequentially placing at 4 ℃ for 15min and at-20 ℃ for 30min, finally placing in a freezing box of a refrigerator at-80 ℃, taking out from the freezing box the next day, and placing in liquid nitrogen.

2.2 transfection of cells

2.2.1 calcium phosphate transfection method

Cells were transfected according to the instructions of the Biyuntian calcium phosphate method cell transfection kit.

1) 24h before transfection, cells were plated at 1X 10⁵The density per well was seeded in 24-well plates to achieve a cell density of around 70% the next day.

2) 0.5-1.5. mu.g of plasmid DNA to be transfected is added into 25. mu.L of calcium chloride solution and mixed well.

3) Slowly adding the DNA-calcium chloride mixed solution into 25 mu LBBS solution, fully and evenly blowing, and incubating for 20-30min at room temperature.

4) And uniformly dripping 50 mu L of the DAN-calcium chloride-BBS mixed solution into a 24-pore plate, continuously culturing in a cell incubator for 4-6h, discarding the culture solution containing the transfection reagent, adding 2mL of fresh DMEM culture medium containing 10% fetal calf serum, and continuously culturing for 48h to perform related detection.

2.2.2. Lentiviral transfection method

Cells were transfected according to the instructions of the cell transfection kit for the Gecky lentivirus transfection method.

1) 18-24h before transfection, ovarian cancer cells are treated at 1X 10⁵The cells were seeded in 24-well plates at a cell density of about 70% for lentivirus transfection.

2) Under conditions ensuring cell adherence, the original medium was replaced with 2ml of fresh medium containing 6. mu.g/ml polybrene, and 1X 10 was added⁸U viral suspension was incubated at 37 ℃.

3) The virus-containing medium was replaced with fresh medium after 6-12 h.

4) And after the culture is continued for 48 hours, the relevant treatment or detection can be carried out.

2.2.3. Establishment of stably transfected cell lines

1) Cells were cultured in DMEM medium containing 10% fetal bovine serum at 37 ℃ with 5% CO₂Culturing under the conditions of (1).

2) Cells were plated at 5X 10 h before transfection⁵The density of the cells per well was inoculated in 6-well plates, and 2mL of DMEM medium containing 10% fetal bovine serum was added to each well, so that the cell density reached about 70% during transfection.

3) Ctrol-si, TJP3-si, Ctrol-OE and TJP3-OE were transferred into cells respectively according to the instructions of the cell transfection kit of the Kjeldahl lentivirus transfection method. After 48h of transfection, the corresponding stably transfected cell lines were obtained by screening with 2. mu.g/ml puromycin/pressure for about 3 weeks.

2.3 Total RNA extraction from cells

1) Cells were collected by centrifugation.

2) Cells were disrupted and 0.75mL Trizol reagent per 0.25mL sample was pipetted for lysis.

3) Centrifuging at 12000 Xg for 5min at 4-10 deg.C, collecting clarified supernatant into new centrifuge tube, and incubating for 5min to completely dissociate nucleoprotein complex.

4) 0.2mL of chloroform was added per 1mL of Trizol reagent and incubated for 2-3 minutes.

5) Centrifuge at 12000 Xg for 15min at 4 ℃. After centrifugation, the mixture is divided into three layers, wherein the lower layer is a red phenol-chloroform layer, the middle layer is an organic phase containing impurities such as protein, and the upper layer is a colorless aqueous phase (containing RNA).

6) The aqueous phase containing the RNA was transferred to a fresh centrifuge tube.

7) And (3) RNA precipitation: a. adding 5-10 μ g of RNase-free glycogen as a carrier into the aqueous phase to allow RNA and glycogen to co-precipitate; b. adding 0.5mL of isopropanol into every 1mL of Trizol; c. incubating for 10 min; d.4 ℃, 12000 Xg for 15min, the total RNA is precipitated at the bottom of the centrifuge tube, white gelatinous precipitate is obtained, and the supernatant is discarded.

8) And (3) RNA washing: a. adding 1mL of 75% ethanol into 1mL of Trizol; b. vortexed briefly, then centrifuged at 7500 Xg for 5min at 4 ℃ and the supernatant discarded; c. precipitating RNA for 5-10min under vacuum or air drying;

9) RNA dissolution: adding 20-50 μ L RNase free water into the RNA precipitate, and gently blowing, beating and dissolving; can be placed in water bath or heating module of 55-60 deg.C for incubation for 10-15min to accelerate dissolution.

