CN114480501A

CN114480501A - Humanized antibody expression plasmid and construction method thereof

Info

Publication number: CN114480501A
Application number: CN202210346411.0A
Authority: CN
Inventors: 陈薇; 李建民; 郝勐; 于长明; 徐俊杰; 侯利华; 迟象阳; 卞婷; 陈旖; 付玲; 董韵竹; 房婷; 刘树玲
Original assignee: Academy of Military Medical Sciences AMMS of PLA
Current assignee: Academy of Military Medical Sciences AMMS of PLA
Priority date: 2022-04-02
Filing date: 2022-04-02
Publication date: 2022-05-13
Anticipated expiration: 2042-04-02
Also published as: CN114480501B

Abstract

The invention discloses a humanized antibody expression plasmid system, which comprises a humanized antibody heavy chain expression plasmid and a humanized antibody light chain expression plasmid, wherein the humanized antibody heavy chain expression plasmid contains a heavy chain variable region homologous arm recombination sequence, a humanized antibody heavy chain encoding gene is integrated into the humanized antibody heavy chain expression plasmid through homologous recombination, the homologous arm recombination sequence which is carried by the humanized antibody heavy chain encoding gene and is identical to the heavy chain variable region homologous arm recombination sequence, the humanized antibody light chain expression plasmid contains a light chain variable region homologous arm recombination sequence, and the humanized antibody light chain encoding gene is integrated into the humanized antibody light chain expression plasmid through homologous recombination, the homologous arm recombination sequence which is carried by the humanized antibody light chain encoding gene and is identical to the light chain variable region homologous arm recombination sequence. The humanized antibody expression plasmid system provided by the invention is used for preparing humanized antibodies and has the advantages of time-saving preparation, high efficiency and high accuracy.

Description

Humanized antibody expression plasmid and construction method thereof

Technical Field

The invention discloses a plasmid, and belongs to the technical field of nucleic acid molecules.

Background

Antibodies (Ab) are important effector molecules for mediating humoral immunity, are glycoproteins produced by proliferation and differentiation of B cells into plasma cells after stimulation of antigens, mainly exist in body fluids such as serum and the like, can be specifically combined with corresponding antigens to further play an immune function, and are adaptive to the fields of autoimmune diseases, solid tumors, blood tumors and the like.

Monoclonal antibody drugs have the following trends: (1) the field of antibody therapy is greatly expanded from infectious diseases to tumors (lymphoma, gastric cancer, lung cancer, etc.), autoimmune diseases (psoriasis, systemic lupus erythematosus, etc.), metabolic diseases (hyperlipidemia, etc.) or degenerative diseases (macular degeneration, alzheimer's disease). (2) The whole research, development, production and sales chain is very complete, and from gene discovery, from the upstream (vector construction, clone expression) to the downstream (large-scale fermentation and purification quality control, impurity removal) of the antibody and industrialization (production, global sales, and partial products entering medical insurance). (3) The new technology emerges endlessly, and develops from monoclonal antibody technology to bispecific antibodies, multispecific antibodies, antibody drug conjugates and nano-antibodies. (4) The administration mode is various: from classical intravenous and intraperitoneal administration to subcutaneous injection, intraocular injection, nasal inhalation, etc.

Anti-infectious disease antibody drugs enter a high-speed development phase with the development of antibody drugs, ranging from respiratory syncytial virus therapeutic antibodies to anthrax therapeutic antibody drugs, to the most recent ebola antibody therapeutic drugs and COVID-19 therapeutic antibody drugs. To some extent, antibody drugs have a clear target and a relatively clear action mechanism, and thus become the strategic placement direction of large pharmaceutical companies. In the research and development of COVID-19 therapeutic antibody drugs, the great research and development progress of regenerative medicine, Gift medicine, Alisanin, Vir and other medicines is in the leading position.

The discovery of infectious disease antibody drugs is from hybridoma technology, phage library technology, transgenic mouse technology, single cell PCR technology and single cell sequencing technology. Compared with the prior discovery technology, the single cell technology has obvious technical progress, the gene is derived from single B lymphocyte in peripheral blood of a rehabilitee or an immune volunteer, is a natural paired fully human antibody gene, and basically avoids the defects of insufficient immunogenicity and stability in the prior antibody research and development.

Regardless of the discovery strategy, the full-length genes of the light chain and the heavy chain are cloned to a eukaryotic expression vector to prepare a full-molecular antibody, and then in vivo and in vitro activity evaluation is carried out to further evaluate whether the antibody has the property of being druggy. At present, a relatively preferred strategy is to directly screen and evaluate whole molecule antibody candidate molecules derived from peripheral blood. The conventional method is to construct a linear expression frame strategy for binding activity screening, and has the defects of low expression quantity, frequent mutation and sometimes non-unique sequence. After the antibody gene with the binding activity is obtained by screening, the antibody gene needs to be cloned to a T vector for sequencing confirmation, and then is subcloned to an expression vector by enzyme digestion. Some commercial vectors can realize cloning and expression vector construction at the same time, and have the defect that amino acid mutation of individual sites exists, so that amino acid correction mutation is required in drug development, and complexity is increased.

Disclosure of Invention

The invention aims to provide a method for conveniently and quickly constructing human IgG1/kappa and IgG1/Lambda antibody expression vectors, which can quickly clone the variable region genes of light and heavy chains of an antibody into a plasmid containing a signal peptide and a coding antibody constant region gene in a homologous recombination mode so as to perform eukaryotic expression of the antibody.

Based on the above purpose, the present invention firstly provides a humanized antibody expression plasmid system, which comprises a humanized antibody heavy chain expression plasmid and a humanized antibody light chain expression plasmid, the expression plasmid of the heavy chain of the human antibody contains a heavy chain variable region homologous arm recombination sequence, and the encoding gene of the heavy chain of the human antibody is carried by the human antibody, and the homologous arm recombination sequence identical to the homologous arm recombination sequence of the heavy chain variable region is integrated into the human antibody heavy chain expression plasmid by homologous recombination, and, the expression plasmid of the human antibody light chain contains a light chain variable region homologous arm recombination sequence, and the encoding gene of the human antibody light chain is carried by the human antibody light chain expression plasmid, and the homologous arm recombination sequence which is the same as the homologous arm recombination sequence of the light chain variable region is integrated into the human antibody light chain expression plasmid through homologous recombination.

