CN114480293A - HBB fusion gene modified autologous hematopoietic stem cell, preparation method and application thereof - Google Patents

Abstract

The invention provides an HBB fusion gene modified autologous hematopoietic stem cell, a preparation method and application thereof, belonging to the technical field of genetic engineering, wherein the HBB fusion gene is obtained by sequentially connecting the following modules in series: DNase I hypersensitive site HS2, DNase I hypersensitive site HS3, DNase I hypersensitive site HS4, promoter, enhancer and HSb T88Q; the nucleotide sequence of the HBB fusion gene is shown in a sequence table SEQ ID NO. 1. The invention utilizes the HBB fusion gene modified CD34 after nucleotide optimization⁺The cells, secreting human haptoglobin were higher in number and the number of erythroid colonies was higher.

Description

HBB fusion gene modified autologous hematopoietic stem cell, preparation method and application thereof

Technical Field

The application relates to an HBB fusion gene modified autologous hematopoietic stem cell, a preparation method and application thereof, belonging to the technical field of genetic engineering.

Background

Sickle Cell Disease (SCD) and beta-thalassemia (beta-TM) are the most common monogenic diseases in the world, with about 40 million pregnant women or newborns affected each year. These diseases are two different types of beta-globin gene mutations that result in the occurrence of a substantial reduction or deletion of the aberrant hemoglobin Structure (SCD) or beta-globin chain (beta-TM). The clinical manifestations of such genetic diseases usually occur several months after birth, when gene expression switches from fetal gamma-globin chains to the formation of adult beta a-globin chains (HbA).

Allogeneic Hematopoietic Stem Cell Transplantation (AHSCT) is currently recommended as a therapeutic option for β -TM if there are Human Leukocyte Antigen (HLA) matched sibling donors. post-AHSCT disease-free survival rates were approximately 88% in pediatric subjects and 65% in adults. However, only less than 25% of patients have suitable intrafamilial donors. Despite the improving transplant outcome, AHSCT still presents a significant risk of serious adverse events and mortality, both of which increase with age and disease severity of the recipient. Serious adverse events include graft failure, Graft Versus Host Disease (GVHD), early or late side effects of regulatory regimens (infection, hemorrhage, secondary malignancy) in clearing bone marrow and immunosuppression, and exacerbation of preexisting organ damage.

For patients lacking a suitable hla matched donor, in vitro gene therapy using autologous hematopoietic stem cells holds promise as a potential treatment option. Gene therapy, therapeutic beta-globin gene derivatives are transfected to hematopoietic stem cells by lentiviruses in vitro, so that the specificity of erythrocytes is highly expressed, and the genetic disease is expected to be cured.

CN110582305A is an invention patent of American blue bird biology company, and mainly provides a gene therapy vector for expressing normal hemoglobin, wherein HS4 DNase I hypersensitive sites are lacked, and the expression level of hemoglobin is low.

The CN111447954A patent is mainly directed to the optimization of adenovirus vectors to make them safe and effective. However, in this patent, the nucleotide point mutation or deletion in the HBB gene is selected from other mutations such as deletion of C at position 264 or 265, and the expression level of hemoglobin is low.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides an HBB fusion gene modified autologous hematopoietic stem cell, a preparation method and application thereof, and the following purposes are realized: improve the expression of human haptoglobin and improve the number of erythroid colonies.

In order to solve the technical problems, the invention adopts the following technical scheme:

an autologous hematopoietic stem cell modified by an HBB fusion gene, wherein the HBB fusion gene is obtained by sequentially connecting the following modules in series: DNase I hypersensitive site HS2, DNase I hypersensitive site HS3, DNase I hypersensitive site HS4, promoter, enhancer, HSb T88Q;

the nucleotide sequence of the DNase I hypersensitive site HS2 is shown as SEQ ID NO.2 in the sequence table;

the nucleotide sequence of the DNase I hypersensitive site HS3 is shown as SEQ ID NO.3 in the sequence table;

the nucleotide sequence of the DNase I hypersensitive site HS4 is shown as SEQ ID NO.4 in the sequence table;

the nucleotide sequence of the promoter is shown as SEQ ID NO.5 in the sequence table;

the nucleotide sequence of the enhancer is shown as SEQ ID NO.6 in the sequence table;

the nucleotide sequence of the HSb T88Q is shown as SEQ ID NO.7 in the sequence table.

The following is a further improvement of the above technical solution:

the autologous hematopoietic stem cells are CD34⁺A cell.

The preparation method comprises the steps of constructing a recombinant expression vector pCDH-HBB, packaging lentiviruses and infecting CD34 with the recombinant lentiviruses⁺A cell.

And (3) constructing the recombinant expression vector pCDH-HBB, and inserting the HBB fusion gene into the pCDH vector to obtain the recombinant expression vector pCDH-HBB.

And (3) packaging the lentivirus, and transfecting the recovered 293T cell by adopting a recombinant expression vector pCDH-HBB to obtain the recombinant lentivirus, wherein the titer of the recombinant lentivirus is 1.52 multiplied by 10⁸TU/mL。

The recombinant lentivirus is infected with CD34⁺Cells, recombinant lentivirus with CD34⁺The proportion of the cells is controlled to be 50:1, and the HBB fusion gene modified CD34 is obtained by culturing, screening and expanding culture⁺A cell.

The HBB fusion gene modified autologous hematopoietic stem cells are applied to the preparation of medicines for treating sickle cell disease and beta-thalassemia.