2.4 RNA quality testing

And (3) measuring the RNA quality by a spectrophotometry method, measuring the total RNA content by absorbance at 260nm, and determining the RNA purity by absorbance at 280 nm.

Measurement and calculation: diluting RNA to be detected with RNase free water, and respectively determining absorbances at 260nm and 280 nm; RNA concentration was calculated using the formula (a260 × dilution × 40 ═ X μ g RNA/mL);

260/A280 ≈ 2, the RNA quality is higher.

1.0% agarose gel electrophoresis was used to see if RNA was degraded or contaminated.

2.5 Synthesis of cDNA by reverse transcription

Using SuperScript^TM III RT/Platinum^TMThe kit performs the experiment, and the specific steps are as follows.

1) Reagents were added to the PCR tubes (25. mu.l total) in the following order:

reagent	Volume (μ l)
		2×Reaction Mix	12.5
Total RNA	1
		Sense primer	1
Anti-sense primer	1
		SuperScript^TM III RT/Platinum^TM Taq Mix	1
DEPC water	8.5

2) Mix all reagents gently.

3) Setting a reaction program:

4) and (4) processing the mixture on a machine for reaction.

2.6PCR reaction

1) PCR reaction primers:

specific primers were designed using Primer Premier 6 based on the sequence of TJP3 in Genebank databases, and the Primer sequences were as follows:

TJP3 primer is shown as SEQ ID NO: and 5, as follows:

TJP 3-upstream primer 5'-aaactggcttctcgcaacac-3'

TJP 3-downstream primer 5'-ccttctacatccgcactcact-3'

GAPDH as an internal control, the primer sequences were as follows:

GAPDH primers are shown in SEQ ID NO: 6, showing:

GAPDH-upstream primer 5'-gacctgacctgccgtctag-3'

GAPDH-downstream primer 5'-gacctgacctgccgtctag-3'

The primer is synthesized by Huada gene.

2) According to the following reaction system, reagents are sequentially added into a 200-mu-l PCR tube;

3) pre-denaturation at 95 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ and extension for 1min for 40 cycles, setting the temperature of a dissolution curve to be 60-95 ℃, setting reaction conditions, and detecting in an ABI7500 real-time fluorescence quantitative PCR instrument.

2.7 Total protein extraction

1) The cells of each experimental group were inoculated in a 6-well plate, after the cell density reached 90%, the culture solution was aspirated off, the cells were washed twice with PBS, and the cells were collected by trypsinization.

2) Centrifuge at 5000rpm for 5min, and discard the supernatant.

3) Adding appropriate amount of RIPA lysate into the precipitate, placing in ice box, and vigorously vortexing for 20s every 5min for 30 min.

4) Low temperature centrifugation at 12,000rpm for 10 min.

5) The supernatant was collected into a new centrifuge tube.

6) Ready for quantitative detection.

2.8 BCA protein quantitation

1) Drawing a standard curve: an elisa plate was taken and reagents were added as per table 1:

TABLE 1 Standard Curve plotting sample addition Table

Number of holes	0	1	2	3	4	5	6	7
									Protein solution (μ l)	0	1	2	4	8	12	16	20
Deionized water (ul)	20	19	18	16	12	8	4	0
									Protein content (μ g)	0	0.5	1	2	4	6	8	10

2) According to the number of samples, a BCA working solution was prepared.

3) Add 200. mu.l BCA working solution to each well and mix well.

4) The microplate was left at 37 ℃ for 30 min.

5) The reaction mixture was cooled at room temperature, and the absorbance was measured at a wavelength of 562 nm.

6) Based on the absorbance of the sample measured and the plotted standard curve, the corresponding protein content (. mu.g) and concentration were calculated.

2.9 SDS-PAGE electrophoresis and Western Blot

1) Preparation of related reagents

(a) Acrylamide stock solution: acrylamide/methylene bisacrylamide (29.1g/0.9 g); separating gel buffer solution: 1.5M Tris-HCl, pH 8.8; concentrating the gel buffer: 0.5M Tris-HCl, pH 6.8; 10% (w/v) SDS; 10% (w/v) ammonium persulfate solution; polymerization agent TEMED.