In a preferred embodiment, the upstream homologous arm recombination sequence of the heavy chain variable region is shown in SEQ ID NO.12, and the upstream homologous arm recombination sequence of the light chain variable region is shown in SEQ ID NO.14 or SEQ ID NO. 16.

In a more preferred embodiment, the human antibody heavy chain expression plasmid further contains an antibody heavy chain signal peptide-encoding gene and an antibody heavy chain constant region-encoding gene, and the human antibody light chain expression plasmid further contains an antibody light chain signal peptide-encoding gene and an antibody light chain constant region-encoding gene.

More preferably, two enzyme cutting sites of Hpa I and Srf I are respectively introduced into the downstream gene coding the antibody heavy chain signal peptide and the upstream gene coding the antibody heavy chain constant region.

Particularly preferably, the sequence between the antibody heavy chain signal peptide coding gene and the antibody heavy chain constant region coding gene is shown as SEQ ID NO. 1.

In another preferred embodiment, the light chain of the antibody is a Kappa chain, and two cleavage sites Kpn I and Pme I are introduced upstream of the gene encoding the signal peptide of the Kappa chain and the gene encoding the constant region, respectively.

More preferably, the sequence between the Kappa chain signal peptide-encoding gene and the Kappa chain constant region-encoding gene is represented by SEQ ID NO. 2.

In yet another preferred embodiment, the light chain of the antibody is a Lambda chain, and two cleavage sites Kpn I and Pml I are introduced upstream of the downstream gene encoding the Lambda chain signal peptide and the gene encoding the constant region, respectively.

More preferably, the sequence between the Lambda chain signal peptide-encoding gene and the Lambda chain constant region-encoding gene is represented by SEQ ID NO. 3.

In a preferred embodiment of the present invention, the antibody heavy chain signal peptide encoding gene has a sequence shown as SEQ ID number 18, and the antibody heavy chain constant region encoding gene has a sequence shown as SEQ ID number 19(GenBank: AAA 02914.1).

In another preferred embodiment of the present invention, the sequence of the gene encoding the signal peptide of the Kappa chain of the antibody is represented by SEQ ID number 20, and the sequence of the gene encoding the constant region of the Kappa chain of the antibody is represented by SEQ ID number 21 (GenBank: AAY 24201.1).

In still another preferred embodiment of the present invention, the sequence of the antibody Lambda chain signal peptide-encoding gene is represented by SEQ ID number 22, and the sequence of the antibody Lambda chain constant region-encoding gene is represented by SEQ ID number 23 (GenBank: AAH 12159.1).

Secondly, the invention also provides a preparation method of the human antibody expression plasmid system, which comprises the following steps:

(1) obtaining a gene segment with an antibody heavy chain signal peptide coding gene and an antibody heavy chain constant region coding gene, and introducing a restriction enzyme site and a non-antibody gene related gene into the antibody heavy chain signal peptide coding gene and the antibody heavy chain constant region coding gene; or

Obtaining a gene fragment with an antibody Kappa light chain signal peptide coding gene and an antibody Kappa light chain constant region coding gene, and introducing a restriction enzyme site and a non-antibody gene related gene into the antibody Kappa light chain signal peptide coding gene and the antibody Kappa light chain constant region coding gene; or

Obtaining a gene segment with an antibody Lambda light chain signal peptide coding gene and an antibody Lambda light chain constant region coding gene, and introducing a restriction enzyme site and a non-antibody gene related gene into the antibody Lambda light chain signal peptide coding gene and the antibody Lambda light chain constant region coding gene;

(2) obtaining a double enzyme digestion segment of a eukaryotic cell expression vector containing a heavy chain variable region homologous arm recombination sequence and a human cytomegalovirus early promoter element CMV and an enhanced expression original WPRE, a poly A tail gene and an ampicillin resistance gene;

(3) cloning the gene fragment obtained in the step (1) to the double enzyme digestion fragment of the expression vector in the step (2) by using a homologous recombination method.

Finally, the invention also provides a method for preparing the humanized antibody by using the humanized antibody expression plasmid system, which comprises the following steps:

(1) carrying out homologous recombination on the linearized humanized antibody heavy chain expression plasmid and the humanized antibody light chain expression plasmid with a heavy chain variable region gene and a light chain variable region gene of an antibody to be prepared respectively, wherein homologous arm recombination sequences which are the same as a heavy chain variable region homologous arm recombination sequence and a light chain variable region homologous arm recombination sequence are arranged at the 5' ends of the heavy chain variable region gene and the light chain variable region gene respectively;

(2) expressing the human antibody heavy chain expression plasmid and the human antibody light chain expression plasmid which are obtained in the step (1) and carry the heavy chain variable region gene and the light chain variable region gene, and recovering expression products.

In a preferred embodiment, the heavy chain variable region homologous arm recombination sequence is shown in SEQ ID NO.12, and the light chain variable region homologous arm recombination sequence is shown in SEQ ID NO.14 or SEQ ID NO. 16.

Compared with the traditional method, the method provided by the invention has the following progress:

1, time saving: the signal peptide and the constant region are directly constructed on the carrier, the process of obtaining the full-length antibody gene by fusion PCR is not needed, and the problem of sequence mutation caused by the process of fusion PCR is effectively avoided.

2, high flux: the constructed vector is recovered after unified enzyme digestion, and a variable region PCR product obtained by a single cell PCR technology or a single cell sequencing technology is directly recovered through a 96-well plate and is connected to the vector through homologous recombination.

