CN114457170A - DNAJC30 gene molecular marker related to chicken carcass traits and application thereof - Google Patents
DNAJC30 gene molecular marker related to chicken carcass traits and application thereof Download PDFInfo
- Publication number
- CN114457170A CN114457170A CN202210240599.0A CN202210240599A CN114457170A CN 114457170 A CN114457170 A CN 114457170A CN 202210240599 A CN202210240599 A CN 202210240599A CN 114457170 A CN114457170 A CN 114457170A
- Authority
- CN
- China
- Prior art keywords
- chicken
- primer
- genotype
- seq
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a DNAJC30 gene molecular marker related to chicken carcass traits and application thereof, belonging to the technical field of biology. The molecular marker is represented by SEQ ID NO. 1, wherein the sequence comprises NC-052550.1 g.618125A > G, NC-052550.1 g.618020T > C, NC-052550.1 g.617664T > C, NC-052550.1 g.617659C > T and NC-052550.1 g.617631G > T. The 5 molecular markers are obviously related to the carcass traits of chickens. Therefore, the method can accurately identify the chicken carcass traits and provide a new molecular marker for molecular marker-assisted selective breeding.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a DNAJC30 gene molecular marker related to chicken carcass traits and application thereof.
Background
Single Nucleotide Polymorphism (SNP) refers to a Polymorphism of a genomic DNA sequence caused by insertion, deletion, transversion, conversion, etc. of a Single Nucleotide at the genomic level. The SNP is the most common animal genetic variation, widely exists in animal genomes, and has the characteristics of stable inheritance, easy detection and the like. In animal production practice, SNP can be used for Molecular marker-assisted Selection (MAS) so as to break through the bottleneck of traditional breeding and improve the accuracy of seed Selection and the breeding effect of target traits.
Molecular chaperone heat shock protein family C30(DnaJ heat shock protein family C30, DNAJC30) is a protein encoded by cell nucleus, and recent research shows that DNAJC30 has an important function in mitochondria, and the interaction with the protein encoded by the mitochondria greatly influences the normal expression or not of the functions of the mitochondria. Mitochondria play an important role in physiological processes such as muscle growth and development and fat deposition as the energy metabolism center of cells. The invention finds that a plurality of SNP loci on the avian DNAJC30 gene are obviously related to the carcass traits of chickens. Therefore, the invention provides a novel SNP molecular marker in combination with carcass performance indexes of chickens.
Disclosure of Invention
The invention aims to provide a DNAJC30 gene molecular marker related to chicken carcass traits and application thereof, which are used for solving the problems in the prior art, discovering SNP sites of DNAJC30 gene exon regions, analyzing the SNP sites in association with chicken carcass traits and providing a new SNP molecular marker for MAS.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a molecular marker related to chicken carcass traits, which is SNP1-SNP5, wherein SNP1 is a sequence shown as SEQ ID NO. 1 and has NC-052550.1: g.618125A > G, SNP2 is a sequence shown as SEQ ID NO. 1 and has NC-052550.1: g.618020T > C, SNP3 is a sequence shown as SEQ ID NO. 1 and has NC-052550.1: g.617664T > C, SNP4 is a sequence shown as SEQ ID NO. 1 and has NC-052550.1: g.617659C > T, and SNP5 is a sequence shown as SEQ ID NO. 1 and has NC-052550.1: g.617631G > T.
Preferably, SNP1 exists in genotypes AA, AG, GG; SNP2 has genotype TT, TC, CC; SNP3 has genotype TT, TC, CC; SNP4 has genotype CC, CT, TT; SNP5 has genotypes GG, GT, TT.
The invention also provides a primer for amplifying the molecular marker, wherein the primer is an upstream primer with a sequence shown as SEQ ID NO. 2 and a downstream primer with a sequence shown as SEQ ID NO. 3.
The invention also provides a kit for identifying the carcass traits of chickens, which comprises the primer.
The invention also provides a method for identifying the carcass traits of chickens, which comprises the following steps:
(1) taking the chicken genome DNA to be detected as a template, and amplifying a target gene segment by using the primer to obtain an amplification product;
(2) sequencing the amplification product, detecting the genotype of the corresponding single nucleotide polymorphism site, and judging the carcass traits of the chicken to be detected according to the genotype.