(b)10 preparation of transfer buffer (500mL)

Tris(25mmol/L)	15.15g
		Glycine (192mmol/L)	72.1g
Sterile water	The volume is up to 500mL

Adding methanol at a ratio when the methanol content is 20%

(c) Preparation of 10X electrophoresis buffer

(d)20×TBST(pH 7.6，500mL)

Tris	24.2g
		NaCl	80g
1M HCl	Adjusting pH to 7.6
		Sterile water	The volume is up to 500mL

Tween 20 was added at a ratio of 1 XBTS/Tween 20 ═ 1000/1.

(e) Sealing solution: 5% skimmed milk powder was made up with TBST.

2) Preparation of SDS-PAGE gels

Separating glue (10%): 3.3ml of double distilled water, 2.7ml of 1.5M Tris, 2ml of 30% Acr/Bis, 0.09ml of 10% SDS, 0.06ml of 10% Aps and 6 mu L of TEMED; the total volume was 8.156 ml.

② concentrating the glue (5%): 2.3ml of double distilled water, 1ml of 1.0M Tris, 0.67ml of 30% Acr/Bis, 0.04ml of 10% SDS, 0.02ml of 10% Aps and 8 mu L of TEMED; the total volume was 40.038 ml.

3) SDS-PAGE electrophoresis

Firstly, preparing a protein loading buffer solution, and heating for 5min at 95 ℃;

adding 1 Xelectrophoresis buffer solution into the electrophoresis tank;

(iii) electrophoresis: electrophoresis is carried out at a constant voltage of 80V until bromophenol blue comes out of the bottom of the gel.

4) Protein transfer

Firstly, pretreating PVDF membrane methanol;

secondly, manufacturing a gel transfer printing accumulation layer and removing bubbles;

placing a transfer printing clamp in the direction of the positive and negative electrodes;

fourthly, 100V constant pressure is carried out for 2 hours;

5) immunoblotting

Firstly, taking out the hybrid membrane and rinsing for 3 times, 5min each time;

sealing the 5% skimmed milk powder closed liquid at a constant temperature for 1 h;

thirdly, adding a sealing liquid containing primary antibody according to the optimal color development condition of the preliminary experiment, and incubating overnight at 4 ℃;

washing the membrane with TBST, adding a second antibody diluent, and incubating for 1h at room temperature;

washing the membrane by TBST;

sixthly, temporarily preparing a chemiluminescence substrate, uniformly dripping the chemiluminescence substrate on the surface of the membrane, and reacting for 5min in a dark place;

seventhly, placing the film into a gel imaging system cartridge for imaging;

and recording the experimental result.

2.10 MTT assay for cell viability

1) Reagent

MTT was used at a concentration of 5 mg/mL. Weighing 0.5g of MTT, dissolving in 100mL of Phosphate Buffer Solution (PBS) or phenol red-free culture medium, and storing at 4 ℃ in a dark place. During formulation and storage, the container was wrapped with tinfoil paper to protect from light.

2) Experimental procedure

Subjecting each group of stably transformed cells to digestion with 0.25% pancreatin to obtain single cell suspension, counting, inoculating to 96-well culture plate, and inoculating 200 μ L (2 × 10 per well) per well³Individual cells), 3 replicate wells per group of stably transfected cells, and a total of 7 flat-bottom plates with 96 wells (marginal wells filled with sterile PBS) were seeded. While a zero setting well (blank medium) was set.

② placing 5 percent of CO at 37 DEG C₂Culturing in the incubator. The cells were incubated for 72 hours after attachment of the cells by observation under an inverted microscope, and the detection was performed every 12 hours for a total of 6 times.

③ Add 5mg/mL MTT 20. mu.L per well and incubate for 4h at 37 ℃.

Fourthly, terminating the culture and carefully absorbing the culture solution in the holes.

Fifthly, 100 mu L of dimethyl sulfoxide is added into each hole and placed on a shaking table to be shaken for 10 min.

Sixthly, detecting the OD value of the sample by using an enzyme-linked immunosorbent detector at the wavelength of 570 nm.

2.11 scratch test for detecting migration ability of ovarian cancer cells

1) The cells of each group were digested with 0.25% pancreatin and counted at 5X 10⁵Cells/well were plated on 6-well plates, with 3 multiple wells per group of cells.

2) 5% CO at 37 ℃₂The culture box is cultured overnight until the density of the cells reaches about 80%.