Compared with the prior art, the invention has the following beneficial effects:

the invention utilizes the HBB fusion gene modified CD34 after nucleotide optimization⁺The number of cells, erythroid colonies averaged 540, and the human haptoglobin content was 985.42 mg/L.

Drawings

FIG. 1 is a schematic diagram of an HBB fusion gene;

FIG. 2 shows the pair of recombinant lentiviruses CD34 containing pCDH-HBB⁺Flow chart of infection rate of cells;

FIG. 3 shows pCDH-HBB modified CD34⁺CD34 in cells⁺Flow chart of positive rate;

FIG. 4 shows CD34 pair containing pCDH-HBB-before optimization recombinant lentivirus⁺Flow chart of infection rate of cells;

FIG. 5 is pCDH-HBB-Pre-optimized modified CD34⁺CD34 in cells⁺Flow chart of positive rate;

FIG. 6 is an electrophoretogram of PCR to identify the presence of a gene of interest;

FIG. 7 is a graph showing the number of colonies of HBB fusion gene-modified hematopoietic stem cells.

Detailed Description

EXAMPLE 1 construction of recombinant expression vector pCDH-HBB

The HBB fusion gene module is schematically shown in FIG. 1 (complete nucleic acid sequence shown in appendix SEQ ID NO. 1).

HBB fusion gene module sequence

(1) DNase I hypersensitive locus HS2 (SEQ ID NO.2)

(2) DNase I hypersensitive site HS3(SEQ ID NO.3)

(3) DNase I hypersensitive site HS4(SEQ ID NO.4)

(4) Promoter (SEQ ID NO.5)

(5) Enhancer (SEQ ID NO.6)

（6）HSb T88Q (SEQ ID NO.7)

The DNase I hypersensitive sites HS2-HS4 are core sequences intercepted from full-length sequences;

the application performs codon optimization on the nucleotide sequence of HSb T88Q;

and (2) according to the sequence of the SEQ ID NO.1, trusting Shanghai Jieli bioengineering limited company to synthesize the whole expression frame, inserting a SpeI-NotI site of a pCDH vector (provided by Chinese disease control center virus disease prevention and control), converting to E.coli (Top10), correctly sequencing, and extracting a plasmid by using a plasmid extraction kit of an OMEGA company to obtain a recombinant expression vector pCDH-HBB. In the invention, the concentration of the recombinant expression vector pCDH-HBB is 1.23 mug/muL.

Adopting full-length sequences for DNase I hypersensitive site HS2 and DNase I hypersensitive site HS4, wherein the full-length nucleotide sequence of the DNase I hypersensitive site HS2 is shown as SEQ ID NO.13 in a sequence table; the full-length nucleotide sequence of the DNase I hypersensitive site HS4 is shown as SEQ ID NO.14 in the sequence table; connecting the nucleic acid sequences of SEQ ID NO.13, SEQ ID NO.3, SEQ ID NO.14, SEQ ID NO.5 and SEQ ID NO.6 in sequence, and then connecting the nucleic acid sequences with the nucleotide sequence of HSb T88Q before optimization to obtain an HBB fusion gene sequence (SEQ ID NO. 8) before optimization; the same pCDH vector is adopted as the vector to construct a recombinant expression vector, and the plasmid concentration is 1.05 mug/muL before the vector is named as pCDH-HBB-optimization and other operations are carried out as above.

The nucleotide sequence of HSb T88Q before optimization was: the codon 262-264 of the sequence number CR541913 in NCBI was adjusted to CAG, and the resulting sequence was used as the nucleotide sequence of HSb T88Q before optimization.

Example 2 packaging and Titer assay of lentiviruses

1) Reconstitution of packaging cell lines

The packaging cell line used in the present invention is 293T cell. The frozen 293T cells were taken out of the liquid nitrogen tank, quickly dropped into a 37 ℃ water bath and quickly shaken, and the cell solution was completely dissolved within 2 min as much as possible. Transferring 1mL of cell solution into a50 mL centrifuge tube, adding 35mL of physiological saline to wash DMSO, mixing uniformly, and centrifuging under the following centrifugation conditions: 1500rpm, 5 min. The supernatant was removed, 5mL of fresh high-sugar DMEM (10 Vol% FBS) medium was added to resuspend the cells, and the cells were transferred to T75 flasks, and each flask was further filled with high-sugar DMEM (10 Vol% FBS) medium to a constant volume of 10 mL. The culture flask was placed at 37 ℃ and 5% CO smoothly₂ Cultured in an incubator. Cell viability was observed the next day and the medium was changed. Cell growth was observed daily thereafter, and cells were passaged at 90% of the bottom of the flask after 2 passages for transfection.

2) Lentiviral packaging and titer determination

When 293T cells plated up to 80% after passage 2, they were used for transfection.

Preparation of transfection reagents: prepare Tube A and Tube B reagents (Tube A and) in 5mL centrifuge tubes, respectively

Tube B）

After the preparation, the mixture is placed for 5min, then the tube A is slowly added into the tube B, and the mixture is uniformly mixed. Standing at room temperature for 20min to form liposome-DNA mixture. The mixture was added to the flask and mixed gently. Standing at 37 deg.C for 5% CO₂Culturing for 48h in an incubator, observing transfection conditions by using an immunofluorescence microscope, collecting all supernatants and cells, transferring the supernatants and the cells to a50 mL centrifuge tube, and centrifuging, wherein the centrifugation conditions are as follows: centrifuge at 4000g for 30 min. Removing precipitate, concentrating, purifying to obtain recombinant lentivirus, and packaging in-80 deg.C refrigerator. The virus titer is determined by a fold-ratio dilution technology method, and the titer of the recombinant lentivirus containing pCDH-HBB in the invention is 1.52 multiplied by 10⁸TU/mL, titer of 1.46X 10 containing pCDH-HBB-pre-optimized recombinant lentivirus⁸TU/mL。

Example 3 recombinant lentivirusModified CD34⁺Preparation of cells

1. CD34⁺Sorting and culturing of cells

Before single cell collection, patients were dosed with Filgrastim drugs to stimulate in vivo cell production, and single cells were collected on day 5. The collected cells were sorted for CD34 using CD34 MicroBead Kit sorting beads from Miltenyi⁺Cells were counted at a concentration of 5X 10⁵The cells/mL of the cell culture medium were inoculated into six-well plates, each well was supplemented with 2mL of CD34 expansion medium, and the plates were incubated at 37 ℃ with 5% CO₂Was cultured in an incubator for 2 days. The six-hole plate is used in advance by 5 microgram/cm²The Fibronectin (purchased from Gibco) was placed in a 37 ℃ incubator and coated for 6h, and the CD34 amplification Medium was StemBan SFEM Medium (purchased from STEMCELL Technologies) containing 20ng/mL SCF, 200ng/mL Flt-3L, and 100ng/mL TPO (both purchased from MCE).

2. Recombinant lentivirus infection CD34⁺Cells

CD34⁺Prior to cell infection, the culture Medium was replaced and 2mL of StemBan SFEM Medium containing 100ng/mL IL-3, 50ng/mL IL-1 α, 100ng/mL IL-6, 20ng/mL SCF, 200ng/mL FLT-3L, 100ng/mL TPO was added to each well to pre-stimulate them for 24h for lentivirus infection experiments.

The recombinant lentivirus prepared in example 2 was thawed at-80 ℃ and diluted to 5X 10 in CD34 amplification medium to obtain a titer⁷TU/mL, resuspend 1X 10 with diluted recombinant lentivirus solution⁶An individual CD34⁺And (4) cells to obtain cell suspension. The cell suspension was added to 6-well plates, 1mL per well, to match the number of viral particles with CD34⁺The ratio of cell number is 50:1, 37 deg.C, 5% CO₂After 6 hours of incubation in the incubator, the cells were diluted one-fold with CD34 amplification medium (1 mL of medium was added to each well), and after 1 day of incubation, the cells were screened for 4 days by replacing the CD34 amplification medium containing 300ng/mL puromycin, and then expanded by replacing the CD34 amplification medium for 3 days.

Respectively obtaining pCDH-HBB modified CD34⁺Cellular, pCDH-HBB-Pre-optimized modified CD34⁺Cells, detection of CD34 by flow cytometry⁺Positive rate and GFPThe expression rate of (3). CD34 not infected by lentivirus⁺Cells served as negative controls. The invention of pCDH-HBB to CD34⁺The infection rate of the cells was 55.1%, CD34⁺The positive rate is 91.6%; pCDH-HBB-Preoptimization for CD34⁺The infection rate of the cells was 54.1%, CD34⁺The positive rate was 89.8% (see FIGS. 2-5).

Example 4 PCR identification of genetically modified CD34⁺Presence of HSb in cells

Separately collecting the pCDH-HBB modified CD34 in amplification culture⁺Cells and pCDH-HBB-Pre-optimized modified CD34⁺And (3) extracting cell genomes, and performing PCR identification by using respective specific primers, wherein the primer sequence of the pCDH-HBB is HBB-F: TACAGAGGTGTGGCAAGCAG (SEQ ID NO. 9) and HBB-R: ACCACTTTCTGATA

GGCAGC (SEQ ID NO. 10), the primer sequence before pCDH-HBB-optimization is B-F: AGATGGCTCTGCCCTGACTT (SEQ ID NO. 11) and B-R: CGTTCACCTTGCCCCACAGG (SEQ ID NO. 12).

As a result, as shown in FIG. 6, PCR was able to amplify a fragment having the same size as the target gene, indicating that both the pCDH-HBB gene and the pCDH-HBB-pre-optimization gene were integrated into CD34⁺In the cell.

Example 5 CD34⁺Cell colony formation assay

(1) Separately collecting lentivirus-infected CD34⁺Cells and uninfected CD34⁺And (4) counting the cells.

(2) Resuspension of 3000 CD34 using 200. mu.L IMDM +2% FBS⁺A cell.

(3) Add 1mL of methylcellulose to the cell suspension, mix well, add 2.5mm culture dish.

(4) Placing the culture dish at 37 deg.C and 5% CO₂Culturing in a cell culture box for 14 days, and prohibiting movement in the culture process.

(5) Colony morphology was observed after 14 days and the number of erythroid colonies was counted (see FIG. 7).

The results are shown in FIG. 7, HBB fusion gene modified CD34⁺The number of erythroid colonies in the cells averaged 540, while HBB-pre-optimized genetically modified CD34⁺Red in cellThe number of colonies averaged 370.

Example 6 genetically modified CD34⁺Detection of human haptoglobin expression level in cells

Genetically modified CD34⁺After one week of cell culture, the expression level of human haptoglobin was measured. The expression level of human haptoglobin was determined using a human haptoglobin ELISA kit (purchased from Shanghai Biotech Co., Ltd.). One well of cells and supernatant were collected each, lysed and centrifuged, and the supernatant was taken for assay. The method comprises the following specific steps:

1. sample adding of the standard substance: and arranging a standard product hole and a sample hole, wherein 50 mu L of standard products with different concentrations are added into the standard product hole respectively.

2. Sample adding: blank holes (the blank reference holes are not added with the sample and the enzyme labeling reagent, and the rest steps are operated in the same way) and sample holes to be detected are respectively arranged. 40 mul of sample diluent is added into the sample hole to be detected on the enzyme-labeled coated plate, and then 10 mul of sample to be detected is added (the final dilution of the sample is 5 times). Adding sample to the bottom of the plate hole of the enzyme label, keeping the sample from touching the hole wall as much as possible, and gently shaking and mixing the sample and the hole wall.

3. Adding an enzyme: add 100. mu.l of enzyme labeling reagent to each well except for blank wells.

4. Incubation: the plates were sealed with a sealing plate and incubated at 37 ℃ for 60 minutes.

5. Preparing liquid: diluting the 20 times of concentrated washing solution with 20 times of distilled water for later use.

6. Washing: carefully uncovering the sealing plate film, discarding the liquid, drying by spin, filling washing liquid into each hole, standing for 30 seconds, discarding, repeating the steps for 5 times, and patting dry.

7. Color development: adding 50 μ l of color-developing agent A and 50 μ l of color-developing agent B into each well, shaking gently, mixing, and developing at 37 deg.C in dark for 15 min.

8. And (4) terminating: the reaction was stopped by adding 50. mu.l of stop solution to each well.

9. And (3) determination: the absorbance (OD value) of each well was measured sequentially at a wavelength of 450nm with the blank well being zeroed.

Calculated, pCDH-HBB modified CD34⁺The content of human haptoglobin in the cells was 985.42mg/L, pCDH-HBB-Premodified CD34⁺The human haptoglobin content of the cells was 658.23 mg/L.

Sequence listing

<110> Shandong Xingyi Biotechnology Ltd

<120> HBB fusion gene modified autologous hematopoietic stem cell, preparation method and application thereof