Preferably, the amplification reaction system is: template DNA 2. mu.L, 2 XEs Taq MasterMix 25. mu.L, upstream primer 2. mu.L, downstream primer 2. mu. L, ddH2O 19μL。
Preferably, the amplification reaction procedure is: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; final extension at 72 ℃ for 3 min; storing at 4 ℃.
Preferably, the carcass traits comprise: pectoral muscle rate, tibiod circumference, leg ratio, lean muscle rate, leg skin yellowness value, and intermuscular fat width.
The invention also provides application of the molecular marker or the primer or the kit or the method in chicken breeding.
Preferably, the method is applied to breeding of chicken carcass traits.
The invention discloses the following technical effects:
according to the invention, through analyzing DNAJC30 gene, the exon region of the gene is found to have a plurality of SNP sites which are obviously related to the chicken carcass traits, and meanwhile, through experimental verification, the invention discovers that: the molecular marker NC-052550.1: g.618125A > G locus has significant correlation with the chest muscle rate and the tibiod circumference (p <0.05), the molecular marker NC-052550.1: g.618020T > C locus has significant correlation with the chest muscle rate, the leg rate and the slaughter rate (p <0.05), the molecular marker NC-052550.1: g.617664T > C locus has significant correlation with the leg skin yellowness value (p <0.05), the molecular marker NC-052550.1: g.617659C > T locus has significant correlation with the leg skin yellowness value (p <0.05), and the molecular marker NC-052550.1: g.617631G > T locus has significant correlation with the width of the fat between muscles (p < 0.05). The 5 molecular markers can accurately identify the carcass traits of the chickens, and provide new SNP molecular markers for MAS, thereby providing scientific basis for the breeding of the chickens.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a schematic diagram showing the primer pair positions and product lengths of DNAJC 30;
FIG. 2 is a DNAJC30 gene exon region SNP locus genotyping map.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
Example 1
1. Materials and methods
1.1 animal samples
The test animals were 450 spotted-brown chickens of 80 days old, and 409 spotted-brown chickens with phenotype records. By collecting 2mL of subcutaneous venous blood, the sample was stored at-80 ℃ and used as a DNA extraction sample. Meanwhile, carcass traits such as subcutaneous fat thickness, intramuscular fat width, full bore weight, half bore weight, abdominal fat weight, leg weight, pectoral muscle rate, leg ratio, abdominal fat rate, half bore rate, full bore rate, lean meat rate, slaughter rate and the like of a selected colony are recorded.
1.2 Primary reagents
Blood sample DNA extraction kit (brand: OMEGA; cat # D3392; Feiyang bioengineering, Guangzhou), 2 XEs Taq MasterMix (Dye) (brand: Kangshi; cat # CW 0690M; Kangshi Biotechnology, Inc.), DNA marker (brand: Novozan; cat # MD 101; Jiangsu Novozan Biotechnology, Inc.), high purity low electroosmosis agarose (brand: Tokyo; cat # TSJ 001; Beijing Tokyo Biotechnology, Inc.).
1.3 Experimental methods
1.3.1 primer design
According to the sequence of the Red raw Chicken (Gallus) DNAJC30 gene (GeneID:770202) published by NCBI (national Center for Biotechnology Information Search database), primers were designed using NCBI's Primer-BLAST tool, and Primer synthesis services were provided by Guangzhou Ongchow Biotechnology, Inc. The information about the primer sequences is shown in table 1, and the pairing positions of the primers on the DNAJC30 gene are shown in fig. 1.
TABLE 1 PCR amplification primer sequences
1.3.2 blood sample DNA extraction
And (4) extracting the DNA of the blood sample by referring to an operation manual of the blood sample DNA extraction kit.
1.3.3 PCR amplification of the exon sequences of the DNAJC30 Gene
The genomic DNA of the 409 individual blood samples was used as a template, and the following reaction system was followed: template DNA 2. mu.L, 2 XEs Taq MasterMix (Dye) 25. mu.L, upstream primer 2. mu.L, downstream primer 2. mu. L, ddH2O 19μL。
Reaction procedure: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; final extension at 72 ℃ for 3 min; storing at 4 ℃. PCR products were subjected to Sanger sequencing by Gene technology, Inc., Tianyihui, Guangzhou.