3) The cell culture plate was scratched about 5mm wide with a yellow tip, which was perpendicular to the cell plane and could not be tilted.

4) PBS wash 3 times, fully wash off the shed cells.

5) The cells were further cultured by adding fresh medium, and observed after further culturing for 24 hours, and photographed.

2.12Transwell test for detecting invasion ability of ovarian cancer cells

1) Transwell cell preparation

(ii) melting the Matrigel overnight at 4 ℃ and diluting the Matrigel with pre-cooled serum-free DMEM medium at a ratio of 1:3 to a final concentration of 1 mg/mL.

② the transwell chamber is placed on 24-well plate, and added with 100u L diluted Matrigel, 37 degrees C were incubated for 4h to make the glue completely solidified.

2) Seeding cell suspensions

Preparing cell suspension with DMEM medium containing 10% fetal calf serum, counting, adding 5 × 10⁴Cells/well and 600. mu.L of normal DMEM in the transwell-based lower chamber.

3) The cell culture plate was placed at 37 ℃ with 5% CO₂The cell incubator of (1) was cultured for 40 hours.

4) The transwell chamber was removed from the 24-well cell plate and washed 3 times with PBS for 3-5min each.

5) Cells were fixed with 4% paraformaldehyde for 30min and washed 3 times with PBS, 3-5min each.

6) Cells that failed to invade on the transwell chamber were carefully removed with a cotton swab.

7) 0.5% TritonX-100 was permeabilized for 5min, washed 3 times with PBS, 3-5min each time.

8) Staining cell nuclei with hematoxylin for 10min, and washing with water.

9) Observed under a microscope and photographed.

10) Statistics of results

2.13 Annexin V-FITC/PI double-staining apoptosis assay

After culturing each group of stable cells in a complete culture medium for 96 hours, detecting apoptosis by a flow cytometer according to the specification of an Annexin V-FITC/PI kit:

1) and each reagent is centrifuged before being opened, and liquid on the pipe wall and the pipe orifice is collected, so that loss is avoided.

2) The 4X Binding Buffer was diluted to 1X Binding Buffer with distilled water.

3) The collected cells were washed gently with PBS and shaken gently.

4) Resuspend cells with 195. mu.l of 1X Binding Buffer; the cell density is adjusted to 2 to 5X 10⁵ cells/ml。

5) Respectively adding 5 mu l of Annexin V-FITC and PI to 190 mu l of cell resuspension, keeping out of the sun, uniformly mixing, and incubating at room temperature for 10-15 min.

6) Cells were washed with 200. mu.l of 1X Binding Buffer.

7) Centrifuging the cells at 1000rpm for 2-5 min, and removing the supernatant.

8) Cells were resuspended in 190. mu.l of 1X Binding Buffer.

9) Add 10. mu.l Propidium lodide and mix well, react for 20min in dark place.

10) To prevent fluorescence decay, flow assays were performed within 4 hours.

11) Flow assay results apoptosis was analyzed using FlowJo _ V10 software.

2.14 statistical analysis

The results of the experiment were analyzed with statistical software SPSS 22.0. The experimental data of the measured data are expressed by mean plus or minus standard deviation, if the data accord with normal distribution and uniform variance, two groups are compared by adopting two independent samples for t test, and more than three groups are compared by adopting one-factor analysis of variance (ANOVA). If the data does not conform to normal distribution, non-parametric rank sum test is used. p <0.05 indicates that the difference is statistically significant. Data results were plotted using GraphPad Prism 7.

The research result of the invention shows that TJP3 is highly expressed in ovarian cancer patients and plays an important role in ovarian cancer cell proliferation, apoptosis and EMT occurrence. Can be a potential and novel biomarker of ovarian cancer. The invention is expected to provide new and valuable basis and reference for the diagnosis and treatment of ovarian cancer.

TJP3 expression level in normal ovarian epithelial cells and epithelial ovarian cancer cell lines

The invention selects 1 normal ovarian epithelial cell strain, 4 epithelial ovarian cancer cell strains and 1 fibroblast ovarian cancer cell strain for detection. The results of qRT-PCR and Western Blot detection show that TJP3 has certain expression in a normal ovarian epithelial cell strain IOSE80, the mRNA level and the protein level expression in an ovarian cancer cell strain are totally increased, and no obvious expression difference exists between an epithelial ovarian cancer cell strain and a fibroblast ovarian cancer cell strain. The expression level of the Caov-3 cell strain is higher than that of other ovarian cancer cell strains, and the growth speed of the cell strain is relatively high, so that the Caov-3 cell strain is selected as a research model of subsequent experiments.

