CN114480491A - Construction and application of GRIN2A gene mutation cognitive impairment mouse model - Google Patents

Abstract

The present invention studies a new mutation of a gene known to have a strong influence on neurodevelopmental disorders and its risk for cognitive disorders; the invention aims to establish a new cognitive impairment mouse model based on the clinical discovery that the 2636 th gene locus of a GRIN2A gene coding region causes 879 th amino acid mutation (K879R, lysine mutation is arginine) to cause comprehensive developmental retardation data; the LTP and LTD of the gene mutation model mouse are seriously damaged, the synaptic plasticity is damaged, and the phenotype of learning and memory damage is shown; provides a proper tool for the neurobiological pathogenesis of the cognitive disorder and provides a new idea for the clinical development and the intervention of the cognitive disorder drugs.

Description

Construction and application of GRIN2A gene mutation cognitive impairment mouse model

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a new mutation of a GRIN2A gene which is newly discovered in a crowd and causes cognitive impairment, wherein the gene mutation model mouse has synaptic plasticity damage, both LTP and LTD are damaged, and behavioristics shows learning and memory dysfunction, and the gene mutation model mouse can be used as a new animal model of cognitive impairment and is used for research and development of medicaments for mental, memory, language, attention and visual space disorders in human.

Background

Cognitive functions are a group of functions including memory, general intelligence, learning, language, orientation, perception, attention, judgment, and concentration. Cognitive impairment is a serious neurological disorder that may occur during fetal development, at birth, shortly after birth or at any time during life. Sometimes, the cause of cognitive impairment is not determinable, especially in newborns or young children. Some diseases are associated with cognitive disorders in children, such as epilepsy, hyperactivity, diabetes, beta-thalassemia, hepatitis, and the like. It is therefore extremely important to understand cognitive function and to intervene early in children to prevent cognitive deterioration.

Cognitive disorders are primarily manifested in humans as intellectual, memory, speech, attention and visuospatial disorders, and in mice as disorders of learning and memory. The research shows that synaptic plasticity is the basis of learning and memory, the synaptic plasticity comprises LTP and LTD, in the LTP, a large amount of calcium ions flow in, so that CaMK2 autophosphorylation is activated, AMPAR Ser845Ser831 is increased so that the upper membrane is increased, and the postsynaptic current is obviously enhanced, and the LTD activates PP1 and CN-calcineurin, so that dephosphorylation and internalization are carried out, so that the postsynaptic current is obviously weakened, and the NMDAR is required to participate in the two processes and is an important calcium-permeable receptor.

NMDA receptors (NMDAR) are ionotropic glutamate receptors, expressed throughout the brain, that mediate excitatory neurotransmission important for development, learning, memory and other higher cognitive functions, and are involved in neurological disorders. NMDA receptors are heterotetrameric structures composed of four subunits that together form a central ion channel pore. And the subunits that make up the NMDAR include GluN1, GluN2, and GluN 3. The most common NMDA receptor is composed of two GluN1 subunits and 2 GluN2 subunits. In the sub-species of NMDA receptor, different types and compositions of GluN2 subtype have the greatest influence on the function of NMDA receptor, and can cause different synaptic response time courses and influences on synaptic strength and plasticity, thereby influencing neuron function, electrical activity and nervous system development and participating in a plurality of physiological and pathological processes such as learning memory, synaptic plasticity, ischemic brain injury, emotional disturbance, epilepsy and the like [ 1 ].

Each subunit of the NMDA receptor has structural similarity and consists of four parts: extracellular amino terminal structure (ATD); an extracellular Ligand Binding Domain (LBD) or Agonist Binding Domain (ABD); a transmembrane domain (TMD); intracellular Carboxy Terminal Domain (CTD) [ 2 ].

The development of next generation sequencing technologies has facilitated the study of NMDAR in central nervous system diseases as well as drugs. To date, hundreds of mutations have been found in the gene encoding NMDAR, particularly the GRIN2A gene variation closely associated with central nervous system disease [ 3 ]. Variation of GRIN2A was scattered in all domains, and gain-of-function GluN2A variants were generally associated with enhanced agonistic potency, reduced channel decay time, and reduced sensitivity to channel blockers [ 4-8 ]. In contrast, GluN2A loss-of-function mutants often result in altered channel characteristics that result in increased sensitivity to negative regulators or in decreased function [ 9-12 ]. These mutations are mainly located in the Ligand Binding Domain (LBD) and the pore forming transmembrane domain (TMD). However, little research has been done on mutations in the GluN2A CTD region.