3, simple and convenient: the colony after homologous recombination does not need to be subjected to clone PCR identification, and the colony is directly selected for sequence determination and confirmation, so that the accuracy is higher than 90%. The expression vector can be directly constructed without constructing an expression frame.

Drawings

FIG. 1 is a schematic diagram of a construction process of a conventional expression vector for an antibody according to an embodiment;

FIG. 2 is a schematic diagram showing the construction process of the pAbH expression vector of the example;

FIG. 3 is a schematic diagram showing the construction process of the pAbk expression vector of the embodiment;

FIG. 4 is a schematic diagram of the construction scheme of the pAb lambda expression vector of the example;

FIG. 5 is a schematic diagram showing the results of PCR amplification of the genes designed in the examples;

FIG. 6 is a schematic diagram of the double digestion of the vector of example pAb;

FIG. 7 is an electrophoretogram of the light and heavy chain variable regions of antibodies E2 and E40;

FIG. 8 is a double-restriction electrophoresis of light and heavy chain expression vectors of antibodies E2 and E40 of the examples;

FIG. 9 is an SDS-PAGE electrophoresis of example antibody purification;

FIG. 10 is a diagram of ELISA analysis of the antibodies of the examples.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of protection defined by the claims of the present invention.

The present invention is illustrated by the construction process of expression plasmids of antibodies E2 and E40 against rift valley fever virus Gn protein, wherein E2 is a Kappa-type antibody in light chain, and E40 is a Lambda-type antibody in light chain.

Example 1: construction of expression plasmids for antibodies E2 and E40 against rift valley fever virus Gn protein

1. Reagents referred to in the examples:

hpa I, Srf I, Kpn I, Pme I and Pml I restriction endonucleases and the homologous recombinase NEBuilder were purchased from NEB. Gel recovery kits were purchased from OMEGA. HiTrap rProteinA was purchased from GE. HRP-labeled secondary goat anti-human IgG antibody was purchased from Abcam. TanStart TaqDNA polymerase was purchased from King Konji, Beijing. Expi293F cell culture medium and transfection reagents were purchased from Thermo Fisher. In the examples, the genes of the variable regions of the antibodies E2 and E40, and the primers and sequencing used therein were synthesized and performed by Bioengineering. Top10 is competently purchased from Bomaide.

2. Designing and constructing a vector:

the adoption of a proper expression vector is the key for successfully expressing the foreign gene, and the expression vector of the mammalian cell which can realize high expression and is suitable for industrial scale application must have the following characteristics: a strong promoter and a highly efficient transcription termination sequence; an intron or element that enhances expression. The invention intends to clone the designed gene to the general eukaryotic cell expression vector pAb, and the vector has the technical characteristics that: (1) has a human cytomegalovirus early promoter element (CMV), is a stronger promoter for promoting expression in a plurality of mammalian cells, and has a wide host application range, wherein the promoter comprises Chinese Hamster Ovary Cells (CHO). (2) The expression of original WPRE is enhanced, the post-transcriptional regulatory sequence is enhanced, and the expression efficiency of the exogenous fragment is increased. (3) poly a tail gene, which facilitates the transport of mRNA from nucleus to cytoplasm and prevents mRNA from ribozyme degradation in cells, enhances mRNA stability (4) ampicillin resistance gene: successfully transformed positive bacterial clones were able to grow on LB plates containing ampicillin. The general cloning strategy is shown in figure 1, and comprises fusion of a signal peptide, a variable region and a constant region, and cloning to a corresponding enzyme cutting site of a vector after correct sequencing to construct an expression plasmid.

The present invention modified 3 genes expressing human IgG1 heavy chain, Kappa chain and Lambda chain, respectively, by introducing single cleavage sites by synonymous mutation without changing the amino acid sequence (human IgG1 heavy chain constant region reference Genbank: AAA02914.1, human Kappa light chain constant region reference Genbank: AAY24201.1, human Lambda light chain constant region reference Genbank: AAH 12159.1) two cleavage sites of Hpa I (GTT ^ AAC) and Srf I (GCCC ^ GGGC) were introduced upstream of the gene coding the heavy chain signal peptide (SEQ ID NO. 18) and the gene coding the constant region (SEQ ID NO. 19), respectively, and two cleavage sites of Kpn I (GGT ^ ACC) and Pvt ^ AAT (GTT ^) were introduced upstream of the gene coding the Kappa chain signal peptide (SEQ ID NO.20) and the gene coding the constant region (SEQ ID NO. 21) sequence of the gene coding the Kappa chain signal peptide (GGT ^ ACC) and two cleavage sites of SEQ ID NO. 23) upstream of the constant region coding SEQ ID NO.23 Two enzyme cutting sites of I (GGT ^ ACC) and Pml I (CAC ^ GTG), which are shown in the attached figure 2, figure 3 and figure 4. Then, a sequence irrelevant to the antibody gene is introduced between two enzyme cutting sites in the three genes. The designed full-length gene sequences are respectively shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. Finally, the three gene sequences are delivered to a biological company for synthesis.

2.1 Total Gene chemical Synthesis

The whole-gene chemical synthesis of Anhui general biotechnology company is entrusted according to the designed sequence.

2.2 full-Length amplification of genes containing constant regions of light and heavy strands

The genes of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 are amplified by using NEB 2 XQ 5 DNA polymerase through upstream and downstream primers AbHR-F and AbHR-R. Primer sequences are shown in table 1:

。

remarking: GAATTC is an EcoRI enzyme cutting site; GGATCC is BamHI enzyme cutting site; ccttggatctctagc is an upstream homology arm; cttgtcgaggtcggg are downstream homology arms. The reaction system is shown in Table 2:

TABLE 2 Gene amplification reaction System

。

The reaction procedure is shown in table 3:

TABLE 3 Gene amplification reaction procedure

。

The amplification results are shown in FIG. 5, and

lanes

1, 2 and 3 show the amplification results of heavy chain, kappa chain and lambda chain, respectively, and the sizes of the bands are consistent with those expected.

2.3 double digestion linearization and recovery purification of plasmid pAb

Plasmid pAb was double digested with the restriction enzymes Eco RI and Bam HI to linearize it. The cleavage system is shown in Table 4:

TABLE 4 plasmid pAb double digestion reaction System

。

The cleavage results are shown in FIG. 6, lane 1 showing that the vector is linearized.

2.4 ligation, transformation and screening of positive clones:

the connection of target fragment and carrier is a high-efficiency homologous recombination technology which is independently developed by NEB and uses NEBuilder assembling kit (the NEBuilder double-efficient seamless cloning technology is a high-efficiency homologous recombination technology which is independently developed by NEB, it utilizes that both ends of target fragment and both ends of carrier contain identical sequence, under the action of NEBuilder double-Master Mix it can implement high-efficiency homologous recombination, firstly clone signal peptide and constant region gene on the carrier to construct recombinant carrier), and make operation according to the instruction to connect target fragment. The reaction system is shown in Table 5:

TABLE 5 homologous recombination reaction System

。

Then mixed gently, ligated for 15 min at 50 ℃ and the system is subsequently placed on ice. Adding 5 mu L of the ligation product into Top10 competence, carrying out ice bath for 30 min, carrying out heat shock at 42 ℃ for 90 s, carrying out ice bath for 3 min, using a nonresistant LB culture medium, carrying out shake culture for 60 min, centrifuging at 8000 rpm for 1min, taking 100 mu L of precipitate resuspension, coating a plate, and incubating overnight at 37 ℃ in an incubator. The monoclonal colonies with good growth state were picked with sterile tips into 1.5 mL sterile centrifuge tubes containing 600. mu.L Amp/LB liquid medium, shake-cultured at 37 ℃ for 12 h, and resistant clones were randomly selected for sequencing validation.

The resulting vectors, designated pAbH, pAbk and pAb λ, contain the IgG1 heavy chain constant region, the KAPPA chain constant region and the λ chain constant region, respectively, and the corresponding sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively, and the corresponding sequence functions are annotated in Table 6, Table 8 and Table 10, respectively.

TABLE 6 Annotation of Ab-H sequence (SEQ ID NO. 1)

。

Heavy chain upstream homology arm nucleotide sequence: CTAATTTTAAAAGGTGTT (SEQ ID NO. 12), 18bp in length, located on the vector and the variable region upstream primer, respectively, and responsible for homologous recombination.

IgG1 heavy chain constant region 5-terminal homology arm: CCAGGGGGAAGACCGATGGGCCC (SEQ ID NO. 13), 25bp, located on the vector and on the variable region downstream primer, respectively, responsible for homologous recombination.

TABLE 7 primer sequences for amplifying heavy chain variable regions

。

TABLE 8 Ab-k sequence notes (SEQ ID NO. 2)

。

Nucleotide sequence of homologous arm of kappa chain upstream: CTGCTATGGGTATCTGGT (SEQ ID NO. 14), 18bp, located on the vector and the variable region upstream primer, respectively, responsible for homologous recombination.

5-terminal homology arm of kappa chain constant region:

GAAGACAGATGGTGCAGCCACAGTACGTTT (SEQ ID NO. 15), 30bp, located on the vector and on the variable region downstream primer, respectively, responsible for homologous recombination.

TABLE 9 primer sequences for amplification of kappa chain variable region

。

TABLE 10 Ab-L sequence notes (SEQ ID NO. 3)

。

Nucleotide sequence of upstream homologous arm of Lambda chain: CTGCTATGGGTATCTGGT (SEQ ID NO. 16), 18bp, located on the vector and the variable region upstream primer, respectively, responsible for homologous recombination

5-end homologous arm of constant region of Lambda chain: GGGGGCAGCCTTGGGCTGCCC (SEQ ID NO. 17), 21bp, located on the vector and downstream primer of the variable region, respectively, responsible for homologous recombination

TABLE 11 primer sequences for amplifying lambda chain variable regions

。

Example 2 antibody preparation example

1 Single cell PCR amplification of antibody variable region genes

First, the variable region gene of the antibody was PCR-amplified using TranStart TaqDNA polymerase using the E2 and E40 light and heavy chain variable region primers in table 2, and the corresponding primer sequences are shown in tables 3, 5 and 7. The reaction system is shown in Table 12:

TABLE 12 Gene amplification reaction System

。

The reaction procedure is as in table 13:

TABLE 13 Gene amplification reaction procedure

。

The heavy and light chain variable region genes of the antibody of the examples were well amplified and the sizes were consistent with the expected sizes (about 400 bp), and the results are shown in FIG. 7 (left is the amplification of the heavy chain E2 (SEQ ID NO.24 sequence) and the kappa chain variable region gene (SEQ ID NO.25 sequence), and right is the amplification of the heavy chain E40E 2 (SEQ ID NO.26 sequence) and the kappa chain variable region gene (SEQ ID NO. 27 sequence)), and the molecular sizes are 400bp, which is expected.

2 double digestion linearization, recovery and purification of plasmids pAbH, pAb kappa and pAb lambda

Plasmids pAbH, pAb κ and pAb λ were double digested with the corresponding restriction endonucleases to linearize them. The enzyme digestion system is shown in tables 14-16:

TABLE 14 pAbH double digestion reaction System

。

TABLE 15 pAb kappa double digestion reaction System

TABLE 16 pAb. lambda. double digestion reaction System

。

The enzyme was cleaved at 37 ℃ for 1 h. Then, Gel recovery and purification were carried out according to the OMEGA Gel Extraction Kit. The process is as follows:

(1) cutting glue and weighing: the agarose gel containing the target gene was excised, and the excess was excised as much as possible, leaving the target band. The excised gel pieces were placed in a clean 1.5 mL centrifuge tube, weighed, and an equal volume of Binding Buffer (1. mu.L of Binding Buffer solution if the mass of the gel piece is 1 mg and the volume can be considered to be 1. mu.L) was added to the gel piece and placed in a 65 ℃ metal bath until the gel piece was completely dissolved.