FIG. 2 is a schematic representation of the mRNA and protein expression of TJP3 in normal ovarian epithelial and ovarian cancer cell lines; p value <0.05, p value < 0.01, p value < 0.001, compared to IOSE-80.

2. Construction of knockdown and overexpression Stable transgenic cell lines

In order to analyze the influence of TJP3 on a series of biological functions related to tumorigenesis and development of Caov-3 cells, such as proliferation and apoptosis, the invention transfers knockdown vectors GV248 and GV248-TJP3 and overexpression vectors GV365 and GV365-TJP3 into Caov-3 cells, and respectively forms two experimental groups with wild-type cells, namely NC, Ctrl-si and TJP3-si knockdown experimental group and NC, Ctrl-EO and TJP3-EO overexpression experimental group. The transfected cells were screened with puromycin (puromycin) selection pressure for 3 weeks and the resulting stably transfected cell lines were verified for stable expression of TJP3 from mRNA and protein levels.

The qRT-PCR and Wsetren Blot detection results show that compared with a normal Caov-3 cell group (NC), the knocking-down no-load control group (Ctrl-Si) and the overexpression no-load control group (Ctrl-OE) have no obvious change, which indicates that the transfer into the slow virus has no load and cannot influence the expression of TJP3 in cells; in contrast, expression levels of TJP3 mRNA and protein were significantly down-regulated on average in knockdown (TJP3-Si) Caov-3 cells (p value < 0.01); the expression level of TJP3 mRNA and protein in over-expression group (TJP3-OE) Caov-3 cells is obviously up-regulated (p value is less than 0.001). The above results demonstrate that a stable transgenic cell line with TJP3 knockdown and overexpression was successfully constructed in Caov-3 cells.

FIG. 3 is a schematic representation of the expression of TJP3 mRNA and protein in knockdown and over-expressed group of Caov-3 cell lines; in comparison with the NC, the data is compared,^nsp value > 0.05; p value < 0.01, p value < 0.001 compared to Ctrl-Si or Ctrl-OE.

Effect of TJP3 on the proliferation Activity of ovarian cancer Caov-3 cells

In order to analyze whether TJP3 has influence on the proliferation of Caov-3 cells, the invention adopts an MTT method to detect the cell viability. MTT detection results show that compared with a normal Caov-3 cell group (NC), the knocking-down no-load control group (Ctrl-Si) and the over-expression no-load control group (Ctrl-OE) hardly affect the cell proliferation activity within 72 hours of detection time; after TJP3(TJP3-Si) is knocked down, the cell proliferation curve becomes gentle in slope and the proliferation speed becomes slow; the growth rate of Caov-3 cells is increased after over-expression of TJP3(TJP 3-OE). This result indicates that the expression of TJP3 is positively correlated with the proliferation activity of Caov-3 cells.

FIG. 4 is a schematic diagram of MTT method for detecting the proliferation capacity of TJP3 knock-down and over-expression group Caov-3 cells in vitro; p value <0.05, p value < 0.01, compared to Ctrl-Si or Ctrl-OE.

Effect of TJP3 on migration and invasion of ovarian cancer Caov-3 cells

The invention respectively adopts a cell scratch experiment and a transwell cell invasion experiment to analyze the influence of TJP3 knock-down and over-expression on Caov-3 cell migration and invasion capacity.

FIG. 5 is a graphical representation of the effect of TJP3 knockdown and overexpression on Caov-3 cell migration and invasiveness; A-B are cell scratch test results; C-D is the result of a Transwell cell invasion test; in comparison with the NC, the data is compared,^nsp value > 0.05; p value < 0.1, p value <0.05 compared to Ctrl-Si or Ctrl-OE.

As shown in FIGS. 5A and 5B, the knockdown unloaded control (Ctrl-Si) and the over-expressed unloaded control (Ctrl-OE) hardly affect the migration ability of the cells compared with the normal Caov-3 cell group (NC); TJP3 overexpression promoted cell migration, while knockdown significantly reduced the ability of Caov-3 cells to migrate.