In recent years, there is a trend of increasing the number of drugs in the central nervous system in research based on NMDAR, such as antagonists, subunit-selective antagonists, and site-partial agonists, among which the research on drugs for epilepsy of NMDAR and alzheimer's disease is relatively extensive, but few drugs for cognitive impairment in children and infants are available. Also, the changes in receptor function that occur as a result of gene mutations directed to different regions of the NMDAR are different. For example, it is known that 70% of ABD region mutations cause receptor loss of function (loF), and 56% of TMD region mutations cause gain of function (GoF) [ 13 ]. Therefore, currently known under-study drugs tend to reverse NMDAR dysfunction caused by genetic variation, such as agonists, competitive antagonists, noncompetitive antagonists, and positive and negative allosteric modulators, etc., by performing corresponding negative or positive modulation on mutated receptors. However, the CTD structure domain of each subunit of the NMDAR participates in the stabilization, transportation, targeted degradation and post-translational modification of the membrane, so that the NMDAR has great specificity and great difference in sequence and length. It is unlikely that NMDAR dysfunction caused by GluN2A CTD domain variation would be reversed by merely corresponding negative or positive modulation of the mutated receptor by the drug. Therefore, the research of the pathogenesis of early cognitive impairment caused by personalized GluN2A CTD region mutation and the diagnosis and treatment of the early cognitive impairment are of particular significance.

Cognitive disorders are an important class of diseases of the nervous system, and there is a need to develop effective intervention and therapeutic drugs. In designing and developing new drugs, animal models of cognitive impairment must be utilized. Experimental animal models of cognitive impairment are consistent with the phenotype and mechanism of human cognitive impairment. An ideal cognitive disorder model should have the following conditions: morphologically, the number of mature dendritic spines of the neurons of the hippocampus is obviously reduced; secondly, learning and memory abilities of behaviours related to cognitive abilities, such as new object recognition, Y maze, water maze and other experiments, are impaired; decrease of synaptic transmission ability of hippocampal neurons related to learning and memory ability; and the synaptic plasticity of the hippocampal neurons is reduced. Until now, there is no specific genetic animal model for GluN2A CTD region mutation for cognitive impairment. Therefore, the research on the mechanism of the cognitive disorder has particularly important clinical significance, and a new model tool is provided for the research and development of drugs for interfering the cognitive disorder.

Reference to the literature

【1】Paoletti P,Neyton J.NMDA receptor subunits:function and pharmacology.Curr Opin Pharmacol.2007；7(1):39-47.doi:10.1016/j.coph.2006.08.011

【2】Hansen KB,Yi F,Perszyk RE,Menniti FS,Traynelis SF.NMDA Receptors in the Central Nervous System.Methods Mol Biol.2017；1677:1-80.doi:10.1007/978-1-4939-7321-7_1

【3】Yuan H,Low CM,Moody OA,Jenkins A,Traynelis SF.Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.Mol Pharmacol.2015；88(1):203-217.doi:10.1124/mol.115.097998

【4】Chen,W.et al.Functional Evaluation of a De Novo GRIN2A Mutation Identified in a Patient with Profound Global Developmental Delay and Refractory Epilepsy.Molecular pharmacology 91,317-330,doi:10.1124/mol.116.106781(2017).

【5】Marwick,K.F.M.,Skehel,P.A.,Hardingham,G.E.&Wyllie,D.J.A.The human NMDA receptor GluN2A(N615K)variant influences channel blocker potency.Pharmacology research&perspectives 7,e00495,doi:10.1002/prp2.495(2019).

【6】Endele,S.et al.Mutations in GRIN2A and GRIN2B encoding regulatory subunits of NMDA receptors cause variable neurodevelopmental phenotypes.Nature genetics 42,1021-1026,doi:10.1038/ng.677(2010).

【7】Ogden,K.K.et al.Molecular Mechanism of Disease-Associated Mutations in the Pre-M1Helix of NMDA Receptors and Potential Rescue Pharmacology.PLoS genetics 13,e1006536,doi:10.1371/journal.pgen.1006536(2017).