1.3.4 SNP determination and genotyping
Analysis of the sequence peak patterns was performed on the Sanger sequencing results of the PCR products using the SeqMan tool of DNAstar software to determine potential SNP sites, and sequencing data for each sample was aligned by this tool for genotyping.
1.3.5 genotype correlation with carcass traits
The data of individual carcass traits corresponding to SNP sites and genotypes are subjected to correlation analysis by adopting a SAS 9.4GLM program package.
2 results
2.1 PCR amplification and SNP screening of exon sequences of DNAJC30 Gene
Selecting blood sample DNA of 409 individuals of the domestic chicken as a template to carry out PCR amplification, carrying out Sanger sequencing on an obtained PCR product (the nucleotide sequence is shown as SEQ ID NO: 1), carrying out comparison analysis on a peak diagram after sequencing, and detecting 7 SNP sites in total, wherein 5 sites are associated with the chicken carcass traits and respectively comprise: NC-052550.1: g.618125A > G, NC-052550.1: g.618020T > C, NC-052550.1: g.617664T > C, NC-052550.1: g.617659C > T and NC-052550.1: g.617631G > T, as shown in FIG. 2.
SEQ ID NO:1
CTGCTCCCAGCCACAATGGCTGTACAAGACAGTCTTGTGCAAAGCTCCTAGCAAGCCCTCGCCAAGGCAGGCTGCTCTGCACAGCGAGGTGCCTGGGGCAGCACCTCCAGGTGATGGCACACACTGACTGGAACACAGGCAGCCAGAGGCCCACGTTCCATTCTTTCAGGCTGCTGAAACCGAGAGCTCTGTGCTCAGCACAGTGTGAGGCACGCCCTGAGCAGAGACACACAGGGTCACGGTGCAGGATGGAGACCAGCGCTCCAAAAATGTACTAAGTGTGACAGCACAAAGGCAGCAAGCTTGGGATTAATGGAACCCACAGGGAGACATTAATTAACATCAGCGTGAGCATCTCCAGGAACACATGCAGCACACAGACACTGCGGGCAATTATTTAATCTCTACCGTGGCTCAGCAAAACAGAGATGTGGTTCCCACTGGGCTCACAGCGCAGTGCCAGTGGAGATGTCAGAGGCCACAAAACAGAGTCCACGCCCCTGCCGGGCGCCTCGCGTGGGCTCTGCTGGCAAATGGGGCACATGGCAGCGGTGGTGCGGGGCCATGCGGTAACACATCACCACACTGCGGGCACGCATGGCTTCAGAAGTGACGCTGAGCCCCTGCACGGGTTCCGCACTGCCCGAGGACTGTCAGCAACGTGCCGACATGTCACTACTTGAGGCCATAGAGCATCGCGAAGCCAAGCACGAAGACCAGCCCAACCGTGAGGTCCGTTAGGAACCGCAGCCTGCCCTGAGCCGCGGCCTCCTCCCGGTAGAGCCGCAGCCGTTCCCGACGCGCCCGCAGCACCCGCTCCCGCTCCAGCTGCTCGCCGTAGTGCGCGCGATAGAAGGCGTCGAAGTCG
2.2 correlation analysis of SNP site of exon sequence of DNAJC30 gene and carcass traits
Correlation analysis was performed between the above 7 SNP sites and carcass traits (thick subcutaneous fat, wide intramuscular fat, full bore weight, half bore weight, abdominal fat weight, leg weight, breast muscle rate, leg ratio, abdominal fat rate, half bore rate, full bore rate, lean meat rate, slaughter rate, live body weight, shin length, shin girth, and carcass cloaca skin color, shoulder skin color, hip skin color, abdominal skin color, chest leg skin color, shin skin color, and abdominal fat color yellowness value).
As shown in Table 2, the results show that NC-052550.1: g.618125A > G locus has significant correlation with the pectoral muscle rate and the tibioid circumference (p <0.05), wherein the pectoral muscle rate of the AA genotype individual is significantly higher than that of the GG genotype individual (p <0.05), and the pectoral muscle rate of the AG genotype individual is not significantly different from that of the AA and GG genotype individuals (p > 0.05); the tibiod circumference of the GG genotype individuals and the AG genotype individuals is significantly higher than that of the AA genotype individuals (p <0.05), and the tibiod circumference between the GG genotype individuals and the AG genotype individuals is not significantly different (p > 0.05).