The detection result of the Transwell cell invasion experiment shows that compared with a normal Caov-3 cell group (NC), the knocking-down no-load control group (Ctrl-Si) and the over-expression no-load control group (Ctrl-OE) hardly affect the invasion capacity of the cells; the membrane penetration number of Caov-3 cells after knocking down TJP3(TJP3-Si) is obviously reduced, compared with Ctrl-Si group, the statistical difference is realized, the p value is more than 0.05, and the membrane penetration number of Caov-3 cells after over-expressing TJP3(TJP3-OE) is obviously improved. The result shows that the TJP3 can be reduced to reduce the invasive metastatic capacity of the cells, and the high expression can promote the invasive metastatic capacity of the cells.

Effect of TJP3 on EMT-associated protein expression in ovarian cancer Caov-3 cells

Epithelial-mesenchymal transition (EMT) is an important process during development, during which epithelial cells acquire mesenchymal fibroblast-like properties, exhibiting reduced intracellular adhesion and increased motility. This is a key feature of normal embryonic development that is exploited by malignant epithelial tumors for tumor dissemination. This tightly regulated process is associated with a large number of cellular and molecular activities. EMT is dependent on a decrease in the expression of cell adhesion molecules. Cadherins mediate calcium-dependent cell-cell adhesion and play a key role in normal tissue development. E-cadherin (E-cadherin) is considered an active inhibitory protein of the invasion and growth of many epithelial cancer cells. Recent studies have shown that, in addition to the loss of E-cadherin, the expression of N-cadherin (N-cadherin) in cancer cells is upregulated. Changes in cadherin expression are termed "cadherin turnover", and E-cadherin expression down-regulation and N-cadherin expression up-regulation are a set of markers for EMT. Snail is a zinc finger transcription factor that inhibits E-cadherin transcription in epithelial cells. In epithelial tumor cell lines, the mRNA levels of Snail and E-cadherin are largely inversely correlated. Vimentin (Vimentin) is the major type of cytoskeletal intermediate fibrils, and structural rearrangement of Vimentin fibrils occurs when EMT occurs, a process that is very important during cell adhesion and cell migration.

Western Blot detection results show that compared with a normal Caov-3 cell group (NC), the change of each protein in cells of a knock-down no-load control group (Ctrl-Si) and an overexpression no-load control group (Ctrl-OE) is small; compared with an over-expression no-load control group (Ctrl-OE), the expression level of Snail, N-cadherin and Vimentin is increased and the expression of E-cadherin protein is reduced in Caov-3 cells after over-expression of TJP3(TJP 3-OE). After TJP3(TJP3-Si) is knocked down, the tendency is opposite, the expression levels of Snail, N-cadherin and Vimentin are reduced to different degrees, and the expression level of E-cadherin protein is increased; the expression trend of the related protein of EMT is consistent with that reported, which shows that under the condition of a Caov-3 cell model, TJP3 expression is increased to inhibit the expression of E-cadherin in cells, and simultaneously, the expression of Snail, N-cadherin and Vimentin is promoted, so that the invasion and migration capability of the Caov-3 cells is enhanced.

FIG. 6 is a schematic illustration of the effect of TJP3 knockdown and overexpression on the expression of EMT-associated proteins in Caov-3 cells; p value <0.05, p value < 0.01, compared to Ctrl-Si or Ctrl-OE.

Effect of TJP3 on apoptosis of ovarian cancer Caov-3 cells

The influence of TJP3 on apoptosis was detected by Annexin V-FITC/PI double-staining apoptosis assay. The flow cytometry two-dimensional scatter plot shows that compared with the normal Caov-3 cell group (NC), the distribution of cells of a knock-down unloaded control group (Ctrl-Si) and an over-expression unloaded control group (Ctrl-OE) is approximately the same in 4 quadrants, the apoptosis percentage is between 6.45% and 6.7%, and the p value is larger than 0.05 without statistically significant difference; after TJP3(TJP3-Si) is knocked down, necrotic cells in a Q1 region, late apoptotic cells in a Q2 region and early apoptotic cells in a Q3 region of the Caov-3 cells are increased, compared with a Ctrl-Si group, the apoptosis rate is increased by 80.8%, the significant difference p value is less than 0.01, and the apoptosis of cells in a TJP3-OE group is reduced by 44%, and the p value is less than 0.01. Experimental results show that the TJP3 reduction can promote the apoptosis of Caov-3 cells, and the high expression can inhibit the apoptosis of the Caov-3 cells.