(2) Binding the target band to the adsorption column: adding the gel block fully dissolved in the Binding Buffer into an adsorption column, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, and putting the adsorption column into the collection tube again. And adding 300 mu L Binding Buffer into the adsorption column, centrifuging at 12000rpm for 1min, and discarding waste liquid in the collection tube.

(3) Washing: add 700. mu.L of Wash Buffer (addition of absolute ethanol was confirmed before use) to the adsorption column bound with DNA fragments, centrifuge at 12000rpm for 1min, discard the waste liquid from the collection tube, replace the adsorption column in the collection tube, and repeat this step twice. The adsorption column was replaced in the collection tube, left to air at 12000rpm for 2 min, and dried at room temperature for 5-10 min to evaporate the alcohol from the Wash Buffer sufficiently to avoid affecting the next experiment.

(4) Elution of the target fragment: placing the adsorption column in a clean 1.5 mL centrifuge tube, and dripping 40 μ L ddH into the center of the adsorption membrane₂The O is put in a metal bath at 65 ℃ for 5min to fully dissolve the DNA in ddH 2O. Finally, the DNA solution was collected by centrifugation at 12000rpm for 2 min.

3, connection, transformation and positive clone screening:

the connection of the target fragment and the vector is carried out by using a NEBuilder assembly kit and operating according to the instruction (the NEBuilder' high-efficiency seamless cloning technology is a high-efficiency homologous recombination technology independently developed by NEB, and the method utilizes the fact that two ends of the target fragment and two ends of the vector contain the same sequence to complete high-efficiency homologous recombination under the action of NEBuilder Master Mix to construct a recombinant vector), the operation is carried out according to the instruction, the target fragment is connected, and the reaction system is shown in Table 17.

TABLE 17 homologous recombination reaction System

。

As a result: 4 resistant clones of E2 monoclonal antibody heavy chains are randomly selected and sequenced, wherein the sequence alignment accords with 4 expected clones, and the positive rate is 100%; 4 resistant clones of E40 monoclonal antibody heavy chain are randomly selected and sequenced, wherein the sequence alignment is in accordance with 3 expected, and the positive rate is 75%; 4 resistant clones are randomly selected by the Kappa chain and sent to be sequenced, wherein the sequence alignment is in accordance with 4 expected, and the positive rate is 100 percent; resistant clones were randomly selected by Lambda strands for 4 clones to be sequenced, where the sequence alignment was 4 as expected and the positive rate was 100%. The total of 4 fragments of the light and heavy chain variable regions of E2 and E40 monoclonal antibodies were successfully plasmid-constructed using this technique, and 16 clones were sent for sequencing, 15 of which were as expected, with a positive rate of 15/16= 93.75%. The constructed expression vector was subjected to double restriction enzyme identification, and the restriction enzyme results are shown in FIG. 8, wherein lane pE2-H shows double restriction enzyme results of the heavy chain vector of E2 monoclonal antibody, and about 7000bp of the expected vector band and about 1500bp of the heavy chain band, lane pE2-L shows double restriction enzyme results of the light chain vector of E2 monoclonal antibody, and about 7000bp of the expected vector band and about 750bp of the light chain band, lane pE40-H shows double restriction enzyme results of the heavy chain vector of E40 monoclonal antibody, and about 7000bp of the expected vector band and about 1500bp of the heavy chain band, and lane pE40-L shows double restriction enzyme results of the light chain vector of E40 monoclonal antibody, and about 7000bp of the expected vector band and about 750bp of the light chain band.

4. Eukaryotic expression and purification of antibodies

And extracting the positive antibody light and heavy chain expression plasmid with correct sequencing. The paired light and heavy chain plasmids were then co-transfected into Expi293F cells. Before transfection, the total cell number was 3X 10⁶An Expi293F cell was seeded into 30 mL Expi293F expression medium and cultured in a shaker at 5% CO2, 37 ℃ and 120 rpm for several hours at a cell density of 3.5X 10⁶at/mL, 80. mu.L Expifeacylamine 293 transfection reagent was added to 1.5 mL of medium and mixed well and incubated at room temperature for 5 min. Add 30. mu.g of expression plasmid to 1.5 mL of medium and mix well. Then adding the mixture of the incubated transfection reagent and the culture medium into the mixture of the plasmid and the culture medium, gently mixing, incubating at room temperature for 25 min, and finally slowly adding into a cell culture bottle. After 16 h of culture, 150. mu.L of transfection-enhancing agent 1 and 1.5 mL of transfection-enhancing agent 2 were added to the above cell culture flasks, respectively.

Collecting cell supernatant after 108 h of continuous culture, firstly centrifuging at 4 ℃ for 15 min at 1500 g, then centrifuging at 3000 g for 15 min, transferring the supernatant into a new centrifuge tube, finally centrifuging at 12000rpm for 10 min at high speed, transferring the supernatant into the new centrifuge tube, and placing at 4 ℃ for later use.

To isolate the antibodies expressed by Expi293F cells from the cell culture medium, we purified the antibodies by HiTrap rProteinA affinity column as follows:

1) first, the HiTrap rProteinA affinity column was run at low flow rate in a protein purifier AKTA pure, then 20% ethanol in the rProteinA affinity column was washed clean with 5 column volumes of pure water, and then equilibration buffer (PBS) was run until the UV setting was zeroed after leveling off.

2) And (3) loading the cell supernatant subjected to high-speed centrifugation at a normal flow rate, collecting the column, and after the loading is finished, continuously balancing the cell supernatant with PBS until the UV is leveled.

3) The antibody in the affinity column was eluted with 0.1M glycine pH 2.7 and the eluted peak was collected. And the eluate was neutralized to pH 7.0 with Tris-HCl solution of pH 9.0. The purification results were then analyzed by SDS-PAGE.