As shown in table 3, the NC _052550.1: g.618020T > C locus has a significant correlation with pectoralis muscle rate, leg ratio and lean muscle rate (p < 0.05). The pectoral muscle rate of the CC genotype individual is obviously lower than that of the TT genotype individual (p is less than 0.05), and the CT genotype is not obviously different from the TT genotype individual and the CC genotype individual (p is more than 0.05); the leg ratio of the CT genotype individuals is significantly higher than that of the TT and CC genotype individuals (p < 0.05); the lean meat percentage of the CT genotype individual is obviously higher than that of the CC genotype individual (p <0.05), and the TT genotype has no obvious difference with the CT and CC (p > 0.05).
As shown in table 4, NC _052550.1: g.617664T > C site was significantly correlated with leg skin yellowness values (p < 0.05). Wherein the leg skin yellowness value of TT genotype individuals is obviously higher than that of TC genotype individuals and CC genotype individuals (p <0.05), and the TC genotype individuals and the CC genotype individuals have no obvious difference (p > 0.05).
As shown in table 5, NC _052550.1: g.617659C > T site was significantly correlated with leg skin yellowness values (p < 0.05). Wherein the leg skin yellowness value of CC genotype individuals is obviously higher than that of CT genotype individuals and TT genotype individuals (p is less than 0.05), and the CT genotype individuals and the TT genotype individuals have no obvious difference (p is more than 0.05).
As shown in Table 6, there was a significant correlation between NC-052550.1: g.617631G > T site and the width of the fat between muscles (p < 0.05). Wherein the fat width between muscles of TT genotype individuals is obviously higher than that of GT genotype individuals (p <0.05), and GG genotype individuals have no obvious difference with GT and TT genotype individuals (p > 0.05).
Besides the 5 SNP sites, the association of other sites in the amplified fragment with the carcass trait does not reach a significant level (p > 0.05).
TABLE 2 NC-052550.1 g.618125A > G sites associated with carcass traits
TABLE 3 NC-052550.1 g.618020T > C locus correlated with carcass traits
TABLE 4 NC-052550.1 g.617664T > C site is associated with carcass traits
TABLE 5 NC-052550.1 g.617659C > T loci associated with carcass traits
TABLE 6 NC-052550.1 g.617631G > T loci associated with carcass traits
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> Kyoho agriculture and animal husbandry Co Ltd
South China Agricultural University
<120> DNAJC30 gene molecular marker related to chicken carcass traits and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 868
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctgctcccag ccacaatggc tgtacaagac agtcttgtgc aaagctccta gcaagccctc 60
gccaaggcag gctgctctgc acagcgaggt gcctggggca gcacctccag gtgatggcac 120
acactgactg gaacacaggc agccagaggc ccacgttcca ttctttcagg ctgctgaaac 180
cgagagctct gtgctcagca cagtgtgagg cacgccctga gcagagacac acagggtcac 240
ggtgcaggat ggagaccagc gctccaaaaa tgtactaagt gtgacagcac aaaggcagca 300
agcttgggat taatggaacc cacagggaga cattaattaa catcagcgtg agcatctcca 360
ggaacacatg cagcacacag acactgcggg caattattta atctctaccg tggctcagca 420
aaacagagat gtggttccca ctgggctcac agcgcagtgc cagtggagat gtcagaggcc 480
acaaaacaga gtccacgccc ctgccgggcg cctcgcgtgg gctctgctgg caaatggggc 540
acatggcagc ggtggtgcgg ggccatgcgg taacacatca ccacactgcg ggcacgcatg 600
gcttcagaag tgacgctgag cccctgcacg ggttccgcac tgcccgagga ctgtcagcaa 660
cgtgccgaca tgtcactact tgaggccata gagcatcgcg aagccaagca cgaagaccag 720
cccaaccgtg aggtccgtta ggaaccgcag cctgccctga gccgcggcct cctcccggta 780
gagccgcagc cgttcccgac gcgcccgcag cacccgctcc cgctccagct gctcgccgta 840
gtgcgcgcga tagaaggcgt cgaagtcg 868
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctgctcccag ccacaat 17
Claims (10)
1. A molecular marker related to chicken carcass traits is characterized by being SNP1-SNP5, SNP1 is a sequence shown as SEQ ID NO. 1 and exists NC-052550.1: g.618125A > G, SNP2 is a sequence shown as SEQ ID NO. 1 and exists NC-052550.1: g.618020T > C, SNP3 is a sequence shown as SEQ ID NO. 1 and exists NC-052550.1: g.614T > C, SNP4 is a sequence shown as SEQ ID NO. 1 and exists NC-052550.1: g.617659C > T, and SNP5 is a sequence shown as SEQ ID NO. 1 and exists NC-052550.1: g.617631G > T.