FIG. 7 is a schematic diagram of the effect of Annexin V-FITC/PI double-staining apoptosis assay TJP3 on Caov-3 apoptosis; in comparison with the NC, the data is compared,^nsp value > 0.05; p value <0.05, p value < 0.01, compared to Ctrl-Si or Ctrl-OE.

The results of the series of experiments prove that the TJP3 has the biological functions of promoting the proliferation activity, cell migration and cell invasion of ovarian cancer cells and inhibiting apoptosis by high expression. It shows that TJP3 has definite biological functions in the development of ovarian cancer cells.

So far, the related literature of TJP3 in the field of gynecological tumors has been reported to a small extent, and no report related to ovarian cancer is found. The subject group verifies the role of the compound in the occurrence and development of ovarian cancer through research, and possibly lays a good foundation for further deep research of TJP3 in the aspects of clinical diagnosis, typing, treatment, prognosis and the like of ovarian cancer.

The existing tumor markers reflect more limitations in the application process, for example, some normal cells also generate tumor markers, and diseases or stress states except cancer can also obviously increase the level of the tumor markers; the serum level stability of the tumor marker is poor and can change along with time, so that a consistent result is difficult to obtain; some tumors do not produce tumor markers detectable in the blood. The new generation sequencing technology provides a new technical means for researching gene functions and provides reliable clues for searching tumor candidate target molecules and biomarkers, TJP3 functional research covers detection data of clinical tissue samples and in-vitro cell level verification, experimental data are reliable, and result analysis is reasonable.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

<110> university of Kunming medical science

<120> application of protein coded by TJP3 gene in preparation of ovarian cancer detection reagent

<160>6

<210>1

<211> 19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ggtgaacattcctcgagga

<210>2

<211> 18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gcagaagttctcgagaac

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gctactcgagtagcttccct

<210>4

<211> 19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ttctccgaacgtgtcacgt

<210>5

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aaactggcttctcgcaacac

ccttctacatccgcactcac

<210>6

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gacctgacctgccgtctag

Claims

1. An application of TJP3 gene coding protein in preparing ovarian cancer detection preparations.

2. An ovarian cancer detection kit, characterized in that the ovarian cancer detection kit comprises the protein encoded by the TJP3 gene for use according to claim 1.

3. A method according to claim 2 for determining the function of the encoded protein, comprising:

constructing a knockdown and overexpression stable transgenic cell line;

step five, detecting the expression of the EMT related protein of the ovarian cancer Caov-3 cells by using TJP 3;

4. The method for determining the function of the encoded protein according to claim 3, wherein the method for detecting the expression level of TJP3 in normal ovarian epithelial cells and epithelial ovarian cancer cell lines in the first step comprises the following steps:

5. The method for determining the function of the encoded protein according to claim 3, wherein the method for constructing the knockdown and overexpression stable cell line in the second step comprises:

6. The method for determining the function of an encoded protein according to claim 5, wherein the experimental groups comprise NC, Ctrl-si, TJP3-si knock-down experimental group and NC, Ctrl-EO, TJP3-EO over-expression experimental group.

7. The method of determining the function of an encoded protein according to claim 3, wherein the method of detecting the effect of TJP3 on the proliferation activity of ovarian cancer Caov-3 cells in step three comprises: MTT method is adopted to detect cell activity, and whether TJP3 has influence on Caov-3 cell proliferation is analyzed.

8. The method of determining the function of the encoded protein according to claim 3, wherein the method of detecting the effect of TJP3 on the migration and invasion of ovarian cancer Caov-3 cells in step four comprises: the effect of TJP3 knockdown and overexpression on Caov-3 cell migration and invasiveness was analyzed using a cell scratch assay and a transwell cell invasion assay, respectively.

9. The method for determining the function of the encoded protein according to claim 3, wherein the method for detecting the influence of TJP3 on the expression of EMT-associated protein of the ovarian cancer Caov-3 cell in the fifth step comprises the following steps: western Blot was used to examine the effect of TJP3 on EMT-associated protein expression in Caov-3 cells of ovarian cancer.

10. The method for determining the function of the encoded protein according to claim 3, wherein the method for detecting the effect of TJP3 on apoptosis of the ovarian cancer Caov-3 cells in the sixth step comprises the following steps: the influence of TJP3 on apoptosis was detected by Annexin V-FITC/PI double staining apoptosis assay.