4) The antibody which is successfully purified is concentrated and changed into PBS through an ultrafiltration tube with 30kDa, and the centrifugation condition is 4 ℃ and 3000 g for 30 min.

Finally, SDS-PAGE analysis of the purified antibodies shows that the antibodies in the examples are well expressed and purified, and the results are shown in figure 9. This result indicates that the base mutation performed in the present invention under the condition that the amino acid sequence is not changed does not affect the normal expression of the antibody.

5, measuring the binding activity of the purified Gn protein monoclonal antibody by ELISA

Coating the purified truncated Gn protein on an ELISA plate (2. mu.g/mL, 100. mu.L/well) at 4 ℃ overnight, washing with PBST for 3 times, and blocking with 2% BSA at 37 ℃ for 1 h; PBST was washed 3 times. First hole with 150 u L concentration of 10 u g/mL antibody, then three times of gradient dilution, total dilution of 12 dilution, then placed in 37 degrees C incubation for 1h, PBST washing three times. mu.L of HRP-labeled secondary goat anti-human IgG antibody (diluted 1: 10000) was added to each well, incubated at 37 ℃ for 1 hour, and then washed three times with PBST. Adding 100 μ L of TMB single-component color developing solution into each well, developing at room temperature for 5min, adding 50 μ L of stop solution, and reading OD450nm-OD630nm value with enzyme-labeling instrument. Finally, the EC of E2 and E40 was determined by four-parameter fitting of the binding curve of each monoclonal antibody using Graphpad Prism software₅₀2.157ng/mL and 4.565ng/mL respectively, and the results are shown in FIG. 10. This result indicates that the base mutation performed in the present invention does not affect the binding function of the antibody to the antigen under the condition that the amino acid sequence is not changed.

Sequence listing

<110> military medical research institute of military science institute of people's liberation force of China

<120> humanized antibody expression plasmid and construction method thereof

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1566

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaattcaatt gccgccacca tgaacttcgg gctcagcttg attttccttg tcctaatttt 60

aaaaggtgtt aacgtgagca agggcgagga gctgttcacc ggggtggtgt aacccatcct 120

ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg 180

cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt 240

gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc 300

cgacgttaac cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt 360

ccaggagcgc accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa 420

gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga 480

cggcaacatc ctggggcaca agctggagta caactacaac agccacaacg tctatatcat 540

ggccgacaag cagaagaacg gcatcaaggt ggcccgggcc catcggtctt ccccctggca 600

ccctcctcca agagcacctc tgggggcaca gcggccctgg gctgcctggt caaggactac 660

ttccccgaac cggtgacggt gtcgtggaac tcaggcgccc tgaccagcgg cgtgcacacc 720

ttcccggctg tcctacagtc ctcaggactc tactccctca gcagcgtggt gaccgtgccc 780

tccagcagct tgggcaccca gacctacatc tgcaacgtga atcacaagcc cagcaacacc 840

aaggtggaca agaaagttga gcccaaatct tgtgacaaaa ctcacacatg cccaccgtgc 900

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 960

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 1020

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 1080

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcccg 1140

caccaggact ggctgaatgg caaagagtac aagtgcaagg tctccaacaa agccctccca 1200

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 1260

accctgcccc caccccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc 1320

aagggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 1380

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 1440

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgcgatgcat 1500

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccagg taaataatga 1560

ggatcc 1566

<210> 2

<211> 748

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaattcaatt gccgccacca tggattcaca ggcccaggtt cttatgttac tgctgctatg 60

ggtatctggt acctgtgggg aaattgtgtt gacacagtct ccagtctccc tggctgtgtc 120

tctgggcgag agggccacca tcaactgcaa gtccagccag agtgttttat acagctccaa 180

caataagaac tacttagctt ggtaccagca gaaaccagga cagcctccta agctgctcat 240

ttactgggca tctacccggg aatccggggt ccctgaccga ttcagtggca gcgggtctgg 300

gacagatttc actctcacca tcagcagcct gcaggctgaa gatgtggcag tttattactg 360

tcagcaatat tatagtactc ctcggacgtt cggccaaggg accaaggtgt ttaaacgtac 420

tgtggctgca ccatctgtct tcatcttccc gccatctgat gagcagttga aatctggaac 480

tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga gaggccaaag tacagtggaa 540

ggtggataac gccctccaat cgggtaactc ccaggagagt gtcacagagc aggacagcaa 600

ggacagcacc tacagcctca gcagtaccct gacgctgagc aaagcagact acgagaaaca 660

caaagtctac gcctgcgaag tcacccatca gggcctgagt tcgcccgtca caaagagctt 720

caacagggga gagtgttaat gaggatcc 748

<210> 3

<211> 736

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaattcaatt gccgccacca tggattcaca ggcccaggtt cttatgttac tgctgctatg 60

ggtatctggt acctgtgggt cctatgagct gacacagcca ccctcagtgt cggtgtcccc 120

aggacagtcg gccaggatca cctgctctgg agaaatactg gcaaaaaaat atactcagtg 180

gttccagcag aagccaggcc aggcccctgt gctggtgata tataaagaca gtgagaggcc 240

ctcagggatc cctgagcgat tctctagctc cagttcaggg acaacagtta ccttgaccat 300

cagtggggcc caggcagaag atgaggctga ctattactgt caatcagtag acagcagtgg 360

taatcattac atcttcggtg ctgggacccg gctgacccac gtgctagggc agcccaaggc 420

tgcccccttg gtcactctgt tcccgccctc ctctgaggag ctccaagcca acaaggccac 480

actagtgtgt ctcataagtg acttctaccc gggagccgtg acagtggcct ggaaggcaga 540

tagcagcccc gtcaaggcgg gagtggagac caccacaccc tccaaacaaa gcaacaacaa 600

gtacgcggcc agcagctacc tgagcctgac gcctgagcag tggaagtccc acaaaagcta 660

cagctgccag gtcacgcatg aagggagcac cgtggagaag acagtggccc ctacagaatg 720

ttcataatga ggatcc 736

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctaattttaa aaggtgttca gtgtgaggtg cagctgttgg ag 42

<210> 5

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccagggggaa gaccgatggg cccttggtcg acgctgagga gacggtgacc gtg 53

<210> 6

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctaattttaa aaggtgttca gtgtgaggtg cagctgttgg ag 42

<210> 7

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccagggggaa gaccgatggg cccttggtcg acgctgagga gacggtgac 49

<210> 8

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctgctatggg tatctggtac ctgtggggat attgtgatga cccagac 47

<210> 9

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaagacagat ggtgcagcca cagtacgttt gatytccacc ttggtc 46

<210> 10

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctgctatggg tatctggtac ctgtgggcag cytgtgctga ctca 44

<210> 11

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gggggcagcc ttgggctgcc ctagcactag gacggtcagc cgagtccc 48

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctaattttaa aaggtgtt 18

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccagggggaa gaccgatggg ccc 23

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctgctatggg tatctggt 18

<210> 15

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gaagacagat ggtgcagcca cagtacgttt 30

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ctgctatggg tatctggt 18

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gggggcagcc ttgggctgcc c 21

<210> 18

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atgaacttcg ggctcagctt gattttcctt gtcctaattt taaaaggtgt ccagtgt 57

<210> 19

<211> 993

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gctagcacca agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 60

ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 120

tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180

ggactctact ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc 240

tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagaa agttgagccc 300

aaatcttgtg acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga 360

ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct 420

gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 480

tacgtggacg gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac 540

agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 600

gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 660

aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcctccatc tcgggatgag 720

ctgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc cagcgacatc 780

gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg 840

ctggactccg acggctcctt cttcctctat agcaagctca ccgtggacaa gagcaggtgg 900

cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg 960

cagaagagcc tctccctgtc tccgggtaaa tga 993

<210> 20

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

atggattcac aggcccaggt tcttatgtta ctgctgctat gggtatctgg tacctgtggg 60

<210> 21

<211> 321

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

aggactgtgg cagcaccttc tgtgtttatc tttcctcctt ctgatgaaca acttaaatct 60

ggaacagcat ctgtggtgtg ccttcttaac aacttctacc cacgcgaggc aaaggtacag 120

tggaaagtgg ataacgcact tcaatctgga aactctcaag aatctgtgac agaacaagat 180

tctaaagatt ctacatattc tctttcttct acacttacac tttctaaagc agattatgag 240

aagcacaagg tgtatgcatg cgaagtgaca catcaaggac taagttcgcc ggtaaccaaa 300

tcatttaatc gtggagaatg c 321

<210> 22

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atggattcac aggcccaggt tcttatgtta ctgctgctat gggtatctgg tacctgtggg 60

<210> 23

<211> 324

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ggtcagccca aggctgcccc ctcggtcact ctgttcccac cctcgagtga ggagcttcaa 60

gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc cgtgacagtg 120

gcctggaagg cagatagcag ccccgtcaag gcgggagtgg agaccaccac accctccaaa 180

caaagcaaca acaagtacgc ggccagcagc tacctgagcc tgacgcctga gcagtggaag 240

tcccaccgta gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300

gcccctacag aatgttcata atga 324

<210> 24

<211> 393

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atgaacttcg ggctcagctt gattttcctt gtcctaattt taaaaggtgt tcagtgtgag 60

gtgcagctgt tggagtcggg gggaggcttg gtccagcctg gagggtccct gagagtctcc 120

tgtgcagtct ctggattcac cttcagtcat tacggcattc actgggtccg ccaggctccg 180

ggaaagggcc tggagtgggt ctcatccatt agtagtgcta gtacttacaa atactacgct 240

gactccgtga agggccgatt caccatctcc agagacaacg ccaagaactc gctgtctctg 300

caaatgaaca gcctgagagc cgaggacacg gccatgtatt actgtactac tttcgataac 360

tggggcccgg gagtcacggt caccgtctcc tca 393

<210> 25

<211> 399

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

atggattcac aggcccaggt tcttatgtta ctgctgctat gggtatctgg tacctgtggg 60

gtcatccaga tgacccagac tccactctcc ctgcccgtca cccctggaga gccggcctcc 120

ctctcctgca ggtctagtca gagcctcttg gcgagtgagg atggaaaaac ctatttggat 180

tggttcctgc agaagccagg ccagtctcca cagctcttga tttacgaggt ttccaagcgg 240

gcctttggag tcccagacag gttcagtggt agtgggtcag acactgaatt cacactgaaa 300

atcagcagag tggaggctga ggatgttggg gtttattact gcatgcaagg tttagagttt 360

cctcggacgt tcggccaagg gaccaaggtg gagatcaaa 399

<210> 26

<211> 426

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

atgaacttcg ggctcagctt gattttcctt gtcctaattt taaaaggtgt tcagtgtgag 60

gtgcagctgt tggagtctgg aggagaggtg aaaaggcccg gggaatctct gaggatctcc 120

tgtaagactt ctggatacag ctttaccacc tactggatca gctgggcgcg ccagatgccc 180

gggaaaggcc tggagtggat ggggatgatc tatcctggtg attctgatac cagatacagc 240

ccgtccttcc aaggccaggt cgccatctca gccgacaagt ccatcaccac cacctacctg 300

cagtggagca gcctgaaggc ctcggacacc gccacgtatt actgtgcaaa aggggcctca 360

gcggctgcaa tccatgagta tggtttggat tcctggggcc aaggggtcgt cgtcaccgtc 420

tcctca 426

<210> 27

<211> 405

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

atggattcac aggcccaggt tcttatgtta ctgctactat gggtatctgg tacctgtggg 60

cagcctgtgc tgactcagcc aacctccctc tcagcatctc ctggagcatc agccagactc 120

acctgcacct tgaacagtgg catcagtgtt ggttattaca ggatgttctg gtaccagcag 180

aagccaggga gtcctcccca gtatcttctg aacttctaca cggactcaga taaaccccag 240

gactctgggg tccccagccg cttctctgga tccaaagatg cttcggccaa tgcaggagtt 300

ttactcatct ctggactcca gtctgaggat gaggctgact attactgtat ggttaaccac 360

aacaatactt gggtattcgg cggagggact cggctgaccg tccta 405

Claims

1. A human antibody expression plasmid system is characterized in that the human antibody expression plasmid system comprises a human antibody heavy chain expression plasmid and a human antibody light chain expression plasmid, wherein the human antibody heavy chain expression plasmid contains a heavy chain variable region homologous arm recombination sequence, a human antibody heavy chain encoding gene is integrated into the human antibody heavy chain expression plasmid through homologous recombination, the human antibody heavy chain encoding gene is carried by the human antibody heavy chain expression plasmid, the homologous arm recombination sequence is identical to the heavy chain variable region homologous arm recombination sequence, the human antibody light chain expression plasmid contains a light chain variable region homologous arm recombination sequence, and the human antibody light chain encoding gene is carried by the human antibody light chain encoding gene, and the homologous arm recombination sequence is identical to the light chain variable region homologous arm recombination sequence and is integrated into the human antibody light chain expression plasmid through homologous recombination.

2. The human antibody expression plasmid system of claim 1, wherein the upstream homologous arm recombination sequence of the heavy chain variable region is shown as SEQ ID No.12, and the upstream homologous arm recombination sequence of the light chain variable region is shown as SEQ ID No.14 or SEQ ID No. 16.

3. The human antibody expression plasmid system of claim 2, wherein the human antibody heavy chain expression plasmid further comprises an antibody heavy chain signal peptide encoding gene and an antibody heavy chain constant region encoding gene, and wherein the human antibody heavy chain expression plasmid further comprises an antibody light chain signal peptide encoding gene and an antibody light chain constant region encoding gene.

4. The humanized antibody expression plasmid system of claim 3, wherein two cleavage sites Hpa I and Srf I are introduced at the downstream gene encoding the antibody heavy chain signal peptide and the upstream gene encoding the antibody heavy chain constant region, respectively.

5. The humanized antibody expression plasmid system of claim 4, wherein the sequence between the antibody heavy chain signal peptide encoding gene and the antibody heavy chain constant region encoding gene is shown in SEQ ID No. 1.

6. The human antibody expression plasmid system of claim 3, wherein the light chain of the antibody is a Kappa chain, and two cleavage sites Kpn I and Pme I are introduced upstream of the gene encoding the signal peptide of the Kappa chain and the gene encoding the constant region, respectively.

7. The human antibody expression plasmid system of claim 6, wherein the sequence between the Kappa chain signal peptide-encoding gene and the Kappa chain constant region-encoding gene is represented by SEQ ID NO. 2.

8. The human antibody expression plasmid system of claim 3, wherein the light chain of the antibody is a Lambda chain, and two cleavage sites Kpn I and Pml I are introduced upstream of the downstream gene encoding a Lambda chain signal peptide and the gene encoding a constant region, respectively.

9. The human antibody expression plasmid system of claim 8, wherein the sequence between the Lambda chain signal peptide-encoding gene and the Lambda chain constant region-encoding gene is represented by SEQ ID No. 3.

10. The humanized antibody expression plasmid system of any one of claims 1 to 9, wherein the sequence of the antibody heavy chain signal peptide coding gene is shown as SEQ ID No.18, and the sequence of the antibody heavy chain constant region coding gene is shown as SEQ ID number 19.

11. The human antibody expression plasmid system of any one of claims 1 to 9, wherein the sequence of the gene encoding the Kappa chain signal peptide of the antibody is represented by SEQ ID number 20, and the sequence of the gene encoding the constant region of the Kappa chain of the antibody is represented by SEQ ID number 21.

12. The human antibody expression plasmid system of any one of claims 1 to 9, wherein the sequence of the encoding gene for the signal peptide of the Lambda chain of the antibody is represented by SEQ ID number 22, and the sequence of the encoding gene for the constant region of the Lambda chain of the antibody is represented by SEQ ID No. 23.

13. A method for preparing a human antibody expression plasmid system according to any one of claims 1 to 9, comprising the steps of:

(1) obtaining a gene fragment with an antibody heavy chain signal peptide coding gene and an antibody heavy chain constant region coding gene, and introducing a restriction enzyme site and a non-antibody gene related gene into the antibody heavy chain signal peptide coding gene and the antibody heavy chain constant region coding gene; or

(2) obtaining a recombinant sequence containing a homologous arm of a heavy chain variable region and a double restriction enzyme digestion fragment of an eukaryotic cell expression vector with a human cytomegalovirus early promoter element CMV, an enhanced expression element WPRE, a poly A tail gene and an ampicillin resistance gene;

14. A method for preparing a humanized antibody using the human antibody expression plasmid system of any one of claims 1 to 9, comprising the steps of:

(1) carrying out homologous recombination on a linearized humanized antibody heavy chain expression plasmid and a humanized antibody light chain expression plasmid with a heavy chain variable region gene and a light chain variable region gene of an antibody to be prepared respectively, wherein homologous arm recombination sequences which are the same as a heavy chain variable region homologous arm recombination sequence and a light chain variable region homologous arm recombination sequence of a humanized antibody expression plasmid system are arranged at the 5' ends of the heavy chain variable region gene and the light chain variable region gene respectively;

(2) expressing the humanized antibody heavy chain expression plasmid system and the humanized antibody light chain expression plasmid system which carry the heavy chain variable region gene and the light chain variable region gene obtained in the step (1), and recovering an expression product.

15. The method of claim 14, wherein the heavy chain variable region homologous arm recombination sequence is set forth in SEQ ID No.12, and the light chain variable region homologous arm recombination sequence is set forth in SEQ ID No.14 or SEQ ID No. 16.