2. The molecular marker of claim 1, wherein SNP1 is present in genotypes AA, AG, GG; SNP2 has genotype TT, TC, CC; SNP3 has genotype TT, TC, CC; SNP4 has genotype CC, CT, TT; SNP5 has genotypes GG, GT, TT.
3. The primer for amplifying the molecular marker of claim 1, wherein the primer is an upstream primer having a sequence shown as SEQ ID NO. 2 and a downstream primer having a sequence shown as SEQ ID NO. 3.
4. A kit for identifying a carcass trait in a chicken comprising the primer of claim 3.
5. A method of identifying a carcass trait in a chicken comprising the steps of:
(1) amplifying a target gene segment by using the primer of claim 3 by using chicken genome DNA to be detected as a template to obtain an amplification product;
(2) sequencing the amplification product, detecting the genotype of the corresponding single nucleotide polymorphism site, and judging the carcass traits of the chicken to be detected according to the genotype.
6. The method for identifying the carcass trait of a chicken as claimed in claim 5 wherein the amplification reaction system is: template DNA 2. mu.L, 2 XEs Taq MasterMix 25. mu.L, upstream primer 2. mu.L, downstream primer 2. mu. L, ddH2O 19μL。
7. The method for identifying a carcass trait in a chicken as claimed in claim 5 wherein the amplification reaction program is: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; final extension at 72 ℃ for 3 min; storing at 4 ℃.
8. The method of identifying a chicken carcass trait of claim 5, wherein the carcass trait comprises: pectoral muscle rate, tibiod circumference, leg ratio, lean muscle rate, leg skin yellowness value, and intermuscular fat width.
9. Use of the molecular marker of claim 1 or the primer of claim 3 or the kit of claim 4 or the method of claim 5 in chicken breeding.
10. The use of claim 9 in the breeding of chicken carcass traits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210240599.0A CN114457170B (en) | 2022-03-10 | 2022-03-10 | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210240599.0A CN114457170B (en) | 2022-03-10 | 2022-03-10 | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114457170A true CN114457170A (en) | 2022-05-10 |
| CN114457170B CN114457170B (en) | 2022-09-16 |
Family
ID=81417487
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210240599.0A Active CN114457170B (en) | 2022-03-10 | 2022-03-10 | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114457170B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820870A (en) * | 2022-08-09 | 2023-03-21 | 华南农业大学 | CDK5 gene molecular marker related to chicken skin color and carcass traits and application |
| CN115851966A (en) * | 2022-09-06 | 2023-03-28 | 华南农业大学 | Molecular marker of ApoD gene related to chicken carcass traits and application |
| CN116334235A (en) * | 2022-09-21 | 2023-06-27 | 华南农业大学 | SERCA2 gene molecular marker related to chicken carcass traits and application thereof |
| CN116814801A (en) * | 2023-05-10 | 2023-09-29 | 华南农业大学 | LncEDCH1 gene molecular marker related to chicken skin yellowness and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250889A (en) * | 2011-07-14 | 2011-11-23 | 四川农业大学 | SNP (Single Nucleotide Polymorphism) related to chick carcass trait and application thereof |
| CN113789393A (en) * | 2021-10-12 | 2021-12-14 | 南昌师范学院 | Molecular marker related to chicken carcass traits and application thereof |
| CN113913538A (en) * | 2021-11-30 | 2022-01-11 | 华南农业大学 | SNP molecular marker related to chicken carcass traits and application |
-
2022
- 2022-03-10 CN CN202210240599.0A patent/CN114457170B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250889A (en) * | 2011-07-14 | 2011-11-23 | 四川农业大学 | SNP (Single Nucleotide Polymorphism) related to chick carcass trait and application thereof |
| CN113789393A (en) * | 2021-10-12 | 2021-12-14 | 南昌师范学院 | Molecular marker related to chicken carcass traits and application thereof |
| CN113913538A (en) * | 2021-11-30 | 2022-01-11 | 华南农业大学 | SNP molecular marker related to chicken carcass traits and application |