<130> 2022

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3012

<212> DNA

<213> Homo sapiens

<400> 1

taagcttcag tttttcctta gttcctgtta catttctgtg tgtctccatt agtgacctcc 60

catagtccaa gcatgagcag ttctggccag gcccctgtcg gggtcagtgc cccacccccg 120

ccttctggtt ctgtgtaacc ttctaagcaa accttctggc tcaagcacag caatgctgag 180

tcatgatgag tcatgctgag gcttagggtg tgtgcccaga tgttctcagc ctagagtgat 240

gactcctatc tgggtcccca gcaggatgct tacagggcag atggcaaaaa aaaggagaag 300

ctgaccacct gactaaaact ccacctcaaa cggcatcata aagaaaatgg atgcctgaga 360

cagaatgtga catattctag aatatattaa gctttcatta aaaaaagtct aaccagctgc 420

attcgacttt gactgcagca gctggttaga aggttctact ggaggagggt cccagcccat 480

tgctaaatta acatcaggct ctgagactgg cagtatatct ctaacagtgg ttgatgctat 540

cttctggaac ttgcctgcta cattgagacc actgacccat acataggaag cccatagctc 600

tgtcctgaac tgttaggcca ctggtccaga gagtgtgcat ctcctttgat cctcataata 660

accctatgag atagacacaa ttattactct tactttatag atgatgatcc tgaaaacata 720

ggagtcaagg cacttgcccc tagctggggg tataggggag cagtcccatg tagtagtaga 780

atgaaaaatg ctgctatgct gtgcctcccc cacctttccc atgtctgccc tctactcatg 840

gtctatctct cctggctcct gggagtcatg gactccaccc agcaccacca acctgaccta 900

accacctatc tgagcctgcc agcctataac ccatctgggc cctgatagct ggtggccagc 960

cctgacccca ccccaccctc cctggaacct ctgatagaca catctggcac accagctcgc 1020

aaagtcaccg tgagggtctt gtgtttgctg agtcaaaatt ccttgaaatc caagtcctta 1080

gagactcctg ctcccaaatt tacagtcata gacttcttca tggctgtctc ctttatccac 1140

agaatgattc ctttgcttca ttgccccatc catctgatcc tcctcatcag tgcagcacag 1200

ggcccatgag cagtagctgc agagtctcac ataggtctgg cactgcctct gacatgtccg 1260

accttaggca aatgcttgac tcttctgagc tcagtcttgt catggcaaaa taaagataat 1320

aatagtgttt ttttatggag ttagcgtgag gatggaaaac aatagcaaaa ttgattagac 1380

tataaaaggt ctcaacaaat agtagtagat tttatcgtcc attaatcctt ccctctcctc 1440

tcttactcat cccatcacgt atgcctctta attttccctt acctataata agagttattc 1500

ctcttattat attcttctta tagtgattct ggatattaaa gtgggaatga ggggcaggcc 1560

actaacgaag aagatgtttc tcaaagaagc cattctcccc acatagatca tctcagcagg 1620

gttcaggaag ataaaggagg atcaaggtcg aaggtaggaa ctaaggaaga acactgggca 1680

agtggatcct ggaacccaaa atattctaca tagtttccat gtcacagcca gggctgggca 1740

gtctcctgtt atttctttta aaataaatat atcatttaaa tgcataaata agcaaaccct 1800

gctcgggaat gggagggaga gtctctggag tccacccctt ctcggccctg gctctgcaga 1860

tagtgctatc aaagccctga cagagccctg cccattgctg ggccttggag tgagtcagcc 1920

tagtagagag gcagggcaag ccatctcata gctgctgagt gggagagaga aaagggctca 1980

ttgtctataa actcaggtca tggctattct tattctcaca ctaagaaaaa gaatgagatg 2040

tctacatata ccctgcgtcc cctcttgtgt actggggtcc ccaagagctc tctaaaagtg 2100

atggcaaagt cattgcgcta gatgccatcc catctaagca atagatggct ctgccctgac 2160

ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 2220

gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 2280

tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 2340

ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 2400

aaaggctggg ggtgggagta gcggatttga agcacttgtt ggcctacaga ggtgtggcaa 2460

gcagagcacc tcagaactca ggcgtactgc ccgccgcccg agccctgcga gggccgatag 2520

cgagggtgtg gcccttatct gcacccagca gagcgccggc ggggtacggt catggtgcat 2580

ctcacacctg aggagaaatc cgcagtgacc gctctttggg gaaaggtgaa cgtggacgaa 2640

gtgggcgggg aagcattggg cagactgctc gtcgtgtatc catggactca gaggtttttt 2700

gaaagttttg gtgatctgtc aacaccagat gctgtgatgg ggaatcccaa agtgaaagca 2760

catgggaaaa aggtcctggg agccttctct gatggtctgg cacacttgga caacctgaag 2820

ggaacgttcg ctcagctcag tgagctgcat tgcgacaagc tccatgtaga cccagagaat 2880

ttcagacttt tgggcaacgt gctcgtatgc gtcctggccc accactttgg caaagaattt 2940

acgcctcctg tccaagctgc ctatcagaaa gtggtggccg gggtggctaa cgctcttgct 3000

cacaagtacc ac 3012

<210> 2

<211> 388

<212> DNA

<213> Homo sapiens

<400> 2

taagcttcag tttttcctta gttcctgtta catttctgtg tgtctccatt agtgacctcc 60

catagtccaa gcatgagcag ttctggccag gcccctgtcg gggtcagtgc cccacccccg 120

ccttctggtt ctgtgtaacc ttctaagcaa accttctggc tcaagcacag caatgctgag 180

tcatgatgag tcatgctgag gcttagggtg tgtgcccaga tgttctcagc ctagagtgat 240

gactcctatc tgggtcccca gcaggatgct tacagggcag atggcaaaaa aaaggagaag 300

ctgaccacct gactaaaact ccacctcaaa cggcatcata aagaaaatgg atgcctgaga 360

cagaatgtga catattctag aatatatt 388

<210> 3

<211> 1301

<212> DNA

<213> Homo sapiens

<400> 3

aagctttcat taaaaaaagt ctaaccagct gcattcgact ttgactgcag cagctggtta 60

gaaggttcta ctggaggagg gtcccagccc attgctaaat taacatcagg ctctgagact 120

ggcagtatat ctctaacagt ggttgatgct atcttctgga acttgcctgc tacattgaga 180

ccactgaccc atacatagga agcccatagc tctgtcctga actgttaggc cactggtcca 240

gagagtgtgc atctcctttg atcctcataa taaccctatg agatagacac aattattact 300

cttactttat agatgatgat cctgaaaaca taggagtcaa ggcacttgcc cctagctggg 360

ggtatagggg agcagtccca tgtagtagta gaatgaaaaa tgctgctatg ctgtgcctcc 420

cccacctttc ccatgtctgc cctctactca tggtctatct ctcctggctc ctgggagtca 480

tggactccac ccagcaccac caacctgacc taaccaccta tctgagcctg ccagcctata 540

acccatctgg gccctgatag ctggtggcca gccctgaccc caccccaccc tccctggaac 600

ctctgataga cacatctggc acaccagctc gcaaagtcac cgtgagggtc ttgtgtttgc 660

tgagtcaaaa ttccttgaaa tccaagtcct tagagactcc tgctcccaaa tttacagtca 720

tagacttctt catggctgtc tcctttatcc acagaatgat tcctttgctt cattgcccca 780

tccatctgat cctcctcatc agtgcagcac agggcccatg agcagtagct gcagagtctc 840

acataggtct ggcactgcct ctgacatgtc cgaccttagg caaatgcttg actcttctga 900

gctcagtctt gtcatggcaa aataaagata ataatagtgt ttttttatgg agttagcgtg 960

aggatggaaa acaatagcaa aattgattag actataaaag gtctcaacaa atagtagtag 1020

attttatcgt ccattaatcc ttccctctcc tctcttactc atcccatcac gtatgcctct 1080

taattttccc ttacctataa taagagttat tcctcttatt atattcttct tatagtgatt 1140

ctggatatta aagtgggaat gaggggcagg ccactaacga agaagatgtt tctcaaagaa 1200

gccattctcc ccacatagat catctcagca gggttcagga agataaagga ggatcaaggt 1260

cgaaggtagg aactaaggaa gaacactggg caagtggatc c 1301

<210> 4

<211> 446

<212> DNA

<213> Homo sapiens

<400> 4

tggaacccaa aatattctac atagtttcca tgtcacagcc agggctgggc agtctcctgt 60

tatttctttt aaaataaata tatcatttaa atgcataaat aagcaaaccc tgctcgggaa 120

tgggagggag agtctctgga gtccacccct tctcggccct ggctctgcag atagtgctat 180

caaagccctg acagagccct gcccattgct gggccttgga gtgagtcagc ctagtagaga 240

ggcagggcaa gccatctcat agctgctgag tgggagagag aaaagggctc attgtctata 300

aactcaggtc atggctattc ttattctcac actaagaaaa agaatgagat gtctacatat 360

accctgcgtc ccctcttgtg tactggggtc cccaagagct ctctaaaagt gatggcaaag 420

tcattgcgct agatgccatc ccatct 446

<210> 5

<211> 265

<212> DNA

<213> Homo sapiens

<400> 5

aagcaataga tggctctgcc ctgactttta tgcccagccc tggctcctgc cctccctgct 60

cctgggagta gattggccaa ccctagggtg tggctccaca gggtgaggtc taagtgatga 120

cagccgtacc tgtccttggc tcttctggca ctggcttagg agttggactt caaaccctca 180

gccctccctc taagatatat ctcttggccc cataccatca gtacaaattg ctactaaaaa 240

catcctcctt tgcaagtgta tttac 265

<210> 6

<211> 171

<212> DNA

<213> Homo sapiens

<400> 6

aaaggctggg ggtgggagta gcggatttga agcacttgtt ggcctacaga ggtgtggcaa 60

gcagagcacc tcagaactca ggcgtactgc ccgccgcccg agccctgcga gggccgatag 120

cgagggtgtg gcccttatct gcacccagca gagcgccggc ggggtacggt c 171

<210> 7

<211> 441

<212> DNA

<213> Homo sapiens

<400> 7

atggtgcatc tcacacctga ggagaaatcc gcagtgaccg ctctttgggg aaaggtgaac 60

gtggacgaag tgggcgggga agcattgggc agactgctcg tcgtgtatcc atggactcag 120

aggttttttg aaagttttgg tgatctgtca acaccagatg ctgtgatggg gaatcccaaa 180

gtgaaagcac atgggaaaaa ggtcctggga gccttctctg atggtctggc acacttggac 240

aacctgaagg gaacgttcgc tcagctcagt gagctgcatt gcgacaagct ccatgtagac 300

ccagagaatt tcagactttt gggcaacgtg ctcgtatgcg tcctggccca ccactttggc 360

aaagaattta cgcctcctgt ccaagctgcc tatcagaaag tggtggccgg ggtggctaac 420

gctcttgctc acaagtacca c 441

<210> 8

<211> 4100

<212> DNA

<213> Homo sapiens

<400> 8

gtatatgtgt atatatatat atatattcag gaaataatat attctagaat atgtcacatt 60

ctgtctcagg catccatttt ctttatgatg ccgtttgagg tggagtttta gtcaggtggt 120

cagcttctcc ttttttttgc catctgccct gtaagcatcc tgctggggac ccagatagga 180

gtcatcactc taggctgaga acatctgggc acacacccta agcctcagca tgactcatca 240

tgactcagca ttgctgtgct tgagccagaa ggtttgctta gaaggttaca cagaaccaga 300

aggcgggggt ggggcactga ccccgacagg ggcctggcca gaactgctca tgcttggact 360

atgggaggtc actaatggag acacacagaa atgtaacagg aactaaggaa aaactgaagc 420

ttatttaatc agagatgagg atgctggaag ggatagaggg agctgagctt gtaaaaagta 480

tagtaatcat tcagcaaatg gttttgaagc acctgctgga tgctaaacac tattttcagt 540

gcttgaatca taaataagaa taaaacatgt atcttattcc ccacaagagt ccaagtaaaa 600

aataacagtt aattataatg tgctctgtcc cccaggctgg agtgcagtgg cacgatctca 660

gctcactgca acctccgcct cccgggttca agcaattctc ctgcctcagc caccctaata 720

gctgggatta caggtgcaca ccaccatgcc aggctaattt ttgtactttt tgtagaggca 780

gggtatcacc atgttgtcca agatggtctt gaactcctga gctccaagca gtccacccac 840

ctcagcctcc caaagtgcta agctttcatt aaaaaaagtc taaccagctg cattcgactt 900

tgactgcagc agctggttag aaggttctac tggaggaggg tcccagccca ttgctaaatt 960

aacatcaggc tctgagactg gcagtatatc tctaacagtg gttgatgcta tcttctggaa 1020

cttgcctgct acattgagac cactgaccca tacataggaa gcccatagct ctgtcctgaa 1080

ctgttaggcc actggtccag agagtgtgca tctcctttga tcctcataat aaccctatga 1140

gatagacaca attattactc ttactttata gatgatgatc ctgaaaacat aggagtcaag 1200

gcacttgccc ctagctgggg gtatagggga gcagtcccat gtagtagtag aatgaaaaat 1260

gctgctatgc tgtgcctccc ccacctttcc catgtctgcc ctctactcat ggtctatctc 1320

tcctggctcc tgggagtcat ggactccacc cagcaccacc aacctgacct aaccacctat 1380

ctgagcctgc cagcctataa cccatctggg ccctgatagc tggtggccag ccctgacccc 1440

accccaccct ccctggaacc tctgatagac acatctggca caccagctcg caaagtcacc 1500

gtgagggtct tgtgtttgct gagtcaaaat tccttgaaat ccaagtcctt agagactcct 1560

gctcccaaat ttacagtcat agacttcttc atggctgtct cctttatcca cagaatgatt 1620

cctttgcttc attgccccat ccatctgatc ctcctcatca gtgcagcaca gggcccatga 1680

gcagtagctg cagagtctca cataggtctg gcactgcctc tgacatgtcc gaccttaggc 1740

aaatgcttga ctcttctgag ctcagtcttg tcatggcaaa ataaagataa taatagtgtt 1800

tttttatgga gttagcgtga ggatggaaaa caatagcaaa attgattaga ctataaaagg 1860

tctcaacaaa tagtagtaga ttttatcgtc cattaatcct tccctctcct ctcttactca 1920

tcccatcacg tatgcctctt aattttccct tacctataat aagagttatt cctcttatta 1980

tattcttctt atagtgattc tggatattaa agtgggaatg aggggcaggc cactaacgaa 2040

gaagatgttt ctcaaagaag ccattctccc cacatagatc atctcagcag ggttcaggaa 2100

gataaaggag gatcaaggtc gaaggtagga actaaggaag aacactgggc aagtggatcc 2160

tgagcccctt ttcctctaac tgaaagaagg aaaaaaaaat ggaacccaaa atattctaca 2220

tagtttccat gtcacagcca gggctgggca gtctcctgtt atttctttta aaataaatat 2280

atcatttaaa tgcataaata agcaaaccct gctcgggaat gggagggaga gtctctggag 2340

tccacccctt ctcggccctg gctctgcaga tagtgctatc aaagccctga cagagccctg 2400

cccattgctg ggccttggag tgagtcagcc tagtagagag gcagggcaag ccatctcata 2460

gctgctgagt gggagagaga aaagggctca ttgtctataa actcaggtca tggctattct 2520

tattctcaca ctaagaaaaa gaatgagatg tctacatata ccctgcgtcc cctcttgtgt 2580

actggggtcc ccaagagctc tctaaaagtg atggcaaagt cattgcgcta gatgccatcc 2640

catctattat aaacctgcat ttgtctccac acaccagtca tggacaataa ccctcctccc 2700

aggtccacgt gcttgtcttt gtataatact caagtaattt cggaaaatgt attctttcaa 2760

tcttgttctg ttattcctgt ttcaatggct tagtagaaaa agtacatact tgttttccca 2820

taaattgaca atagacaatt tcacatcaat gtctatatgg gtcgttgtgt ttgctgtgtt 2880

tgcaaaaact cacaataact ttatattgtt actactctaa gaaagttaca acatggtgaa 2940

tacaagagaa agctattaca agtccagaaa ataaaagtta tcatcttgag gcctcagctt 3000

tctaggaata atatcaatat tacaaaatta atctaacaat tatgaacagc aatgagataa 3060

tgtgtacaaa gtacccagac ctatgtggta gagcatcaag gaagcgcatt gcggagcagt 3120

tttttgtttg tttgtttttg tattctgttt cgtgaggcaa ggtttcactc tgctgtccag 3180

gctggagtgc agtggcaaga tcatgtctca ctgcagcctt gacaagcaat agatggctct 3240

gccctgactt ttatgcccag ccctggctcc tgccctccct gctcctggga gtagattggc 3300

caaccctagg gtgtggctcc acagggtgag gtctaagtga tgacagccgt acctgtcctt 3360

ggctcttctg gcactggctt aggagttgga cttcaaaccc tcagccctcc ctctaagata 3420

tatctcttgg ccccatacca tcagtacaaa ttgctactaa aaacatcctc ctttgcaagt 3480

gtatttacaa aggctggggg tgggagtagc ggatttgaag cacttgttgg cctacagagg 3540

tgtggcaagc agagcacctc agaactcagg cgtactgccc gccgcccgag ccctgcgagg 3600

gccgatagcg agggtgtggc ccttatctgc acccagcaga gcgccggcgg ggtacggtca 3660

tggtgcacct gactcctgag gagaagtctg ccgttactgc cctgtggggc aaggtgaacg 3720

tggatgaagt tggtggtgag gccctgggca ggctgctggt ggtctaccct tggacccaga 3780

ggttctttga gtcctttggg gatctgtcca ctcctgatgc tgttatgggc aaccctaagg 3840

tgaaggctca tggcaagaaa gtgctcggtg cctttagtga tggcctggct cacctggaca 3900

acctcaaggg cacctttgcc cagctgagtg agctgcactg tgacaagctg cacgtggatc 3960

ctgagaactt caggctcctg ggcaacgtgc tggtctgtgt gctggcccat cactttggca 4020

aagaattcac cccaccagtg caggctgcct atcagaaagt ggtggctggt gtggctaatg 4080

ccctggccca caagtatcac 4100

<210> 9

<211> 20

<212> DNA

<213> Homo sapiens

<400> 9

tacagaggtg tggcaagcag 20

<210> 10

<211> 20

<212> DNA

<213> Homo sapiens

<400> 10

accactttct gataggcagc 20

<210> 11

<211> 20

<212> DNA

<213> Homo sapiens

<400> 11

agatggctct gccctgactt 20

<210> 12

<211> 20

<212> DNA

<213> Homo sapiens

<400> 12

cgttcacctt gccccacagg 20

<210> 13

<211> 859

<212> DNA

<213> Homo sapiens

<400> 13

gtatatgtgt atatatatat atatattcag gaaataatat attctagaat atgtcacatt 60

ctgtctcagg catccatttt ctttatgatg ccgtttgagg tggagtttta gtcaggtggt 120

cagcttctcc ttttttttgc catctgccct gtaagcatcc tgctggggac ccagatagga 180

gtcatcactc taggctgaga acatctgggc acacacccta agcctcagca tgactcatca 240

tgactcagca ttgctgtgct tgagccagaa ggtttgctta gaaggttaca cagaaccaga 300

aggcgggggt ggggcactga ccccgacagg ggcctggcca gaactgctca tgcttggact 360

atgggaggtc actaatggag acacacagaa atgtaacagg aactaaggaa aaactgaagc 420

ttatttaatc agagatgagg atgctggaag ggatagaggg agctgagctt gtaaaaagta 480

tagtaatcat tcagcaaatg gttttgaagc acctgctgga tgctaaacac tattttcagt 540

gcttgaatca taaataagaa taaaacatgt atcttattcc ccacaagagt ccaagtaaaa 600

aataacagtt aattataatg tgctctgtcc cccaggctgg agtgcagtgg cacgatctca 660

gctcactgca acctccgcct cccgggttca agcaattctc ctgcctcagc caccctaata 720

gctgggatta caggtgcaca ccaccatgcc aggctaattt ttgtactttt tgtagaggca 780

gggtatcacc atgttgtcca agatggtctt gaactcctga gctccaagca gtccacccac 840

ctcagcctcc caaagtgct 859

<210> 14

<211> 1063

<212> DNA

<213> Homo sapiens

<400> 14

tgagcccctt ttcctctaac tgaaagaagg aaaaaaaaat ggaacccaaa atattctaca 60

tagtttccat gtcacagcca gggctgggca gtctcctgtt atttctttta aaataaatat 120

atcatttaaa tgcataaata agcaaaccct gctcgggaat gggagggaga gtctctggag 180

tccacccctt ctcggccctg gctctgcaga tagtgctatc aaagccctga cagagccctg 240

cccattgctg ggccttggag tgagtcagcc tagtagagag gcagggcaag ccatctcata 300

gctgctgagt gggagagaga aaagggctca ttgtctataa actcaggtca tggctattct 360

tattctcaca ctaagaaaaa gaatgagatg tctacatata ccctgcgtcc cctcttgtgt 420

actggggtcc ccaagagctc tctaaaagtg atggcaaagt cattgcgcta gatgccatcc 480

catctattat aaacctgcat ttgtctccac acaccagtca tggacaataa ccctcctccc 540

aggtccacgt gcttgtcttt gtataatact caagtaattt cggaaaatgt attctttcaa 600

tcttgttctg ttattcctgt ttcaatggct tagtagaaaa agtacatact tgttttccca 660

taaattgaca atagacaatt tcacatcaat gtctatatgg gtcgttgtgt ttgctgtgtt 720

tgcaaaaact cacaataact ttatattgtt actactctaa gaaagttaca acatggtgaa 780

tacaagagaa agctattaca agtccagaaa ataaaagtta tcatcttgag gcctcagctt 840

tctaggaata atatcaatat tacaaaatta atctaacaat tatgaacagc aatgagataa 900

tgtgtacaaa gtacccagac ctatgtggta gagcatcaag gaagcgcatt gcggagcagt 960

tttttgtttg tttgtttttg tattctgttt cgtgaggcaa ggtttcactc tgctgtccag 1020

gctggagtgc agtggcaaga tcatgtctca ctgcagcctt gac 1063

Claims (6)

1. An HBB fusion gene modified autologous hematopoietic stem cell, characterized in that: the HBB fusion gene is obtained by sequentially connecting the following modules in series: DNase I hypersensitive site HS2, DNase I hypersensitive site HS3, DNase I hypersensitive site HS4, promoter, enhancer, HSb T88Q;

the nucleotide sequence of the DNase I hypersensitive site HS2 is shown as SEQ ID NO.2 in the sequence table;

the nucleotide sequence of the DNase I hypersensitive site HS3 is shown as SEQ ID NO.3 in the sequence table;

the nucleotide sequence of the DNase I hypersensitive site HS4 is shown as SEQ ID NO.4 in the sequence table;

the nucleotide sequence of the promoter is shown as SEQ ID NO.5 in the sequence table;

the nucleotide sequence of the enhancer is shown as SEQ ID NO.6 in the sequence table;

the nucleotide sequence of the HSb T88Q is shown as SEQ ID NO.7 in the sequence table;

the autologous hematopoietic stem cells are CD34⁺A cell.

2. The method for producing HBB fusion gene-modified autologous hematopoietic stem cells according to claim 1, wherein: the preparation method comprises the steps of constructing a recombinant expression vector pCDH-HBB, packaging lentiviruses and infecting CD34 with the recombinant lentiviruses⁺A cell.

3. The method for producing HBB fusion gene-modified autologous hematopoietic stem cells according to claim 2, wherein: and (3) constructing the recombinant expression vector pCDH-HBB, and inserting the HBB fusion gene into the pCDH vector to obtain the recombinant expression vector pCDH-HBB.

4. The method for producing HBB fusion gene-modified autologous hematopoietic stem cells according to claim 2, wherein: packaging the lentivirus, transfecting the recovered 293T cell by adopting a recombinant expression vector pCDH-HBB to obtain a recombinant lentivirus, andthe titer of the recombinant lentivirus is 1.52 multiplied by 10⁸TU/mL。

5. The method for producing HBB fusion gene-modified autologous hematopoietic stem cells according to claim 4, wherein: the recombinant lentivirus is infected with CD34⁺Cells, recombinant lentivirus with CD34⁺The proportion of the cells is controlled to be 50:1, and the HBB fusion gene modified CD34 is obtained by culturing, screening and expanding culture⁺A cell.

6. Use of the HBB fusion gene modified autologous hematopoietic stem cells of claim 1 in the preparation of a medicament for the treatment of sickle cell disease and

the application of the beta-thalassemia drug.

Images