【8】Lesca,G.et al.GRIN2A mutations in acquired epileptic aphasia and related childhood focal epilepsies and encephalopathies with speech and language dysfunction.Nature genetics 45,1061-1066,doi:10.1038/ng.2726(2013).

【9】Gao,K.et al.A de novo loss-of-function GRIN2A mutation associated with childhood focal epilepsy and acquired epileptic aphasia.PloS one 12,e0170818,doi:10.1371/journal.pone.0170818(2017).

【10】Addis,L.et al.Epilepsy-associated GRIN2A mutations reduce NMDA receptor trafficking and agonist potency-molecular profiling and functional rescue.Scientific reports 7,66,doi:10.1038/s41598-017-00115-w(2017).

【11】Sibarov,D.A.et al.Functional Properties of Human NMDA Receptors Associated with Epilepsy-Related Mutations of GluN2A Subunit.Frontiers in cellular neuroscience 11,155,doi:10.3389/fncel.2017.00155(2017).

【12】Swanger,S.A.et al.Mechanistic Insight into NMDA Receptor Dysregulation by Rare Variants in the GluN2A and GluN2B Agonist Binding Domains.American journal of human genetics 99,1261-1280,doi:10.1016/j.ajhg.2016.10.002(2016).

【13】XiangWei W,Jiang Y,Yuan H.De Novo Mutations and Rare Variants Occurring in NMDA Receptors.Curr Opin Physiol.2018；2:27-35.doi:10.1016/j.cophys.2017.12.013.

Disclosure of Invention

To solve the above problems, the present inventors studied a new mutation of a gene known to have a strong influence on neurodevelopmental disorders and the risk thereof on cognitive disorders. The invention aims to establish a new cognitive impairment mouse model on the basis of the genealogy data which is obtained by mutating the 2636 th site gene site (c.2636A > G) of a GRIN2A coding region to 879 th site lysine to arginine (p.K879R) and causes overall developmental retardation. The gene-mutated model mice have severely impaired LTP and LTD, impaired synaptic plasticity, and an impaired learning and memory phenotype. Provides a proper tool for the neurobiological pathogenesis of the cognitive disorder and provides a new idea for the clinical development and the intervention of the cognitive disorder drugs.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the invention discloses application of 2636 th site mutation (c.2636A > G/p.K879R) in a coding region of a GRIN2A gene in constructing a cognitive impairment animal model.

Furthermore, the 2636 th position of the encoding region of the GRIN2A gene is a/g hybrid type.

The invention discloses application of 2636 th site mutation (c.2636A > G/p.K879R) animal models of a GRIN2A gene coding region in cognitive impairment, wherein the application comprises but is not limited to drug screening, therapeutic effect evaluation and diagnostic target discovery.

The invention discloses a cognitive disorder animal model, wherein the 2636 th position of a GRIN2A gene coding region is an a/g hybrid type.

The invention discloses a preparation method of a cognitive disorder animal model, which comprises the following steps:

(1) designing a pair of sgRNA recognition sequences according to a K879 site peripheral sequence to construct a sgRNA;

(2) constructing a corresponding Donor vector according to the sgRNA;

(3) injecting a Donor vector to the fertilized egg in a microinjection manner and transplanting the fertilized egg to a supervolved receptor mouse to obtain a fountain mouse;

(4) screening out a positive fountain mouse by PCR gene identification and sequencing, backcrossing the positive fountain mouse and a C57BL6/J background mouse to obtain an F1 generation, mutually matching and breeding the F1 generation, obtaining homozygous and heterozygous gene knock-in mutant mice (KI) by PCR primer and sequencing, and performing open field experiments, Y maze experiments, new object identification, conditional fear, Morris water maze, synaptic plasticity and other experiments on the mutant mice and a contrast wild mouse from three months to determine the cognitive disorder phenotype.

Further, in the step (1), the sequence of the sgRNA is SEQ ID No.1 and SEQ ID No. 2.

Further, in the step (3), a sequence around the mutation knock-in site in the Donor vector is shown as SEQ ID No.3, and a 44bp insertion sequence is made in an intron region at the upstream of the mutation site in the Donor vector is shown as SEQ ID No. 4. Further, in the step (4), the PCR primers comprise a forward primer and a reverse primer, the sequence of the forward primer is shown as SEQ ID NO.5, and the sequence of the reverse primer is shown as SEQ ID NO. 6.

The clinical data of the invention is found on the basis of a proband of intellectual disability and the data of all family members are collated and a family spectrogram is drawn (the data is not published), a member blood sample is extracted to extract DNA, the GRIN2A exon region is amplified, the amplified fragment is sequenced, the sequencing sequence is compared with the sequence of the wild GRIN2A genome exon region in GenBank, and the mutation of the 2636 th gene locus (c.2636A > G) in the GRIN2A gene coding region, which causes the 879 th amino acid lysine to be mutated into arginine (p.K987R), is screened through comparison. Sequencing validation showed that the proband carrying this mutation rarely inherited the variant from her father.

The model preparation of the invention is to use Cas9/RNA system gene targeting technology to construct mice with mutation at the site of Grin2a-K879R on the basis of finding that human GRIN2A gene (ID:4585) and mouse Grin2a gene (ID:95820) have high homology by comparison, and to obtain homozygous and heterozygous Grin2a gene mutant mice by breeding. The behavior of male mice was systematically analyzed starting at 3 months of age. There was no significant difference in the ability of WT, KI/+ and KI/KI mice to move in the open field test. In the Y maze test, KI/KI mice have impaired memory capacity compared to WT mice. In the new object recognition test, KI/KI mice explore new objects less often than WT mice. In the Morris water maze test, KI/KI and KI/+ mice spend more time searching for platforms than WT mice, suggesting that their spatial learning capabilities are deficient. After platform removal, KI/+ and KI/KI mice spend more time searching for the original platform, and pass through the original platform less often than WT mice, indicating impaired spatial memory of KI/KI mice. In the conditional fear test, the catalepsy time was significantly reduced in KI/KI mice compared to WT mice, indicating that K879R disrupts the fear memory. Taken together, these results indicate that the K879R mutation results in impaired cognitive performance, but does not affect motor activity.

The invention has the beneficial effects that: the invention firstly prepares a mouse with a mutation at a corresponding site according to the discovery of a new single-site mutation of the GRIN2A gene in a patient with mental disorder, and the mouse with the mutation at the K879R site knocked in has learning and memory disorders. The new mutation site knock-in model mouse provides a good model for researching the molecular mechanism of cognitive disorder, and provides a good choice for screening and developing the aspects of drug screening, treatment effect evaluation, diagnosis target discovery and the like for intervening the cognitive disorder.

Drawings

FIG. 1 is a strategy diagram for constructing a mutant mouse Grin2 a-K879R;

FIG. 2 shows the result of gene sequencing identification of positive F1 mouse, in which the upper diagram shows the sequence of wild C57BL/6 mouse, and the lower diagram shows the result of sequencing of positive F1 mouse;

FIG. 3 shows the results of open field experiments on mice homozygous, heterozygous and wild for the Grin2a-K879R mutation, where A is the total distance traveled by the mice; b is the time spent by the mouse in the central region;

FIG. 4 shows the results of experiments for identifying novel objects from Grin2a-K879R mice homozygous, heterozygous and wild;

FIG. 5 shows the results of Y maze experiments on mice homozygous, heterozygous and wild for the mutation from Grin2a-K879R, wherein A is the total arm-entering times of the mice; b is the spontaneous alternate behavior score of the mice;

FIG. 6 shows the results of Morris water maze experiments on mice homozygous, heterozygous and wild for the Grin2a-K879R mutation, wherein A is the incubation period for the mice to find the platform during the training stage of hiding the platform, B is the incubation period for the mice to find the platform after removing the platform, C is the number of times the mice pass through the platform after removing the platform, and D is the number of times the mice enter the platform after removing the platform;

FIG. 7 shows the results of conditioned fear experiments in mice homozygous, heterozygous and wild for the Grin2a-K879R mutation;

FIG. 8 shows the results of experiments on synaptic plasticity of mice homozygous, heterozygous and wild for the mutation Grin2a-K879R, wherein A and B are the results of experiments on LTP projected by acute Sheffer's lateral shoot-CA 1 in mice, and C and D are the results of experiments on LTD projected by acute Sheffer's lateral shoot-CA 1 in mice.

Detailed Description

The present invention will be further illustrated with reference to the accompanying drawings and specific embodiments, which are to be understood as merely illustrative of the invention and not as limiting the scope of the invention.

Example 1

Preparation of mouse model for cognitive impairment

1. Design, construction and purification of vectors

(1) For the mouse Grin2a-201(ENSMUST00000032331.7) gene, a CRISPR Design tool (http:// CRISPR. mit. edu /) of the college of science and technology of Massachusetts was used, and a target DNA of 20bp in length was designed according to the height of Score, wherein the target DNA sequence 1 was Gps00002426-Grin2a-5S1(TACAAGCAGTAACAATTGGC (SEQ ID NO.1)), and the target DNA sequence 2 was Gps00002426-Grin2a-3S1(GACCCAGTCAGATTGAAGTC (SEQ ID NO. 2)). Cas9 protein is combined to a target site under the guidance of gRNA to cause DNA double-strand break, and a Donor vector repairs the broken double strand through homologous recombination, thereby realizing the gene knock-in of the DNA sequence of the target site. Information around the mutation knock-in site in the Donor vector is

(SEQ ID NO. 3). Underlined bases are the intended mutations, while double underlined positions are synonymous mutated bases for disruption of PAM in order to avoid cleavage of the knock-in sequence on the Donor vector by cas9 protein. Constructing a mutation site on a Donor vector, and preparing a 44bp insertion sequence (TCTGAGGCGGAAAGAACCAGATGTTCTTGCCCAAGGTCAGTTGG (SEQ ID NO.4)) in an intron region upstream of the No. 12 exon where the mutation site is located, wherein the insertion sequence is used for subsequent positive clone screening and mouse gene identification.

(2) The designed sequence was synthesized as a product of PAGE. Annealing the synthesized 2 single-stranded oligonucleotide sgRNA sequences (naturally cooling to room temperature after 5min at 95 ℃) to form double-stranded DNA, linking the double-stranded DNA with pGK1.1linear vector under the action of T4 DNA ligase to construct a sgRNA expression vector, transforming a recombinant plasmid into a DH5a competent cell, screening and identifying a positive cloning plasmid through kanamycin resistance of pGK1.1linear vector and sequencing of target DNA, selecting a correct colony clone, and extracting the plasmid for preparing an in vitro transcription template after amplification culture. And (2) making a Donor fragment carrying a target site homology arm and a target knock-in sequence, connecting the Donor fragment with a T-vector, constructing a Donor vector, transforming the recombinant plasmid into a DH5a competent cell, screening and identifying positive clone plasmids through ampicillin resistance of the T-vector and sequencing of an inserted fragment, selecting correct colony clone, extracting the plasmid after amplification culture, and purifying to obtain the Donor vector for injection.

Construction of the mouse mutant Grin2a-K879R the strategy diagram is shown in FIG. 1, the top Target Vector fragment shows that a partial fragment of the Donor Vector contains 44bp of insertion sequence and point mutation, the middle part shows the exon structure of the wild-type Grin2a gene (the lower 1-12 numbers represent 1-12 exons), and the bottom diagram shows that a partial fragment of the Donor Vector is integrated into the Grin2a gene after the Grin2a gene is edited.

2. Sample preparation and microinjection

(1) In vitro transcription of the sample: the expression vector of the sgRNA is linearized by DraI enzyme digestion, extracted and purified by phenol chloroform, dissolved in nuclease-free water as a template for in vitro transcription, and synthesized into the sgRNA by T7 RNA polymerase outside a MEGAshortscript Kit (Ambion, AM1354) reagent Kit;

(2) microinjection of Cas9/sgRNA and Donor: mixing the Cas9 protein, sgRNA and the purified Donor fragment, adjusting the concentration of the sgRNA to 10 ng/. mu.l and the Donor fragment to 50 ng/. mu.l, microinjecting the mixture into the proto-nucleus and cytoplasm of fertilized eggs of a C57BL/6 mouse by using a TE2000U microinjection instrument, transplanting the fertilized eggs into the uterus of a pseudopregnant C57BL/6 mother mouse, and waiting for the birth of a fountain mouse;

3. identification and passage of positive mice

At 5-7 days after birth, the mice are marked by a toe shearing method, cut rat tail tissues are subjected to DNA extraction by a phenol chloroform method, and primers (a forward primer: TCTGAGGCGGAAAGAACCAG (SEQ ID NO. 5); and a reverse primer: GGCCACAAATGTTTGCAGTTC (SEQ ID NO.6)) designed in a target region are identified. The PCR reaction system was 20. mu.L, containing 12.5. mu.L of 2 XTaq Master mix (Vazyme, China), 1. mu.L of 10. mu.M forward primer, 1. mu.L of 10. mu.M reverse primer, 1. mu.L of prepared genomic DNA template, and 9.5. mu.L of ultrapure water. The reaction conditions are as follows: 95 ℃ for 5 min; 35 cycles (95 ℃, 30 seconds; 65 ℃ (-0.5 ℃/cycle), 30 seconds; 72 ℃, 45 seconds); (95 ℃ C., 30 seconds; 55 ℃ C., 30 seconds; 72 ℃ C., 45 seconds) at 72 ℃ C., 5 min. The size of the PCR product is 682 bp. And selecting a PCR positive sample for sequencing. Mating the correctly sequenced fountain mouse with the wild C57BL/6 mouse to generate F1 mouse, identifying the F1 mouse according to the identification method of the fountain mouse, and obtaining the positive F1 heterozygote mouse which can be stably inherited.

The positive F1 generation mouse gene sequencing identification result is shown in figure 2, wherein the upper graph is the sequence of wild C57BL/6 mouse, and the lower graph is the sequencing result of positive F1 generation mouse.

Example 2

Open field detection of mice

The experimental environment is required to be closed and quiet, and the sound insulation of a laboratory is better, so that the influence of the external environment and the sound can be avoided. The size of the open box for the open field experiment in the laboratory is (50cm multiplied by 20cm) length multiplied by width multiplied by height, and the middle of the open box is a central area of 20cm multiplied by 20 cm. The central region is 10cm from the box edges on each side. The camera system is vertically arranged above the open box. During the experiment, the mouse is lightly placed at the center of the open field box, then the software is opened, the movement track of the mouse is collected for 20min, and the times of entering the open field center and the staying time of the mouse are recorded. After the experiment of each mouse, the residual odor of each mouse was removed by wiping with 75% ethanol to prevent the effect on the next mouse.

Results of the open field experiments for the homozygous (KI/KI), heterozygous (KI/+) and wild type mice (+/+) Grin the Grin2a-K879R mutation are shown in FIG. 3, with 13 wild type mice moving a total distance of 24.44. + -. 0.88 (mean. + -. SEM) and spending time in the central region of 6.00. + -. 0.86. The average total distance traveled by 15 mice heterozygous for Grin2a-K879R was 24.92 ± 1.30, and the time spent in the central region was 5.72 ± 0.70. The average total distance traveled by 13 mice homozygous for Grin2a-K879R was 20.81 ± 1.45, and the time spent in the central region was 4.74 ± 0.61. There were no statistical differences between the data of the three groups of mice, indicating that the motor activity of the mice was not significantly different.

Example 3

Cognitive disorder-related behavioral detection

1. And (3) identifying and detecting a new object: the camera system is vertically placed above the new object recognition box. First, two identical objects were placed at the left and right ends of one side of a box (50cm × 50cm × 20cm, length × width × height) identified by the new object, and the mouse was placed in the box with the two objects facing away from it, and allowed to freely explore for 10 min. (in order to ensure the recognition effect of the same object, the time for the mouse to search for two objects is preferably longer than 20s respectively, if the mouse does not recognize the object, the data can be removed at the later stage as appropriate.) after the recognition of each mouse is finished, the object and the bottom of the box are cleaned by 70% ethanol, and the olfaction suggestion is reduced. And after 24h, changing one object into a new object with different shapes, testing for 10min, analyzing the time for identifying the new object and the old object by the mouse, and calculating the time for exploring each object by the mouse.

Results of experiments for identifying new objects of Grin2a-K879R homozygous (KI/KI), heterozygous (KI/+) and wild type mice (+/+) are shown in fig. 4, and the Grin2a-K879R homozygous mice have obviously reduced preference for new objects compared with wild type mice at this stage, which indicates that the memory function is reduced.

Y maze detection: the center of a mouse facing the maze is placed at the tail end of any arm of the Y maze, the mouse is allowed to freely explore for 8min in three arms of the Y maze, a camera system records the behavior change of the animal for 8min, and the following indexes are recorded: (ii) total arm-advance number (the total number of entries): the times of the animals entering the maze arm (taking the standard that four feet of the mouse enter the arm once); ② alternate (alternate) one time (an alternation): enter the Y maze in sequence and continuously for all three arms once. (iii) maximum number of turns (The number of maximum alternates): total arm-advance times-2. Spontaneous rotation behavior score is total rotation/maximum rotation 100%, and the calculated results are used for statistical analysis.

Results of experiments of mutant homozygous (KI/KI), heterozygous (KI/+) and wild type mice (+/+) Y maze of Grin2a-K879R are shown in FIG. 5, and results of spontaneous alternate behavior scores of 15 wild type mice, 13 heterozygous mutant mice and 11 homozygous mutant mice are analyzed, and the results show that the spontaneous alternate behavior scores of Grin2a-K879 homozygous mutant mice are obviously lower than those of wild type mice (FIG. 5B) on the basis of no obvious difference of total arm entering times (FIG. 5A), which indicates that the working memory of Grin2a-K879 homozygous mutant mice is damaged relative to that of wild type mice.

Morris water maze experiment: the pond (diameter 1.5m, height 50cm, depth 30cm) was divided into A, B, C, D quadrants, optionally with the platform (diameter 12cm, height 29cm) centrally located in the quadrant, submerged 1cm below water, making the platform invisible. The periphery of the pool is adhered with abundant reference clues (geometric figures such as triangles, squares, circles, diamonds and the like are arranged in each quadrant) and kept unchanged, so that the mouse can be used for positioning the platform. The camera is arranged about 3 meters above the water pool and is connected with the computer. And in the training stage, the mouse is put into water from four different quadrants respectively, the time for the mouse to find the underwater platform is recorded, and if the time exceeds 60s, the mouse is guided to reach the platform and stays on the platform for 15 s. Four times per day for 6 days. And (4) removing the platform on the 7 th day, putting the animal into water from the opposite side of the quadrant of the original platform, and recording the time when the mouse first reaches the position of the original platform, the residence time of the mouse in the platform area and the times of passing through the platform area within 60 s.

Results of experiments on mutant homozygous (KI/KI), heterozygous (KI/+) and wild-type mice (+/+) Morris water maze are shown in FIG. 6, in the training stage of the hidden platform, the latency of the mutant heterozygous and homozygous Grin2a-K879R mice for finding the platform is obviously higher than that of the wild-type mice (FIG. 6A), and after the platform is removed, the latency of mutant homozygous Grin2a-K879R mice for finding the platform is increased (FIG. 6B), the times of passing through the platform (FIG. 6C) and entering the platform (FIG. 6C) are also reduced, which indicates that the cognitive abilities of learning, memory and the like of the mutant homozygous Grin2a-K879R mice are reduced relative to the wild-type mice.

4. Conditioned fear detection: mice were placed in a conditioned fear box and 3 shocks (0.2mA, duration 2s, 1 minute interval) were given 2 minutes later. After 5min, the mice were removed and returned to their cages. After 24h, mice were placed back in the conditioned fear box without shock and recorded for 5 minutes. The rigor behavior of the mice was monitored by overhead cameras and the time to rigor of the mice was measured by an automatic scoring system.

Results of the mutant homozygous (KI/KI), heterozygous (KI/+) and (+/+) conditioned fear experiments of the wild-type mice are shown in FIG. 7, and the catalepsy behavior of the mutant homozygous Grin2a-K879R mice is obviously lower than that of the wild-type mice, which indicates that the fear memory of the mutant homozygous Grin2a-K879R mice is impaired.

Example 4

Electrophysiological detection of cognitive disorders

We cut 350 μm acute brain slices with a vibrating microtome 14-21 days after birth, record LTP and LTD projected by Scheffer lateral-CA 1 in ACSF (containing PTX, Bic) bath, place stimulation electrodes in the region of Scheffer lateral, and place recording electrodes in CA1 pyramidal cells. After recording the EPSC for 5min smoothly, respectively giving a high-frequency stimulation of 90s and 2Hz or a low-frequency stimulation of 15min and 1Hz to induce the generation of LTP and LTD respectively, continuously recording the EPSC for 1h after stimulation, and finally counting the times of increasing or decreasing the EPSC after stimulation relative to the times before stimulation.

Results of experiments on synapse plasticity of Grin2a-K879R mutation homozygous (KI/KI), heterozygous (KI/+) and wild type mice (+/+) are shown in fig. 8, and results of experiments on LTP and LTD projected by schofura lateral shoot-CA 1 of three genotype mice are analyzed, and compared with wild type mice, LTP (fig. 8A) and LTD heterozygous and homozygous for Grin2a-K879R mutation are reduced (fig. 8B), which indicates that Grin2a-K879R mutation causes synapse plasticity damage.

Statistical method

Statistical analysis was performed using SPSS19.0 with the level of statistical significance set at P <0.05, using mean ± standard deviation (mean ± SD), and Leven's test method to test normality and homogeneity of variance. If the normality and the homogeneity of variance are met, carrying out statistical analysis by using a T test (T-test); if the normality and variance are not met, the Kruskal-Wallis test is used. If the Kruskal-Wallis Test is statistically significant (P <0.05), then a comparative analysis is performed using Dunnett's Test (nonparametric method). Statistical differences and biological significance were considered for the evaluation.

It should be noted that the above-mentioned contents only illustrate the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and it is obvious to those skilled in the art that several modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations fall within the protection scope of the claims of the present invention.

Sequence listing

<110> Nanjing City health care hospital for women and children

<120> construction and application of GRIN2A gene mutation cognitive impairment mouse model

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tacaagcagt aacaattggc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gacccagtca gattgaagtc 20

<210> 3

<211> 111

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgtccctcac agggcatcta cagttgcatc catggagtgc acattgaaga aaggaagaag 60

tctccagatt tcaatctcac tgggtcacag agcaacatgc taaagcttct c 111

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctgaggcgg aaagaaccag atgttcttgc ccaaggtcag ttgg 44

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctgaggcgg aaagaaccag 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggccacaaat gtttgcagtt c 21

Claims (8)

1. Application of 2636 th site mutation c.2636A > G/p.K879R in construction of a cognitive disorder animal model in a GRIN2A gene coding region.
2. 2. The use of claim 1, wherein the GRIN2A gene encoding region is a/g hybrid at position 2636.
3. 3, application of 2636 th site mutation c.2636A > G/p.K879R animal model in drug screening, treatment effect evaluation and diagnosis target discovery of cognitive impairment of GRIN2A gene coding region.
4. 4. An animal model of cognitive impairment characterized in that GRIN2A gene encodes a region of the a/g hybrid type at position 2636.
5. 5. A preparation method of an animal model with cognitive impairment is characterized by comprising the following steps:

   (1) designing a pair of sgRNA recognition sequences according to a K879 site peripheral sequence to construct a sgRNA;

   (2) constructing a corresponding Donor vector according to the sgRNA;

   (3) injecting a Donor vector to the fertilized egg in a microinjection manner and transplanting the fertilized egg to a supervolved receptor mouse to obtain a fountain mouse;

   (4) screening out positive fountain mice by PCR gene identification and sequencing, and mixing the positive fountain mice with C57BL6/J

   Carrying out backcross on background mice to obtain F1 generations, carrying out matched breeding on F1 generations, obtaining homozygous and heterozygous gene knock-in mutant mice by PCR primers and sequencing, and carrying out open field experiments, Y maze experiments, new object identification, conditioned fear, Morris water maze, synaptic plasticity and other experiments on the mutant mice and contrast wild mice from three months to determine the cognitive disorder phenotype of the mutant mice.
6. 6. The method for preparing an animal model with cognitive impairment as claimed in claim 5, wherein in step (1), the sgRNA has the sequence of SEQ ID No.1 and SEQ ID No. 2.
7. 7. The method for preparing an animal model with cognitive impairment as defined in claim 5, wherein in step (3), the sequence around the mutation knock-in site in the Donor vector is shown as SEQ ID No.3, and a 44bp insertion sequence is made in the upstream intron region of the mutation site in the Donor vector as shown as SEQ ID No. 4.
8. 8. The method for preparing an animal model with cognitive impairment as defined in claim 5, wherein in step (4), the PCR primers comprise a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID No.5, and the sequence of the reverse primer is shown in SEQ ID No. 6.

Images