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "NCBI Reference Sequence: XM_003642377.6", 《GENBANK》 * |
| 伊宝: "基于RNA-Seq的舍内氨气对肉鸡胸肌生长发育的分子机制", 《中国优秀博硕士学位论文全文数据库(博士) 农业科技辑》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820870A (en) * | 2022-08-09 | 2023-03-21 | 华南农业大学 | CDK5 gene molecular marker related to chicken skin color and carcass traits and application |
| CN115820870B (en) * | 2022-08-09 | 2023-10-13 | 华南农业大学 | CDK5 gene molecular marker related to chicken complexion and carcass traits and application |
| CN115851966A (en) * | 2022-09-06 | 2023-03-28 | 华南农业大学 | Molecular marker of ApoD gene related to chicken carcass traits and application |
| CN115851966B (en) * | 2022-09-06 | 2023-11-10 | 华南农业大学 | ApoD gene molecular marker related to chicken carcass traits and application |
| CN116334235A (en) * | 2022-09-21 | 2023-06-27 | 华南农业大学 | SERCA2 gene molecular marker related to chicken carcass traits and application thereof |
| CN116334235B (en) * | 2022-09-21 | 2023-11-24 | 华南农业大学 | SERCA2 gene molecular marker related to chicken carcass traits and application thereof |
| CN116814801A (en) * | 2023-05-10 | 2023-09-29 | 华南农业大学 | LncEDCH1 gene molecular marker related to chicken skin yellowness and application thereof |
| CN116814801B (en) * | 2023-05-10 | 2024-03-08 | 华南农业大学 | LncEDCH1 gene molecular marker related to chicken skin yellowness and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114457170B (en) | 2022-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114457170B (en) | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof | |
| CN114438231B (en) | CRELD1 gene molecular marker related to chicken carcass traits and application | |
| CN107475412B (en) | Molecular marker related to egg-laying traits of chickens and application of molecular marker in chicken breeding | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN114150070A (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| CN115820870B (en) | CDK5 gene molecular marker related to chicken complexion and carcass traits and application | |
| CN115851966B (en) | ApoD gene molecular marker related to chicken carcass traits and application | |
| CN114317780B (en) | SNP molecular marker related to chicken prematurity and application | |
| CN115896299A (en) | PSMD3 gene molecular marker related to chicken skin color character and carcass character and application thereof | |
| CN114457171B (en) | Haplotype molecular marker related to reproductive performance of laying ducks and application thereof | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN114350818A (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| CN110835651B (en) | Primer and kit for detecting indel multiple allele markers of chicken CDKN3 gene promoter region and application of primer and kit | |
| CN116334235B (en) | SERCA2 gene molecular marker related to chicken carcass traits and application thereof | |
| CN111961732A (en) | Molecular marker influencing full bore weight of chicken and application thereof | |
| CN115992248B (en) | Molecular marker related to muscovy duck propagation traits and application thereof | |
| CN114622020B (en) | KLHL31 gene molecular marker related to chicken growth traits and application thereof | |
| CN115820872B (en) | Molecular marker related to pheasant reproduction traits and application thereof | |
| CN116590431B (en) | Molecular marker related to chicken carcass traits and application thereof | |
| CN110923337B (en) | Molecular marker related to anti-DHAV-3 character of Beijing duck and application thereof | |
| CN116555446B (en) | DCT gene molecular marker related to black peritoneum character of chicken and application | |
| CN117305476A (en) | PDK4 gene molecular marker related to chicken carcass traits and application thereof | |
| CN105256045A (en) | Method for identifying pH value of longissimus muscle of back of pig butchered for 24 hours and specialized primer pair thereof | |
| CN116694774A (en) | LncEDCH1 gene molecular marker related to chicken carcass traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |