CN114457105A - Carrier skeleton, positioning expression system based on carrier skeleton and hypocrea orientalis low-background engineering strain and application - Google Patents

Abstract

The invention relates to the technical field of microorganisms, in particular to a carrier skeleton, a positioning expression system based on the carrier skeleton and low background engineering strains of hypocrea orientalis and application. The vector framework gene sequence is shown as SEQ ID NO.1, and comprises an aspartic acid proteolytic enzyme upstream and downstream homology arms of hypocrea orientalis delta xyr1-3, a resistance marker gene expression box and an enzyme cutting site inserted by a target gene expression box, so that the expression and mutation research of different genes, such as the expression and mutation research of protease in the system, is facilitated. According to the positioning expression system of the low background engineering strain based on the vector skeleton pUC-ASPG and the extracellular protein of the hypocrea orientalis, xyr1 genes are knocked out, the strain delta xyr1-3 basically does not express cellulase and hemicellulase under induction conditions, background expression of the cellulase and the hemicellulase is eliminated, and the hypocrea orientalis delta xyr1-3 is suitable for expression and mutation research of the cellulase, the hemicellulase and other fungi secretory proteins.

Description

Carrier skeleton, positioning expression system based on carrier skeleton and hypocrea orientalis low-background engineering strain and application

Technical Field

The invention relates to the technical field of microorganisms, in particular to a carrier skeleton, a positioning expression system based on the carrier skeleton and low background engineering strains of hypocrea orientalis and application.

Background

Lignocellulose is a macromolecular polysaccharide polymer widely existing in nature and belongs to the most abundant renewable biological resources on the earth. The cellulose can be degraded into fermentable sugars such as monosaccharide by using cellulase to produce biofuel (such as bioethanol), bio-based fine chemical products and medicines. Is used for replacing or partially replacing fossil energy sources to reduce environmental pollution. However, the cost of cellulase is one of the major bottlenecks in the industrial application of cellulose chemical conversion.

The modification of cellulase proteins is mainly carried out in E.coli or yeast, but the expression systems of both are different from those of filamentous fungi, for example, the difference can cause the hyperglycosylation or folding of the enzyme, thereby causing the difference existing between the improved enzymes in the two systems and the filamentous fungi. The filamentous fungi producing cellulase is the best expression system, but the expression of cellulase and hemicellulase exists in the filamentous fungi even under non-induction conditions, so that the expressed target protein is polluted, the purification is difficult, and the property research of the engineering enzyme is influenced.

At present, the production efficiency of a certain specific enzyme can be improved mainly by constructing an engineering bacterium through overexpression of a certain enzyme-producing gene of the engineering bacterium, for example, a Trichoderma reesei genetic engineering bacterium which can produce cellulase at high yield under the induction of soluble and non-soluble carbon sources and is disclosed by a patent document with the publication number of CN107012102B and the publication number of 2020, 06, 30 is obtained by overexpression of bgl1-his gene in Trichoderma reesei C-30, and is classified and named as Trichoderma reesei and strain number SEU-7, and the engineering bacterium SEU-7 shows extremely high cellulase-producing capacity under the induction of the soluble carbon source and the non-soluble carbon source.

However, the insertion site of the target gene of the construction mode of the engineering bacteria has randomness, and the expression difference of the engineering bacteria protein of different transformants is large, so that the random insertion method is not beneficial to the research of directed evolution of a certain specific enzyme gene.

Disclosure of Invention

In order to fix a target gene at a certain specific position on a host chromosome for effective expression, the invention provides a vector framework, which is specifically named as vector framework pUC-ASPG, and the gene sequence of the vector framework is shown as SEQ ID NO. 1.

Based on the above protocol, in one embodiment, the vector backbone pUC-ASPG is an expression cassette containing a resistance selection marker gene inserted between the UAsp and the DAsp of a vector pUC-eASP comprising the 5 'flanking sequence (UAsp) and the 3' flanking sequence (DAsp) of aspartic acid proteolytic enzyme (Asp).

Based on the above scheme, in one embodiment, the sequence of the vector pUC-eASP is shown in SEQ ID NO. 2.

Based on the above scheme, in one embodiment, the resistance selection marker gene is G418, and the expression cassette is eG 418.

The invention also provides a positioning expression system, which comprises the vector skeleton pUC-ASPG, hypocrea orientalis delta xyr1-3, a promoter and a terminator, wherein the hypocrea orientalis delta xyr1-3 is obtained by knocking out xyr1 gene by taking hypocrea orientalis EU7-22 as an initial strain; the hypocrea orientalis delta xyr1-3 can not detect cellulase and hemicellulase activity basically even under induction conditions, provides a low background host for the expression of a certain specific cellulase or hemicellulase and the like, and is convenient for the purification of correspondingly expressed enzyme protein.

The preservation number of the hypocrea orientalis EU7-22 is CCTCC NO: m20211189, which is classified and named as Trichoderma orientalis, has a Latin literature name of Trichoderma orientalis EU7-22, is preserved in China center for type culture Collection, and has an address of Wuhan university, Wuhan City, China, a postal code of 430072 and a preservation date of 2021, 9 months and 17 days.

The direct source of the hypocrea orientalis EU7-22 is obtained from laboratories of Xiamen university, and the original source is obtained by separation from rotten corncobs of Xiamen city, Fujian province and mutagenesis after physicochemical mutagenesis.

Based on the scheme, in one embodiment, the hypocrea orientalis delta xyr1-3 is obtained by transforming protoplast of hypocrea orientalis EU7-22 with a xyr1 knockout cassette, and the gene sequence of the xyr1 knockout cassette is shown as SEQ ID No. 3.

Based on the above scheme, in one embodiment, the promoter and the terminator are the promoter Ppdc and the terminator Tpdc of pyruvate decarboxylase (pdc) gene in trichoderma reesei QM9414, respectively. The constitutive promoter Ppdc can make the gene expressed under the condition that glucose is used as a carbon source, so that the culture medium is simplified, and the purity of the secreted protein is further improved.

The invention also provides a specific method for expressing a certain gene by adopting the positioning expression system, which comprises the following steps:

carrying out enzyme digestion, connection and transformation on the vector skeleton pUC-ASPG and an expression cassette containing a target gene, and then carrying out positive cloning to obtain a vector containing a target gene positioning expression cassette;

and then cloning an expression cassette containing a target gene by using a vector containing the target gene positioning expression cassette as a template, converting the expression cassette into the hypocrea orientalis delta xyr1-3 to obtain a positive transformant, and verifying a positive clone.

Based on the above scheme, in one embodiment, the expression cassette containing the target gene is transformed into hypocrea orientalis Δ xyr1-3 by PEG-mediated transformation.

Based on the above, compared with the prior art, the invention has the following technical effects:

the vector framework pUC-ASPG constructed by the invention comprises upstream and downstream homology arms of aspartic acid proteolytic enzyme of hypocrea orientalis delta xyr1-3, a resistance marker gene expression box and an enzyme cutting site inserted by a target gene expression box, and is convenient for expression and mutation research of different genes, such as expression and mutation research of protease in the system.

The invention constructs a diapason positioning expression system of the hypocrea of the oriental meat, which comprises delta xyr1-3 of the hypocrea of the oriental meat with xyr1 gene knocked out, a vector framework pUC-ASPG, a constitutive promoter Ppdc and a terminator Tpdc thereof, after xyr1 gene knocked out, the strain delta xyr1-3 basically does not express cellulase and hemicellulase under induction conditions, the background expression of the cellulase and the hemicellulase is eliminated, and an electrophoretogram is relatively clean, so that the hypocrea of the oriental meat is delta xyr1-3 is suitable for the expression and mutation research of secreted proteins of the cellulase, the hemicellulase and other fungi.

Additional features and advantages of the invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objectives and other advantages of the invention will be realized and attained by the structure particularly pointed out in the written description and claims hereof as well as the appended drawings.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the description of the embodiments or the prior art will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts; in the following description, the drawings are illustrated in a schematic view, and the drawings are not intended to limit the present invention.

FIG. 1 is a schematic diagram of the structure of a pUC-eASP vector;

FIG. 2 is an amplification electrophoretogram during construction of the pUC-eASP vector;

FIG. 3 is a schematic diagram of the structure of vector backbone pUC-ASPG;

FIG. 4 is an amplified electrophoretogram during construction of vector backbone pUC-ASPG;

FIG. 5 is a schematic view of a process for preparing hypocrea orientalis Δ xyr 1-3;

FIG. 6 is an electrophoresis image of amplification during preparation of xyr1 knockout cassettes;

FIG. 7 is an electrophoretogram of a partial fragment of hygB gene cloned by primers hph-F and hph-R;

FIG. 8 is an electrophoretogram of a partial fragment of the gene xyr1 cloned by primers xyr1-F and xyr 1-R;

FIG. 9 is an electrophoretogram of fragment a in FIG. 5 amplified by primers Uxyr1-P1 and PgpdA-yz;

FIG. 10 is an electrophoretogram of fragment c in FIG. 5 amplified by primers Dxyr1-P6 and hph-yz;

FIG. 11-1 shows the results of measuring the activity of a filter paper enzyme (FPase);

FIG. 11-2 shows the results of the activity assay of endoglucanase (CMCase);

FIG. 11-3 shows the results of detecting the activity of exocellulase (PNPCase);

FIGS. 11 to 4 show the results of the activity assay of β -glucosidase (PNPGase);

FIGS. 11-5 show the results of the xylanase (xylanase) activity assay;

FIGS. 11 to 6 show the results of the activity assay of β -xylosidase (PNPXase);

FIG. 12 is SDS-PAGE patterns of hypocrea orientalis EU7-22 and hypocrea orientalis delta xyr1-3 extracellular protein;

FIG. 13 is an amplification electrophoretogram during construction of the xyn1 mapping expression cassette;

FIG. 14 is a schematic structural diagram of a vector pUC-ASPGXR;

FIG. 15 is an electrophoretogram of Sarcodon orientalis xyn1-3 verified by 4 rounds of PCR.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some embodiments of the present invention, but not all embodiments; the technical features designed in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other; all other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the description of the present invention, it is to be noted that all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs, and are not to be construed as limiting the present invention; it will be further understood that terms used herein should be interpreted as having a meaning that is consistent with their meaning in the context of this specification and the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

The "M" in the electropherograms referred to in the examples below is designated as marker and refers to the corresponding lane, e.g., M1 refers to lane 1, M2 refers to lane 2, etc.;

the formula of the protoplast enzymolysis solution is that the snailase is 10mg/mL, the cellulase is 10mg/mL, the zymolase is 1mg/mL and the lysine is 1mg/mL, 0.6mol/L KCl-0.05mol/L citric acid buffer solution is used for preparation, and the solution is filtered and sterilized and is used for preparation;

the formula of the MM liquid medium is 20g of glucose, (NH)₄)₂SO₄ 5g，KH₂PO₄ 15g，MgSO₄ 0.6g，CaCl₂0.6g, 10mL of microelement mother liquor, and adjusting the pH value to 5.5;

the formula of MK solid culture medium is 20g of glucose, (NH)₄)₂SO₄ 5g，KH₂PO₄ 15g，MgSO₄ 0.6g，CaCl₂0.6g, 0.6mol/L of KCl, 10mL of microelement mother liquor, and the pH value is 5.5;

the semisolid screening culture medium is MM culture medium or PDA culture medium containing 100 mu G/mL hygromycin B or 300 mu G/mL G418 and 1% agar;

microelement mother liquor (100 ×): FeSO₄·7H₂O 0.5g/L，MnSO₄·H₂O 0.16g/L，ZnSO₄·7H₂O 0.14g/L，CoCl₂·6H₂O 0.2g/L；

The inducer-free enzyme-producing medium is tryptone 5g/L, KH₂PO₄ 2.5g/L，MgSO₄ 0.5g/L，CaCl₂0.5g/L, 10mL of microelement mother liquor, and the pH value is 5.2; the inducer-free enzyme-producing medium is usually freed from the inducer, such as microcrystals, bran, in the induction medium.

Example 1: construction of vector skeleton pUC-ASPG vector

A. Construction of pUC-eASP vector

Referring to FIG. 1, the pUC-eASP vector has a structure comprising 5 'flanking sequence (UAsp) and 3' flanking sequence (DAsp) of aspartic acid proteolytic enzyme (Asp);

wherein, the primers UAsp-P1 and UAsp-eP3 are used for cloning the 5' flanking sequence (UAsp) of Asp, the amplified length is 2040bp, and the amplified result is shown as a lane 1 in a figure 2;

asp 3' flanking sequence (DAsp) clones were 2550bp in length using primers DAsp-eP4 and DAsp-P6, and the amplification is shown in lane 2 of FIG. 2;

the template used for the cloning is a hypocrea orientalis EU7-22 genome, then nested primers UAsp-eP2 and DAsp-eP5 are used for fusing the two fragments to obtain a fragment eASP (shown as a lane 3 in figure 2), three enzyme cutting sites are arranged between UAsp and DAsp of the eASP, namely Not1, Spe1 and Smi1 respectively, the vectors pUC19 and eASP are subjected to double enzyme cutting through XbaI and Sse 8387I respectively, then are transformed into escherichia coli DH5 alpha competence after being connected through T4 ligase, positive transformants are obtained on an ampicillin resistant plate, and the correct pUC-eASP vector is obtained after enzyme cutting verification and sequencing.

B. Construction of vector backbone pUC-ASPG

Based on pUC-eASP, G418 was used as a resistance selection marker to construct a pUC-ASPG vector, and with reference to FIG. 3, an expression cassette of G418 (eG418) was inserted between UAsp and DAsp, as follows:

cloning the promoter PgpdA of the eG418 cassette by the primers PgpdA-P1 and PgpdA-eP3 (the PgpdA promoter represents the promoter of the Aspergillus nidulans glyceraldehyde triphosphate dehydrogenase gene), the length of the clone is 2225bp, and the electrophoresis chart of the amplification result is shown as lane 1 in FIG. 4;

cloning the G418 gene by primers G418-F and G418-R, the length of the clone is 795bp, and the cloning result is shown as lane 2 in FIG. 4;

the terminator TtrpC of the eG418 cassette was cloned by primers TtrpC-egP4 and TxtrpC-P6, the cloning length was 858bp, and the cloning results are shown in lane 3 of FIG. 4;

the template used for the above 3 fragment clones was plasmid pUR5750, and these three fragments were subjected to fusion PCR using primers PgpdA-ssF and TtrpC-hsR to obtain an eG418 cassette fragment, which was 3740bp in length, as shown in lane 4 of FIG. 4.

And (3) recovering the eG418 box fragment, performing double enzyme digestion on the eG418 box fragment and the vector pUC-eASP respectively, connecting, converting to escherichia coli competence, verifying a positive clone through colony PCR, performing double enzyme digestion and sequencing verification on the plasmid, and finally obtaining a correct expression vector skeleton pUC-ASPG.

TABLE 3.1 primers used for vector backbone construction

Primer name	Primer sequence (5 '-3')
		UAsp-P1	TGGAGTAGCATAGGTAAGGCCT
UAsp-eP2	TGCTCTAGA(XbaI)TCATCAACCATGGAAGGAGC
		UAsp-eP3	ATTTAAATACTAGTGCGGCCGCGACTGGACTTGTCTTGAAGGCT
DAsp-eP4	GCGGCCGCACTAGTATTTAAATAGGCACGGACAGAGTAAGTGC
		DAsp-eP5	TTCCTGCAGG(Sse8387I)TAGACGGGCATCCAACTACG
DAsp-P6	AAGACGCCGACACCTCAAC
		PgpdA-P1	TTGTAAAACGACGGCCAGTG
PgpdA-ssF	TTCCTGCAGGACTAGT(SpeI)GATCTTTCGACACTGAAATACGTC
		PgpdA-eP3	TGCAATCCATCTTGTTCAATCATGGTGATGTCTGCTCAAGCGG
TtrpC-egP4	GCCTTCTTGACGAGTTCTTCTGAAGTAGATGCCGACCGGGAT
		TtrpC-hsR	CCCAAGCTTATTTAAAT(SmiI)AAGAAGGATTACCTCTAAACAAGTG
TxtrpC-P6	CACAGGAAACAGCTATGACCATG
		G418-F	ATGATTGAACAAGATGGATTGCA
G418-R	TCAGAAGAACTCGTCAAGAAGGC
		Ppdc-1F	GAGGACTTCCAGGGCTACTTG
Ppdc-2F	TGCTCTAGAGCGGCCGC(NotI)GCCATGAATTCCATCTTTCGA
		Ppdc-X1R	GAGGGAGGTGAAGGAGACCATGATTGTGCTGTAGCTGCGCT
Tpdc-X1F	GCTTCCATCACCGTCAGCTAACCCGGCATGAAGTCTGACC
		Tpdc-2R	TTCCTGCAGGACTAGT(SpeI)TCTCGCATACGTGACCCAGAT
Tpdc-1R	TGGACGCCTCGATGTCTTCC
		Xyn1-F	ATGGTCTCCTTCACCTCCCTC
Xyn1-R	TTAGCTGACGGTGATGGAAGC

Example 2: construction of Hypocrea orientalis delta xyr1-3

By knocking out the key gene xyr1 of the cellulase produced by the hypocrea orientalis, the background expression of cellulase, hemicellulase and the like existing in the hypocrea orientalis EU7-22 is eliminated.

A. xyr1 construction of knockout cassettes

Knocking out xyr1 gene of hypocrea orientalis EU7-22 according to the principle of homologous double exchange, wherein the knocking-out schematic diagram is shown in FIG. 5:

xyr1 the 5' flanking sequence of the knockout cassette was amplified by primers Uxyr-P1 and Uxyr-P3, and the results of the amplification are shown in FIG. 6, Lane 1;

xyr1 the 3' flanking sequence of the knockout cassette was amplified by primers Dxyr-P4 and Dxyr-P6, as shown in FIG. 6, lane 2;

the hygromycin cassette was amplified by primers PgpdA-P2 and TgtrpC-P5, as shown in FIG. 6-lane 3;

finally, the 3 fragments were subjected to fusion PCR using nested primers Uxyr-P2 and Dxyr-P5 to obtain a xyr1 knockout cassette (kxyr1) fragment, which is shown in FIG. 6-lane 4.

B. The method is used for preparing protoplasts of hypocrea orientalis EU7-22, and comprises the following specific operations:

inoculating 2-ring PDA or MM plate activated 4-5d hypocrea to 50mL MM liquid culture medium, and culturing at 30 ℃ and 180rpm for 42 h;

filtering hypha with sterilized three-layer lens wiping paper, washing with 0.6mol/L KCl-0.05mol/L citric acid buffer solution for 2-3 times, draining with sterilized tweezers, and weighing;

weighing 1.0g of wet thallus, adding 10mL of protoplast enzymolysis liquid, carrying out enzymolysis for 1.5-2.0 h at 32 ℃, observing the formation condition of the protoplast by using an optical microscope in the enzymolysis process, and reducing the regeneration rate of the protoplast due to too long enzymolysis time, so that the enzymolysis time is not more than 2 h;

fourthly, adding 0.6mol/L KCl solution with the same volume after the enzymolysis is finished, filtering the solution by using three layers of mirror paper, then filtering the solution by using a cotton column with the length of about 0.5cm, centrifuging the filtrate for 15min at the temperature of 4 ℃ at 4000rpm, and removing clear liquid;

re-suspending with 2mL of 0.6mol/L KCl solution, subpackaging in 1.5mL centrifuge tubes, centrifuging at 4 ℃ and 4000rpm for 10min, and removing supernatant;

sixthly, adding 1mL of 0.6mol/L KCl for resuspension, centrifuging for 10min at the temperature of 4 ℃ and the rotating speed of 4000rpm, removing supernatant, and repeating the step twice;

seventhly, 0.5mL of 0.6mol/L KCl-50mmol/L CaCl is used₂Resuspending the solution and mixing the twoCombining the tubes into one tube, centrifuging at 4 deg.C and 4000rpm for 10min, and removing supernatant;

eighty percent of proper amount of 0.6mol/L KCl-50mmol/CaCl₂The solution was resuspended and then aliquoted 100. mu.L/tube for the next transformation.

C. xyr1 knockout box fragment transformation and transformant primary screening

The kxyr1 fragment obtained is transformed into protoplast of hypocrea orientalis EU7-22 by a PEG mediated method, and the specific operation steps are as follows:

adding 10 mu L of kxyr1 fragments (about 1-2 mu g) into 100 mu L of the separately packaged protoplasts, and uniformly mixing for 6-8 times in a vortex for 1s each time;

adding 50 mu L of sterilized PEG solution, carrying out vortex oscillation for 4-5 times, each time for 1s, and carrying out ice bath for 25 min;

adding 1mL of PEG solution, uniformly mixing by blowing and sucking with a pipette gun, blowing and sucking for at least more than 10 times, and standing for 25min at room temperature;

adding the mixed solution into a proper amount of MK solid culture medium which is just sterilized and cooled to 50 ℃, pouring a flat plate, and culturing at 30 ℃ for about 36-48 hours after the culture medium is solidified;

fifthly, adding a layer of semisolid screening culture medium after hyphae can be observed on the flat plate, and carrying out upright culture, wherein whether bacterial colonies appear or not is observed every day in the culture process, and the number of the bacterial colonies is generally not more than 7 days;

sixthly, picking the grown bacterial colony to a new hygromycin B resistant plate to see whether the bacterial colony grows or not;

seventhly, transferring the transformants capable of growing to a PDA (personal digital assistant) plate for growing for 4-5d, streaking and inoculating to a hygromycin B resistant plate, culturing for 1-2 d, and then selecting a single colony to the PDA plate for continuous culture for 5-7 d. The purpose of this step is to remove heterokaryons and obtain pure transformants;

extracting transformant genome DNA as a template for verifying a transformant by a microwave simple extraction method, and specifically operating as follows:

after the kxyr1 fragment was transferred to hypocrea orientalis EU7-22, a total of 20 transformants were obtained, and after heterokaryons were removed from the 20 transformants, genomic DNAs of the 20 transformants were extracted by the microwave simple method for PCR verification, which was performed 4 times in total as follows:

1, time: the cloning by primers hph-F and hph-R was a partial fragment of the hygB gene (PhygB, as shown in B in FIG. 5), the cloning length was 811bp, and the results are shown in FIG. 7, from which it can be seen that 20 transformants all cloned the PhygB fragment, indicating that the xyr1 knockout cassette of the 20 transformants had successfully integrated into the genomic DNA of hypocrea orientalis;

and 2, time: the xyr1 gene was cloned by primers xyr1-F and xyr1-R, the length of the clone is 2944bp, the cloning result is shown in FIG. 8, and it can be seen that 5 transformants can be cloned to the original gene, the 5 transformants are transformants No.2, 7, 8, 10 and 17 respectively, which indicates that the 5 transformants kxyr1 are integrated into the genome by means of non-homologous recombination;

and (3) time: the 15 transformants integrated into the genome in a manner other than the above non-homologous recombination were subjected to 5' flanking clone verification using Uxyr1-P1 and PgpdA-yz as primers, and the amplified fragment was a in FIG. 5, the amplified length was 3285bp, and the amplification results are shown in FIG. 9.

4, time: 3 'flanking clone verification is carried out on the 15 transformants, primers for 3' flanking clone verification are Dxyr1-P6 and hph-yz, the amplified fragment is shown as a c fragment in figure 5, the length is 3837bp, and the amplification result is shown as figure 10.

As can be seen from the validation results (see FIGS. 9 and 10), the 5 'and 3' flanking clones of the 15 transformants verified the expected size of the target band, indicating that the 15 transformants all underwent homologous double crossover.

Ninthly, randomly selecting one transformant (namely engineering bacteria) from the 15 transformants which are subjected to homologous double exchange, and naming the transformant as hypocrea orientalis delta xyr1-3, and carrying out enzyme production analysis, wherein the specific operation is as follows:

culturing hypocrea orientalis EU7-22 and hypocrea orientalis delta xyr1-3 on a PDA (personal digital Assistant) plate for 4-5 days, and culturing with ddH (ddH)₂Spores were washed out of O and inoculated into 100mL MM medium (10)⁵spores/mL), and culturing for 36h by shaking at 30 ℃ and 180 rpm;

then filtering by using a G5 sand core funnel, cleaning for 2-3 times by using an inducer-free enzyme production culture medium, weighing equivalent hyphae, ensuring that the inoculated hyphae amount of each bottle is consistent, the liquid loading amount of each bottle is 50mL, performing shake culture at 30 ℃ and the rotating speed of 180rpm, extracting 3 bottles of enzyme liquid from each strain every 24 hours, centrifuging at normal temperature and the rotating speed of 6000rpm, and taking the supernatant to measure the enzyme activity (the extraction amount of the enzyme liquid in the step can be determined according to the required amount in actual detection);

the activities of the filter paper enzyme (FPase), the endocellulase (CMCase), the exocellulase (PNPCase), the beta-glucosidase (PNPGase), the xylanase (xylanase) and the beta-xylosidase (PNPXase) of the obtained enzyme solution are respectively measured, the detection results are shown in figures 11-1 to 11-6, and the corresponding activities of the cellulase and the hemicellulase can hardly be detected in hypocrea delta xyr 1-3.

FIG. 12 shows SDS-PAGE patterns of extracellular proteins of Sarcodon orientalis EU7-22 and Sarcodon orientalis delta xyr1-3, in which E1-E5 and X1-X5 respectively show electrophoresis results of EU7-22 and delta xyr1-3 from day 1 to day 5; the background of the electrophorogram of delta xyr1-3 was found to be low by SDS-PAGE analysis, and it was suitable for individual expression and mutation studies of a certain protein of cellulase or hemicellulase.

TABLE 3.2 xyr1 primers used for knockout cassette construction and transformant validation

Example 3: construction of hypocrea orientalis xyn1-3

This example is a specific application of the localization expression system provided by the present invention in constructing xylanase 1 expression strains, and the application concept is as follows:

carrying out enzyme digestion, connection and transformation on the vector skeleton pUC-ASPG and an expression cassette containing xylanase 1 gene (xyn1), and verifying positive clones to obtain a vector pUC-ASPGXR containing a xyn1 positioning expression cassette;

then, an expression cassette containing xyn1 is cloned by taking a vector pUC-ASPGXR as a template, and transformed to the hypocrea orientalis delta xyr1-3 to obtain a positive transformant.

The method specifically comprises the following steps:

A. the construction of the xyn1 positioning expression cassette comprises the following specific operation steps:

firstly, cloning a pdc gene promoter sequence of Trichoderma reesei QM9414 by using primers Ppdc-1F and Ppdc-X1R, wherein the cloning length is 1556bp, and an electrophoresis diagram of an amplification result is shown as a lane 1 in FIG. 13;

the terminator sequence of the pdc gene was cloned by the primers Tpdc-X1F and Tpdc-1R, the cloning length was 1051bp, and the electrophoresis pattern of the amplification result is shown in lane 2 of FIG. 13;

cloning the two fragments by taking the genome of the trichoderma reesei QM9414 as a template;

secondly, cloning a xylanase 1(Xyn1) gene fragment of the hypocrea orientalis by taking the hypocrea orientalis EU7-22 genome as a template, wherein the sequence of Xyn1 is shown as SEQ ID NO.4, the cloned primers are Xyn1-F and Xyn1-R, the cloning length is 675bp, and the result is shown as a lane 3 in FIG. 13;

thirdly, three fragments obtained by cloning in the first step and the second step are fused through primers Ppdc-2F and Tpdc-2R to obtain an xyn1 positioning expression box with the length of 2855bp, and the result is shown in a lane 4 in a figure 13.

B. The construction of the vector pUC-ASPGXR comprises the following specific operation steps:

carrying out double enzyme digestion and connection on the vector framework pUC-ASPG and xyn1 positioning expression cassettes constructed in the embodiment 2 through NotI and SpeI respectively, then transforming the vector framework pUC-ASPG and xyn1 positioning expression cassettes into escherichia coli DH5 alpha, carrying out PCR verification on positive clones, selecting 1-2 clones with correct PCR verification, carrying out plasmid extraction and enzyme digestion, and sending to sequencing verification, so that a correct vector pUC-ASPGXR with the xyn1 positioning expression cassettes is obtained, wherein the structure of the vector pUC-ASPGXR is shown in FIG. 14; the sequence is shown as SEQ ID NO. 5.

C. The xyn1 location expression cassette transformation and validation method comprises the following specific operation steps:

cloning an xyn1 positioning expression box by using primers ASP-xATF and ASP-xR and taking plasmid pUC-ASPGXR as a template, and transforming a purified proper amount of the expression box into a strain delta xyr1-3 through PEG mediation to obtain a positive transformant xyn1-3 strain; it should be noted that the detailed steps of the transformation process are the same as those of the xyr1 knockout box transformed hypocrea orientalis EU7-22 or those skilled in the art can obtain the corresponding xyn1-3 strain by performing the above-mentioned steps, and the details are not repeated herein.

The hypocrea orientalis xyn1-3 strain is subjected to PCR verification to determine whether the transformant is correctly recombined to an expected position in a double exchange mode, and the PCR verification is carried out for 4 times in total:

and 1, round: cloning of the Asp gene by primers ASP-F and ASP-R, as shown in lanes 1 and 2 in FIG. 15, with a band for Δ xyr1-3 and no corresponding band for xyn1-3 (1280 bp);

and 2, round 2: cloning of the resistance gene G418 by primers G418-F and G418-R, as shown in lanes 3 and 4 in FIG. 15, there was no band for Δ xyr1-3 and a corresponding band (795bp) for xyn 1-3;

and (3) round: upstream site-directed crossover was confirmed by primers UAsp-P1 and PgpdA-yz, and the cloned fragment was about 6000bp in length, as shown in lanes 5 and 6 in FIG. 15, with no band in strain Δ xyr1-3 and a band in strain xyn 1-3;

and 4, round: cloning by primers G418-F and DAsp-P6 gave a length of approximately 4053bp, as shown in FIG. 15 in lanes 7 and 8, with no band for Δ xyr1-3 and a band for xyn1-3 around 4000 bp.

The successful insertion of the xyn1 expression cassette at the Asp gene position of the delta xyr1-3 strain was demonstrated by these 4 rounds of PCR.

Inoculating hypocrea orientalis xyn1-3 strain cultured by PDA for 4-5 days into 50mL MM culture medium (10 mL)⁵spores/mL), inoculating into an expression culture medium after culturing for 18h, and determining the xylanase activity of a culture solution by using 1% beech xylan after culturing for 5d, wherein the xylanase activity is determined to reach 236.49 IU/mL. When the Pichia pastoris which is commonly used for producing xylanase in the field is cultured in the same culture medium for 144h, the xylanase activity is only measured to reach 174 IU/mL.

Therefore, the embodiment combines the vector framework provided by the invention with the target gene xyn1, and transforms the corresponding expression cassette into the hypocrea orientalis delta xyr1-3 to obtain the hypocrea orientalis xyn1-3 inserted according to the expected location, which is obviously superior to the saccharomyces pombe in terms of xylanase expression.

The formula of the expression culture medium comprises the following components in percentage by mass: 7% glucose, 3% tryptone, 1.5% potassium dihydrogen phosphate, 0.006% anhydrous magnesium sulfate, 0.006% calcium chloride, 10ml/L microelement mother liquor (100X), and pH 5.2;

the 1% zelkova xylan determination culture solution comprises the following components in percentage by weight: 10g of beech xylan were dissolved in 90mL of citric acid buffer (pH 4.8,0.05mol/L) and brought to 100mL with buffer.

TABLE 3.3 primers used in the construction of hypocrea orientalis xyn1-3

Primer name	Primer sequence (5 '-3')
		ASP-xF	CATCAACCATGGAAGGAGCG
ASP-xR	TAGACGG GCATCCAACTACG
		ASP-F	ATGCAGACCTTTGGAGCTTTTC
ASP-R	TTATTTCTGAGCCCAGCCCAG

In conclusion, compared with the prior art, the localized expression system provided by the invention can be used for researching the expression and mutation of the enzyme protein derived from the filamentous fungi, particularly the single expression and mutation research of cellulase and hemicellulase, and is convenient for the application of the mutant protein in the filamentous fungi.

In addition, it will be appreciated by those skilled in the art that, although there may be many problems with the prior art, each embodiment or aspect of the present invention may be improved only in one or several respects, without necessarily simultaneously solving all the technical problems listed in the prior art or in the background. It will be understood by those skilled in the art that nothing in a claim should be taken as a limitation on that claim.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Sequence listing

<110> university of mansion

<120> vector framework pUC-ASPG, positioning expression system based on vector framework and low background engineering strain and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10788

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat 420

cctctagaca tcaaccatgg aaggagcgca gtcgtcctta tcgcaaccat cacgtgctcc 480

agccagatga aacaacgact ttgtcccttc ttctcttctc gtaatactcc aaacttcgta 540

actcgtgaaa tcacacgcag cgtcgcattc gcctccaacg ccagcgccac tcgacaacgg 600

caacaacaac agcctcctcc cgttcggccg gttccgctgc ctcttttgct tcggccgact 660

gcaactggcg attcctcgca caggtctctt ttccaagact ccaacgaccg ccgtcagctg 720

catgccgaat agccggccag cagaccaggg gcccagcagc atccacgaga gcaaagcagc 780

gaattgtctc taatgacggc ctccatgacc cctgtccggc agctggagcg ggccttttgg 840

gctctgggcc ttttggacat gccgctctgg gcttgagctc gctgtaacga acttctgtca 900

cgcaccgcag ccacggcagc ccgtgatttg acggcttccg gtattgggat gagcagcaga 960

gatgagaggg ggatggcgat tcgggcacaa gttcccaccc ctgactgccg gacgccaagt 1020

cggttgtccc tgggccagcg acagtagtgc cacggcgcca gagccaatgg ccctcgaggc 1080

cgtccggacg agccccagga tcggaggcca cagcagattg gccctgttca tgccccgtca 1140

ccaggccgct ctgattgatg ggacggcgga tttaacatag gctaacggat tagacttaat 1200

tcggccgcct ggctgttgat ccataggcat tgggctagtt cattgttcag tcccctatgt 1260

gatgagcacg aggcagatct gagtcaagca aggcatggga tgggggctct tgtggcttgg 1320

cttcaccgtt gaagcgaaag agcctttggg ccacacgagg actgattcgt gcttgcggct 1380

ggtgactggc cgtttggggg cccgagcatg ccactgacag tgggatgcgg tggaacatga 1440

ttgcaacatc gctcccaaaa ggatggcctc ctttcttcgt ctgtccaggt cgacctcggt 1500

cggtcatatg aagcaaagga cgcgggcgca gtgtcattgc ccaagtcatg tcggcccgcc 1560

taccccagcc tgtcatatca tcgcacggac tgaactgtgg gctgctgttt aagcgtcgag 1620

caggaagacc cttgatagac aaagatcggc gatggatcct tctttcgagg cttgcttatt 1680

tcccttagcc tccgcggtgt tcagactgca cagccagcaa tgacttcgga ttggccggcc 1740

atcgtggcga ggaacgattg ttcaggaaga ccatcttgac ttgcgcgcct cgggggacag 1800

cactgttgcg ccgccccgag cgaatggccg tggccgtggg ctagcaggac tctggacttc 1860

tatcttggga tgcttcacga tacgtgatcg acaaaggttc cagcgtctcc attggagcaa 1920

ggcagaaatg gcagtacagc acgctctcgg ccgacctttc ttggtgggct agggaaccag 1980

gcacgccctc cacatggatg ccacccctgg acgcggatgc ttcattcgct cgcgggccgg 2040

ccacgacgac ctacagccat ctggcctgat tgcggagatc aattccacca tctcgactcc 2100

tcctgccatc accatgcccc ccagcaagtg tgtgaagctc ggggagaatg gcgcaaaccg 2160

accttcctaa accatgctct tgaggccgtc aacaacgaca atgcctcgga gacgcgagat 2220

tatcgacgag cgttgtcagt tgaactcaaa gggatataaa gacgtccggc ttccctccac 2280

ctggtgttgt tggagctctc ttctcatcag cctcatcagc cttcaagaca agtccagtcg 2340

cggccgcact agtgatcttt cgacactgaa atacgtcgag cctgctccgc ttggaagcgg 2400

cgaggagcct cgtcctgtca caactaccaa catggagtac gataagggcc agttccgcca 2460

gctcattaag agccagttca tgggcgttgg catgatggcc gtcatgcatc tgtacttcaa 2520

gtacaccaac cctcttctga tccagtcgat catcccgctg aagggcgctt tcgaatcgaa 2580

tctggttaag atccacgtct tcgggaagcc agcgactggt gacctccagc gtccctttaa 2640

ggctgccaac agctttctca gccagggcca gcccaagacc gacaaggcct ccctccagaa 2700

cgccgagaag aactggaggg gtggtgtcaa ggaggagtaa gctccttatt gaagtcggag 2760

gacggagcgg tgtcaagagg atattcttcg ctctgtatta tagataagat gatgaggaat 2820

tggaggtagc atagcttcat ttggatttgc tttccaggct gagactctag cttggagcat 2880

agagggtccc tttggctttc aatattctca agtatctcga gtttgaactt attcccgtga 2940

accttttatt caccaatgag cattggaatg aacatgaatc tgaggactgc aatcgccatg 3000

aggttttcga aatacatccg gatgtcgaag gcttggggca cctgcgttgg ttgaatttag 3060

aacgtggcac tattgatcat ccgatagctc tgcaaagggc gttgcacaat gcaagtcaaa 3120

cgttgctagc agttccaggt ggaatgttat gatgagcatt gtattaaatc aggagatata 3180

gcatgatctc tagttagctc accacaaaag tcagacggcg taaccaaaag tcacacaaca 3240

caagctgtaa ggatttcggc acggctacgg aagacggaga agcccacctt cagtggactc 3300

gagtaccatt taattctatt tgtgtttgat cgagacctaa tacagcccct acaacgacca 3360

tcaaagtcgt atagctacca gtgaggaagt ggactcaaat cgacttcagc aacatctcct 3420

ggataaactt taagcctaaa ctatacagaa taagatggtg gagagcttat accgagctcc 3480

caaatctgtc cagatcatgg ttgaccggtg cctggatctt cctatagaat catccttatt 3540

cgttgaccta gctgattctg gagtgaccca gagggtcatg acttgagcct aaaatccgcc 3600

gcctccacca tttgtagaaa aatgtgacga actcgtgagc tctgtacagt gaccggtgac 3660

tctttctggc atgcggagag acggacggac gcagagagaa gggctgagta ataagcgcca 3720

ctgcgccaga cagctctggc ggctctgagg tgcagtggat gattattaat ccgggaccgg 3780

ccgcccctcc gccccgaagt ggaaaggctg gtgtgcccct cgttgaccaa gaatctattg 3840

catcatcgga gaatatggag cttcatcgaa tcaccggcag taagcgaagg agaatgtgaa 3900

gccaggggtg tatagccgtc ggcgaaatag catgccatta acctaggtac agaagtccaa 3960

ttgcttccga tctggtaaaa gattcacgag atagtacctt ctccgaagta ggtagagcga 4020

gtacccggcg cgtaagctcc ctaattggcc catccggcat ctgtagggcg tccaaatatc 4080

gtgcctctcc tgctttgccc ggtgtatgaa accggaaagg ccgctcagga gctggccagc 4140

ggcgcagacc gggaacacaa gctggcagtc gacccatccg gtgctctgca ctcgacctgc 4200

tgaggtccct cagtccctgg taggcagctt tgccccgtct gtccgcccgg tgtgtcggcg 4260

gggttgacaa ggtcgttgcg tcagtccaac atttgttgcc atattttcct gctctcccca 4320

ccagctgctc ttttcttttc tctttctttt cccatcttca gtatattcat cttcccatcc 4380

aagaaccttt atttccccta agtaagtact ttgctacatc catactccat ccttcccatc 4440

ccttattcct ttgaaccttt cagttcgagc tttcccactt catcgcagct tgactaacag 4500

ctaccccgct tgagcagaca tcaccatgat tgaacaagat ggattgcacg caggttctcc 4560

ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc 4620

tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga 4680

cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt ggctggccac 4740

gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct 4800

gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa 4860

agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc 4920

attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct 4980

tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc 5040

caggctcaag gcgcgcatgc ccgacggcga tgatctcgtc gtgacccatg gcgatgcctg 5100

cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct 5160

gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct 5220

tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca 5280

gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga agtagatgcc gaccgggatc 5340

cacttaacgt tactgaaatc atcaaacagc ttgacgaatc tggatataag atcgttggtg 5400

tcgatgtcag ctccggagtt gagacaaatg gtgttcagga tctcgataag atacgttcat 5460

ttgtccaagc agcaaagagt gccttctagt gatttaatag ctccatgtca acaagaataa 5520

aacgcgtttc gggtttacct cttccagata cagctcatct gcaatgcatt aatgcattgg 5580

acctcgcaac cctagtacgc ccttcaggct ccggcgaagc agaagaatag cttagcagag 5640

tctattttca ttttcgggag acgagatcaa gcagatcaac ggtcgtcaag agacctacga 5700

gactgaggaa tccgctcttg gctccacgcg actatatatt tgtctctaat tgtactttga 5760

catgctcctc ttctttactc tgatagcttg actatgaaaa ttccgtcacc agcccctggg 5820

ttcgcaaaga taattgcact gtttcttcct tgaactctca agcctacagg acacacattc 5880

atcgtaggta taaacctcga aaatcattcc tactaagatg ggtatacaat agtaaccatg 5940

catggttgcc tagtgaatgc tccgtaacac ccaatacgcc ggccgaaact tttttacaac 6000

tctcctatga gtcgtttacc cagaatgcac aggtacactt gtttagaggt aatccttctt 6060

atttaaatag gcacggacag agtaagtgca cctcaatctc cttattgtac gcagtagact 6120

gacagaacca aaaacagacg gcagctacaa ctttggctac attgacacca gcgtcgccaa 6180

gggccccgtt gcctacacgc ccgttgacaa cagccagggc ttctgggagt ttactgccac 6240

gggctacgct gtcggcagcg gcaagctgaa ccgcaactcc atcgacggta ttgccgacac 6300

cggcaccacc ctgctcctcc tcgacgacga cgttgtcaac gcctactacg ccaacgtccg 6360

ctcggccgag tacgacaacc agcaggaggg tgtcgtcttc gactgcgacg aggacctgcc 6420

ttcgttcagc ttcggcgtgg gaggctccac catcaccatc cccggcaacc tgctgaacct 6480

gactcccctc gaggagggca gctccacctg cttcggtggt ctccagagca gctctggcat 6540

tggcatcaac atctttggtg atgttgccct caaggctgcc ctggttgtct ttgaccttgg 6600

caacgagcgt ctgggctggg ctcagaaata agcggtggcg tggacttaat gaaaaggtta 6660

tgggatcaat gatgattgga aaaaaaggct ctcaagactt gtaaataccc ttggtgtata 6720

tagccagaag tcggcacata gtggagcaat gacgaagtta ttgaaaggaa gctttgggtt 6780

tcatagactg tgagatgtgt gattggttac cgtatccgat tgtctttcgt attcatcaca 6840

actcagctgg caatctacct acgatgcttg gattgagctt ttacatcata cactggtcca 6900

tcatagccgt gaatagtggt ttgagaggct gatatatgat gtactcgaga atagtcaagg 6960

ttgattacgg ctcgtaactc tccattccca gtttgccccc cagtgtgtgg acggaggctg 7020

ctcatccact atcctttgcg gacgggccga taatttgttc taatcttgaa gtgtattcct 7080

gttgatgctc aagtattgag tgcgttggtt aagaccaaga tggggaggtg gtggccgtga 7140

aggatgcgaa actttggagg tgatgacttt ctcgagcgag tcggaggcgg gctacatatc 7200

aaggagagta actaacgctg ttgtatacac actttgtccg tccttttaca tgaagccacg 7260

catactagat aggcaagtga atgttattcc acttcgacta acagttgaca aacagctcct 7320

cctcatcatc tccctgcctg acatgcttct ccttgaaacc ccccttcagc taacaatact 7380

cttttctatc gccatccgct ggcctgcgca ttaggcagcg gggatgtcag cgagcccgat 7440

aatccccgtt ctgaacgagc tgaggaatcc ggctctgggt attctgttga tgcaatggcg 7500

gaagatgcag tgaacatgac atttgctccc ctgttttcct cctgaaatcc ccaactgtca 7560

tgaggacggt gtatgataag gtgcagctag tatgtgtgaa ctttctttcc gaagggagat 7620

ttctcgggca tggtgttagt gatagacgtg gggagcctcg ggagggtgca tacctttgct 7680

gaaggcgagt gcatgttctt cacctccaaa cgtggaagat gaagtccgtt gagcggacac 7740

acctcgaaac tccgaaaggt caaatgcgtc aagcagtaat aggttattcc tcgctttgat 7800

gtgagttgat attgagttgt tgcgtaggtg attatgtgag ttctcctttc ctatcgagtt 7860

gcggtttggc tgatatgtta gaggaggggg agttgagaat tgatgaggct atacaggata 7920

tcggtagagc attttgagga ccttgctacg gagcttgctg ttgctgcgat ggattaatgg 7980

atgtatggag ccgaggggtg atatttgtat gacgagtgtc gaaaccgccc cctgaacttt 8040

acggcgccat tatacagagc gtttgctgaa gaagtacttg tatcaatgcc gtctaactac 8100

cgccacctct tcgaaacaac cactcgtctc acaaatacac atctgtggca ctcttcatga 8160

acaaaggaca gcgaagaaaa agccggtcag cagccaaacc ggccccctga ccgaaaagct 8220

acccactccc acccagccac accgaggtcg cttccaacct ataaccggcg gttacaaagc 8280

cgatttcact acctctcttt cagcatgtaa tacatttatc agtcaatcag gcagtcacac 8340

cgcgtcagtt ggaatcatga caatgtttcc ttggcgggtt acatccgatg agaatctttg 8400

tatatcaaac gtccggaata ggcaggagaa atacgaggac tctcgagatc tgttaatccg 8460

gtgaaggggg atgtcatgaa tggacttgtt cgtgttatca accggacttt ctgagcgtag 8520

ttggatgccc gtctacctgc aggcatgcaa gcttggcgta atcatggtca tagctgtttc 8580

ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt 8640

gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc 8700

ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 8760

ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 8820

cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 8880

cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 8940

accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 9000

acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 9060

cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 9120

acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 9180

atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 9240

agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 9300

acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 9360

gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg 9420

gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 9480

gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 9540

gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 9600

acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 9660

tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 9720

ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 9780

catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 9840

ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 9900

caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 9960

ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 10020

tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 10080

cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 10140

aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 10200

tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 10260

gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 10320

cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 10380

aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 10440

tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 10500

tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 10560

gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 10620

atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 10680

taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa accattatta 10740

tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtc 10788

<210> 2

<211> 7081

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat 420

cctctagaca tcaaccatgg aaggagcgca gtcgtcctta tcgcaaccat cacgtgctcc 480

agccagatga aacaacgact ttgtcccttc ttctcttctc gtaatactcc aaacttcgta 540

actcgtgaaa tcacacgcag cgtcgcattc gcctccaacg ccagcgccac tcgacaacgg 600

caacaacaac agcctcctcc cgttcggccg gttccgctgc ctcttttgct tcggccgact 660

gcaactggcg attcctcgca caggtctctt ttccaagact ccaacgaccg ccgtcagctg 720

catgccgaat agccggccag cagaccaggg gcccagcagc atccacgaga gcaaagcagc 780

gaattgtctc taatgacggc ctccatgacc cctgtccggc agctggagcg ggccttttgg 840

gctctgggcc ttttggacat gccgctctgg gcttgagctc gctgtaacga acttctgtca 900

cgcaccgcag ccacggcagc ccgtgatttg acggcttccg gtattgggat gagcagcaga 960

gatgagaggg ggatggcgat tcgggcacaa gttcccaccc ctgactgccg gacgccaagt 1020

cggttgtccc tgggccagcg acagtagtgc cacggcgcca gagccaatgg ccctcgaggc 1080

cgtccggacg agccccagga tcggaggcca cagcagattg gccctgttca tgccccgtca 1140

ccaggccgct ctgattgatg ggacggcgga tttaacatag gctaacggat tagacttaat 1200

tcggccgcct ggctgttgat ccataggcat tgggctagtt cattgttcag tcccctatgt 1260

gatgagcacg aggcagatct gagtcaagca aggcatggga tgggggctct tgtggcttgg 1320

cttcaccgtt gaagcgaaag agcctttggg ccacacgagg actgattcgt gcttgcggct 1380

ggtgactggc cgtttggggg cccgagcatg ccactgacag tgggatgcgg tggaacatga 1440

ttgcaacatc gctcccaaaa ggatggcctc ctttcttcgt ctgtccaggt cgacctcggt 1500

cggtcatatg aagcaaagga cgcgggcgca gtgtcattgc ccaagtcatg tcggcccgcc 1560

taccccagcc tgtcatatca tcgcacggac tgaactgtgg gctgctgttt aagcgtcgag 1620

caggaagacc cttgatagac aaagatcggc gatggatcct tctttcgagg cttgcttatt 1680

tcccttagcc tccgcggtgt tcagactgca cagccagcaa tgacttcgga ttggccggcc 1740

atcgtggcga ggaacgattg ttcaggaaga ccatcttgac ttgcgcgcct cgggggacag 1800

cactgttgcg ccgccccgag cgaatggccg tggccgtggg ctagcaggac tctggacttc 1860

tatcttggga tgcttcacga tacgtgatcg acaaaggttc cagcgtctcc attggagcaa 1920

ggcagaaatg gcagtacagc acgctctcgg ccgacctttc ttggtgggct agggaaccag 1980

gcacgccctc cacatggatg ccacccctgg acgcggatgc ttcattcgct cgcgggccgg 2040

ccacgacgac ctacagccat ctggcctgat tgcggagatc aattccacca tctcgactcc 2100

tcctgccatc accatgcccc ccagcaagtg tgtgaagctc ggggagaatg gcgcaaaccg 2160

accttcctaa accatgctct tgaggccgtc aacaacgaca atgcctcgga gacgcgagat 2220

tatcgacgag cgttgtcagt tgaactcaaa gggatataaa gacgtccggc ttccctccac 2280

ctggtgttgt tggagctctc ttctcatcag cctcatcagc cttcaagaca agtccagtcg 2340

cggccgcact agtatttaaa taggcacgga cagagtaagt gcacctcaat ctccttattg 2400

tacgcagtag actgacagaa ccaaaaacag acggcagcta caactttggc tacattgaca 2460

ccagcgtcgc caagggcccc gttgcctaca cgcccgttga caacagccag ggcttctggg 2520

agtttactgc cacgggctac gctgtcggca gcggcaagct gaaccgcaac tccatcgacg 2580

gtattgccga caccggcacc accctgctcc tcctcgacga cgacgttgtc aacgcctact 2640

acgccaacgt ccgctcggcc gagtacgaca accagcagga gggtgtcgtc ttcgactgcg 2700

acgaggacct gccttcgttc agcttcggcg tgggaggctc caccatcacc atccccggca 2760

acctgctgaa cctgactccc ctcgaggagg gcagctccac ctgcttcggt ggtctccaga 2820

gcagctctgg cattggcatc aacatctttg gtgatgttgc cctcaaggct gccctggttg 2880

tctttgacct tggcaacgag cgtctgggct gggctcagaa ataagcggtg gcgtggactt 2940

aatgaaaagg ttatgggatc aatgatgatt ggaaaaaaag gctctcaaga cttgtaaata 3000

cccttggtgt atatagccag aagtcggcac atagtggagc aatgacgaag ttattgaaag 3060

gaagctttgg gtttcataga ctgtgagatg tgtgattggt taccgtatcc gattgtcttt 3120

cgtattcatc acaactcagc tggcaatcta cctacgatgc ttggattgag cttttacatc 3180

atacactggt ccatcatagc cgtgaatagt ggtttgagag gctgatatat gatgtactcg 3240

agaatagtca aggttgatta cggctcgtaa ctctccattc ccagtttgcc ccccagtgtg 3300

tggacggagg ctgctcatcc actatccttt gcggacgggc cgataatttg ttctaatctt 3360

gaagtgtatt cctgttgatg ctcaagtatt gagtgcgttg gttaagacca agatggggag 3420

gtggtggccg tgaaggatgc gaaactttgg aggtgatgac tttctcgagc gagtcggagg 3480

cgggctacat atcaaggaga gtaactaacg ctgttgtata cacactttgt ccgtcctttt 3540

acatgaagcc acgcatacta gataggcaag tgaatgttat tccacttcga ctaacagttg 3600

acaaacagct cctcctcatc atctccctgc ctgacatgct tctccttgaa accccccttc 3660

agctaacaat actcttttct atcgccatcc gctggcctgc gcattaggca gcggggatgt 3720

cagcgagccc gataatcccc gttctgaacg agctgaggaa tccggctctg ggtattctgt 3780

tgatgcaatg gcggaagatg cagtgaacat gacatttgct cccctgtttt cctcctgaaa 3840

tccccaactg tcatgaggac ggtgtatgat aaggtgcagc tagtatgtgt gaactttctt 3900

tccgaaggga gatttctcgg gcatggtgtt agtgatagac gtggggagcc tcgggagggt 3960

gcataccttt gctgaaggcg agtgcatgtt cttcacctcc aaacgtggaa gatgaagtcc 4020

gttgagcgga cacacctcga aactccgaaa ggtcaaatgc gtcaagcagt aataggttat 4080

tcctcgcttt gatgtgagtt gatattgagt tgttgcgtag gtgattatgt gagttctcct 4140

ttcctatcga gttgcggttt ggctgatatg ttagaggagg gggagttgag aattgatgag 4200

gctatacagg atatcggtag agcattttga ggaccttgct acggagcttg ctgttgctgc 4260

gatggattaa tggatgtatg gagccgaggg gtgatatttg tatgacgagt gtcgaaaccg 4320

ccccctgaac tttacggcgc cattatacag agcgtttgct gaagaagtac ttgtatcaat 4380

gccgtctaac taccgccacc tcttcgaaac aaccactcgt ctcacaaata cacatctgtg 4440

gcactcttca tgaacaaagg acagcgaaga aaaagccggt cagcagccaa accggccccc 4500

tgaccgaaaa gctacccact cccacccagc cacaccgagg tcgcttccaa cctataaccg 4560

gcggttacaa agccgatttc actacctctc tttcagcatg taatacattt atcagtcaat 4620

caggcagtca caccgcgtca gttggaatca tgacaatgtt tccttggcgg gttacatccg 4680

atgagaatct ttgtatatca aacgtccgga ataggcagga gaaatacgag gactctcgag 4740

atctgttaat ccggtgaagg gggatgtcat gaatggactt gttcgtgtta tcaaccggac 4800

tttctgagcg tagttggatg cccgtctacc tgcaggcatg caagcttggc gtaatcatgg 4860

tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc 4920

ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg 4980

ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc 5040

ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact 5100

gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 5160

atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 5220

caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 5280

cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 5340

taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 5400

ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 5460

tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 5520

gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 5580

ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 5640

aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 5700

agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 5760

agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 5820

cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 5880

gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 5940

atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat 6000

gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc 6060

tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg 6120

gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct 6180

ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca 6240

actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg 6300

ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg 6360

tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc 6420

cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag 6480

ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg 6540

ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag 6600

tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat 6660

agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg 6720

atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca 6780

gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca 6840

aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat 6900

tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag 6960

aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa 7020

gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt 7080

c 7081

<210> 3

<211> 9171

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gacatgaata ccggaaatag acctggcgat gctaccacgg gctacttgca ccctccttcg 60

ttgctctagc atttgccccc tttgcgccag tcctaccaag gtacaggaaa gtgcacgccg 120

atgcagacta acagcagcga tgaagaaaac ggggaaaacg gtgccgaaca agggcaggtg 180

gggcgatgac acgggccagt agcagtcgca gtccttggcg ctttccaacc tccactctgc 240

ttgctgcttg cctctttctg ctcgtgcttc ctgctcccgt gccaagcagc ggattgaatg 300

gcaggcaagt gcaagccgct gccatttccg ctggagattt gctcgatatt ctctggaagc 360

ggcggtggac ctgacactaa cgggtaatac aatcacaggc ctcagacacg gatcagagct 420

gtccgccgct cgatctggtt ggcccgtgct ccttccccaa cggcacatgc ttggtgcttg 480

gttactcccg tgagcgttcc tgctctggcg gcaagcggct tccttctccg cgcaacgacc 540

tcagaattga gtctgacctg cttcgtatcc gtgcttacct aacgtagtcc ggctttgcca 600

tcttcttctc ctccttggtc cttcagctaa tactgcaacg accctgactc agttgccccc 660

tcatctgaat tctcgtctat cgtgcatcga gcagatgcgg tgcatacgtt ctcgacactt 720

ggactgttct ttctatcttt ctttctttca ttctcctcac tcctcacgat cgccgtcgcc 780

gcaatataat cagacaacat gcagtcagat gagggggatg tcaaaatttt tcctcgctta 840

gcccaacgga gaccatttcc gagcgccgac tccctctctg gtctcccctt gtccggttgt 900

catttcccgg caggccctgt tcttggttcg tccggttggg gcagcagagc ccaaaaccgt 960

ggcgccactc gacgacccca tatcccatcg catggccccc ctgtacgcct ttccagaaac 1020

gcttagagtg gcttgaccca ttgggaaacg cctccgactt gcccatcttg ctgagctcag 1080

gtccgaggcc gcggttggtc gacggcggta ccaagcagtc actgcccgcc gagaggcgcc 1140

gtggtctggc acgagagcca gcctagaagc cagaatgacc gtcatgatgc cgccgaggca 1200

aaggaatgcc aggcagtgtg taccttgccc aaggacgaag tactgccagc ttcacgtcca 1260

ggctacaggc acatggccga cgactaaccc cgcataatgg tttactgctg aagccggtcc 1320

tcactacggg caataacccg ttcgatacgc gtggcgtcga gttgtccacg acctgctgct 1380

gcacgttcct tgaggaactg acaggcaccg cgagttgccc gacggatgag catgggaaaa 1440

tacgtcggag ggacgcggct ctatcacctt gaaacggata tgtcgattcg ccgacaaggg 1500

acgctgcgcg aggaccgctc cgtttctcgt cccggtgttg cttcaaacat gcgctcgtcc 1560

ctgtgcatgt atgtactgta catgtatgat ggcatgcggg ctggtagcgc gccctgtctg 1620

cccgccaggt tcgcccccct ttcttcccgt tcttcttttg tccgttgtct ctcattgtct 1680

ggggtaagag ccccaactgc cagtttctgg ggcgtcatag ccacgttggg atggcacgcc 1740

tctgcggctt gcctcacccc ccctttctcg attgtgatgt ggcggccggg gaaccatgag 1800

gaggaggagc acgaactgaa ctgcaagacg gaaacacctg ctcgcaggca ccaagagccg 1860

tgatgctact agtatctccg aaattccctt tggccatcta caagttcaca cataagagca 1920

atcgccctaa gcagacgcac caattgtgag cgcatcactg caccccagca tctccactcg 1980

catgtccacc tccacaaggt gctccatccc catcccattc tccagccatc catgaccatc 2040

acttggccac catcaactcc gcctccacac ccatcgacgg cttccctgcc tggctcgccc 2100

accctagcga ggtgctccta cggggccctc gcaagccttg tcttatggag gccctccggc 2160

gcggtgcgag gagcgaacag caataaaaat tgcgagagtc cccatatatt gcttccatga 2220

tggagctctc cggtcgtgtc ttttaactaa caccccccag tctctgcccc aactttgcca 2280

tctcttctgc tgcatcatct tctgtttgtt ttgtgtcatt gcctgctggt ttgtcgttgt 2340

ggctggcagc cgtgcagctt gtcaaaggcg cgctcgcgat agggagtttc gcctttttgc 2400

ctttcccctc ttcattatcc tcggactcag ccagtgagag ccgtcggcgg cgagtcacgt 2460

ctccgtccag agacgaccca ttgattgcag ccaagcattt catcccccag aaggatgtcg 2520

aattaacgaa cagtatattc agtctctcct ccattggata cctggtgtgc ggcagaaaca 2580

gcttctgtcc ccgacctttt tcctgctcag ggcttggcgc gatttctgcg cattttcagc 2640

atactcttgt ggtttgctct ctcaggtcct gagggttaca gccccctctc cttaacgcaa 2700

cttcatcgga cgcctcatcg cccgtttagc aacaagtggt caacgaaacg tcttcctgca 2760

gggatctttc gacactgaaa tacgtcgagc ctgctccgct tggaagcggc gaggagcctc 2820

gtcctgtcac aactaccaac atggagtacg ataagggcca gttccgccag ctcattaaga 2880

gccagttcat gggcgttggc atgatggccg tcatgcatct gtacttcaag tacaccaacg 2940

ctcttctgat ccagtcgatc atccgctgaa ggcgctttcg aatctggtta agatccacgt 3000

cttcgggaag ccagcgactg gtgacctcca gcgtcccttt aaggctgcca acagctttct 3060

cagccagggc cagcccaaga ccgacaaggc ctccctccag aacgccgaga agaactggag 3120

gggtggtgtc aaggaggagt aagctcctta ttgaagtcgg aggacggagc ggtgtcaaga 3180

ggatattctt cgactctgta ttatagataa gatgatgagg aattggaggt agcatagctt 3240

catttggatt tgctttccag gctgagactc tagcttggag catagagggt cctttggctt 3300

tcaatattct caagtatctc gagtttgaac ttattccctg tgaacctttt attcaccaat 3360

gagcattgga atgaacatga atctgaggac tgcaatcgcc atgaggtttt cgaaatacat 3420

ccggatgtcg aaggcttggg gcacctgcgt tggttgaatt tagaacgtgg cactattgat 3480

catccgatag ctctgcaaag ggcgttgcac aatgcaagtc aaacgttgct agcagttcca 3540

ggtggaatgt tatgatgagc attgtattaa atcaggagat atagcatgat ctctagttag 3600

ctcaccacaa aagtcagacg gcgtaaccaa aagtcacaca acacaagctg taaggatttc 3660

ggcacggcta cggaagacgg agaagccacc ttcagtggac tcgagtacca tttaattcta 3720

tttgtgtttg atcgagacct aatacagccc ctacaacgac catcaaagtc gtatagctac 3780

cagtgaggaa gtggactcaa atcgacttca gcaacatctc ctggataaac tttaagccta 3840

aactatacag aataagatag gtggagagct tataccgagc tcccaaatct gtccagatca 3900

tggttgaccg gtgcctggat cttcctatag aatcatcctt attcgttgac ctagctgatt 3960

ctggagtrcc agagggtcat gacttgagcc taaaatccgc cgcctccacc atttgtagaa 4020

aaatgtgacg aactcgtgag ctctgtacag tgaccggtga ctctttctgg catgcggaga 4080

gacggacgga cgcagagaga agggctgagt aataagccac tggccagaca gctctggcgg 4140

ctctgaggtg cagtggatga ttattaatcc gggaccggcc gcccctccgc cccgaagtgg 4200

aaaggctggt gtgcccctcg ttgaccaaga atctattgca tcatcggaga atatggagct 4260

tcatcgaatc accggcagta agcgaaggag aatgtgaagc caggggtgta tagccgtcgg 4320

cgaaatagca tgccattaac ctaggtacag aagtccaatt gcttccgatc tggtaaaaga 4380

ttcacgagat agtaccttct ccgaagtagg tagagcgagt acccggcgcg taagctccct 4440

aattggccca tccggcatct gtagggcgtc caaatatcgt gcctctcctg ctttgcccgg 4500

tgtatgaaac cggaaaggcc gctcaggagc tggccagcgg cgcagaccgg gaacacaagc 4560

tggcagtcga cccatccggt gctctgcact cgacctgctg aggtccctca gtccctggta 4620

ggcagctttg ccccgtctgt ccgcccggtg tgtcggcggg gttgacaagg tcgttgcgtc 4680

agtccaacat ttgttgccat attttcctgc tctccccacc agctgctctt ttcttttctc 4740

tttcttttcc catcttcagt atattcatct tcccatccaa gaacctttat ttcccctaag 4800

taagtacttt gctacatcca tactccatcc ttcccatccc ttattccttt gaacctttca 4860

gttcgagctt tcccacttca tcgcagcttg actaacagct accccgcttg agcagacatc 4920

accatgcctg aactcaccgc gacgtctgtc gagaagtttc tgatcgaaaa gttcgacagc 4980

gtctccgacc tgatgcagct ctcggagggc gaagaatctc gtgctttcag cttcgatgta 5040

ggagggcgtg gatatgtcct gcgggtaaat agctgcgccg atggtttcta caaagatcgt 5100

tatgtttatc ggcactttgc atcggccgcg ctcccgattc cggaagtgct tgacattggg 5160

gaattcagcg agagcctgac ctattgcatc tcccgccgtg cacagggtgt cacgttgcaa 5220

gacctgcctg aaaccgaact gcccgctgtt ctgcagccgg tcgcggaggc catggatgcg 5280

atcgctgcgg ccgatcttag ccagacgagc gggttcggcc cattcggacc gcaaggaatc 5340

ggtcaataca ctacatggcg tgatttcata tgcgcgattg ctgatcccca tgtgtatcac 5400

tggcaaactg tgatggacga caccgtcagt gcgtccgtcg cgcaggctct cgatgagctg 5460

atgctttggg ccgaggactg ccccgaagtc cggcacctcg tgcacgcgga tttcggctcc 5520

aacaatgtcc tgacggacaa tggccgcata acagcggtca ttgactggag cgaggcgatg 5580

ttcggggatt cccaatacga ggtcgccaac atcttcttct ggaggccgtg gttggcttgt 5640

atggagcagc agacgcgcta cttcgagcgg aggcatccgg agcttgcagg atcgccgcgg 5700

ctccgggcgt atatgctccg cattggtctt gaccaactct atcagagctt ggttgacggc 5760

aatttcgatg atgcagcttg ggcgcagggt cgatgcgacg caatcgtccg atccggagcc 5820

gggactgtcg ggcgtacaca aatcgcccgc agaagcgcgg ccgtctggac cgatggctgt 5880

gtagaagtac tcgccgatag tggaaaccga cgccccagca ctcgtccgag ggcaaaggaa 5940

tagagtagat gccgaccgcg ggatccactt aacgttactg aaatcatcaa acagcttgac 6000

gaatctggat ataagatcgt tggtgtcgat gtcagctccg gagttgagac aaatggtgtt 6060

caggatctcg ataagatacg ttcatttgtc caagcagcaa agagtgcctt ctagtgattt 6120

aatagctcca tgtcaacaag aataaaacgc gttttcgggt ttacctcttc cagatacagc 6180

tcatctgcaa tgcattaatg cattgactgc aacctagtaa cgccttncag gctccggcga 6240

agagaagaat agcttagcag agctattttc attttcggga gacgagatca agcagatcaa 6300

cggtcgtcaa gagacctacg agactgagga atccgctctt ggctccacgc gactatatat 6360

ttgtctctaa ttgtactttg acatgctcct cttctttact ctgatagctt gactatgaaa 6420

attccgtcac cagccctggg ttcgcaaaga taattgcatg tttcttcctt gaactctcaa 6480

gcctacagga cacacattca tcgtaggtat aaacctcgaa atcattccta ctaagatggt 6540

atacaatagt aaccatgcat ggttgcctag tgaatgctcc gtaacaccca atacgccggc 6600

cgaaactttt ttacaactct cctatgagtc gtttacccag aatgcacagg tacacttgtt 6660

tagaggtaat ccttcttaag cttgggtggc ttgtttacat cgttgacagg cacctggcgc 6720

tctgctacaa ccgcccccta ttccttctgg atagcgagtg cagcgatctg taccacccga 6780

tggacgacat caagtggcaa gcgggcaaat tccggagcca cgatgcaggc aatattgata 6840

gttccatgac ggacgagttt ggtgatagcc cccgtgctgc tcgcggcgcg cactacgagt 6900

gtcgtggccg tagcatcttt ggctatttct tgtccctgat gaccatcctg ggcgagattg 6960

tcgacgttca tcatgccaag agccacccac gtttcggcgt cgggttccgc tctgcgcggg 7020

attgggacga gcaggttgct gagattaccc gacacctgga catgtatgag gagagcctga 7080

agaggttcgt ggcgaagcat ctgcccctgg ccacaaagga caaggagcag catgagatgc 7140

acgacagcgg agcggtagta gacatgcaat ctccactctc ggtgcggacc aacgcatcca 7200

gccgcatgac ggagagcgag atccaggcca gcatcgtggt ggcttacagc acccatgtga 7260

tgcatgtcct ccacatcctc cttgcggaca agtgggatcc catcaacctg cttgacgacg 7320

acgacttgtg gatctcgtcg gaaggattcg tgacggcaac gagccacgcg gtatcggctg 7380

ccgaagccat tagtcagatt ctcgagtttg acccaggcct ggagttcatg cccttcttct 7440

acggcgtcta tcttttgcag gggtccttcc tcctgctcct gatcgccgac aagctgcagg 7500

ctgaagcgtc tccaagcgtc atcaaggcgt gcgagaccat tgtacgagca cacgaagctt 7560

gcgtcgtgac gctgagcaca gagtatcagg taagccctat cacgccgaat atgttccctt 7620

ctgtgaatcg aagactaacg gagacattag cgcaacttta gcaaggtcat gcgaagcgca 7680

ctggctctga ttcggggtcg agtgccggaa gatctagctg agcagcagca acgacgacgc 7740

gagcttcttg cactataccg atggactggt aacggaaccg gtctggccct ctaaggaggt 7800

tcatcaaatg tatgatgaga agcgggagaa tacacaacac ggaagcgacc ggggagggtc 7860

ggctccgcta caatacttca acattgtggc aattatggat aatcttttct tttgtaggca 7920

agggtatgtt ttggttttta cgttttcacg gtgttgcagg ctatcttaat actttgggac 7980

gctatgaagg atggtcaggt gggctgaggc gccaggcaag gctggtagga tcatgagcga 8040

cttatggtta tgatgaaaaa gatatccctg tttttatttg tacggtaggc actggcttgg 8100

acgacatgtt tggtgtatcg atttaggact gggggttttg tctttggcac gatgatgggt 8160

ggctatcttg gttattgagg acacgaaatc aaattgctgt atgtctaggt aatatgaagc 8220

tttcatgaag acaacaaagc gactgcttgc gcagctggcc cgtggttgat gagcgtgacc 8280

agacagaacc gtaccctagc aatcgaaggt gacgagtgac ggtggctcgc cagctggtcg 8340

tcaactttgc cagccggttt gctcgctgca gtgggcagcc aaacacggtg ttgagggcgc 8400

ctgtagggtt cattaccgcg tccagtagtc actgtatcaa gtaaaaaaag acgttgatag 8460

ggaagagcat ttgccgagag taagaagact tgattcacag aagcagcaga agatggaata 8520

agaagatgat atccgcaagg tacctgaagc agaaaaaaag gggggaagaa agacaagtat 8580

gagagagcct gttctgacga gtgcccgaac aaaacagaac aatgcttgta tctcttcatt 8640

gccttggtcg tgttgtgttt tgcgtttggg aaagtagttg gttattagca gtgattcacc 8700

gtctccgttt tccgatttgc gcgttctcgc gtgggtggtg gagggggatg aggatggggg 8760

atgtcgttgt tattgtcttt tcgccgtcgt gagctgactc tttgaggaca ttttaaatga 8820

gatatgttgg tttataatgt atgtaggctg ctagaataca tgttttcttg atttgcaagc 8880

gaaagaaaaa ggaagaaaag tccaatataa cggagttcga tgaccaggag gttcggccac 8940

ctcgatagcc agagccaagt gaatgtggtg agcagctgtt cgattctcca cccactcaaa 9000

agaaaacaaa acaaacagag cacctagaaa taccccgctt ctttttctct tcctgagctt 9060

ttgttttcct cttcctcttc ctcttcctct tcacccgcgc acacaacaca cacacacaca 9120

cacaaactct tgatacacca tcacctcttc accaccagac ctcattctct c 9171

<210> 4

<211> 675

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggtctcct tcacctccct cctcgccggc gtcgccgcca tctccggcgt cctggccgct 60

cccgccgccg atgtcgccga gtccgtggcc gtcgagaagc gccagacgat ccagcccggc 120

acgggctaca acaacggcta cttctactcg tactggaacg acggccacgg cggtgtgacg 180

tacaccaacg gccccggcgg acagttctcc gtcaactggt ccaactcggg caactttgtc 240

ggcggcaagg gatggcagcc cggcaccaag aacaaggtca tcaacttctc gggctcctac 300

aaccccaacg gcaacagcta cctctccgtc tacggctggt cccgcaaccc gctgatcgag 360

tactacatcg tcgagaactt tggcacctac aacccgtcca ccggcgccac caagctgggc 420

gaggtcacct cggacggcag cgtctacgac atctaccgca cgcagcgcgt caaccagccg 480

tccatcatcg gcaccgccac cttttaccag tactggtccg tccgccgcaa ccaccgctcg 540

agcgggtccg tcaacacggc gaaccacttc aacgcgtggg cgcagcaggg cttgacgctc 600

gggactatgg attaccagat tgtggccgtc gagggttact ttagctctgg ctctgcttcc 660

atcaccgtca gctaa 675

<210> 5

<211> 13610

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat 420

cctctagaca tcaaccatgg aaggagcgca gtcgtcctta tcgcaaccat cacgtgctcc 480

agccagatga aacaacgact ttgtcccttc ttctcttctc gtaatactcc aaacttcgta 540

actcgtgaaa tcacacgcag cgtcgcattc gcctccaacg ccagcgccac tcgacaacgg 600

caacaacaac agcctcctcc cgttcggccg gttccgctgc ctcttttgct tcggccgact 660

gcaactggcg attcctcgca caggtctctt ttccaagact ccaacgaccg ccgtcagctg 720

catgccgaat agccggccag cagaccaggg gcccagcagc atccacgaga gcaaagcagc 780

gaattgtctc taatgacggc ctccatgacc cctgtccggc agctggagcg ggccttttgg 840

gctctgggcc ttttggacat gccgctctgg gcttgagctc gctgtaacga acttctgtca 900

cgcaccgcag ccacggcagc ccgtgatttg acggcttccg gtattgggat gagcagcaga 960

gatgagaggg ggatggcgat tcgggcacaa gttcccaccc ctgactgccg gacgccaagt 1020

cggttgtccc tgggccagcg acagtagtgc cacggcgcca gagccaatgg ccctcgaggc 1080

cgtccggacg agccccagga tcggaggcca cagcagattg gccctgttca tgccccgtca 1140

ccaggccgct ctgattgatg ggacggcgga tttaacatag gctaacggat tagacttaat 1200

tcggccgcct ggctgttgat ccataggcat tgggctagtt cattgttcag tcccctatgt 1260

gatgagcacg aggcagatct gagtcaagca aggcatggga tgggggctct tgtggcttgg 1320

cttcaccgtt gaagcgaaag agcctttggg ccacacgagg actgattcgt gcttgcggct 1380

ggtgactggc cgtttggggg cccgagcatg ccactgacag tgggatgcgg tggaacatga 1440

ttgcaacatc gctcccaaaa ggatggcctc ctttcttcgt ctgtccaggt cgacctcggt 1500

cggtcatatg aagcaaagga cgcgggcgca gtgtcattgc ccaagtcatg tcggcccgcc 1560

taccccagcc tgtcatatca tcgcacggac tgaactgtgg gctgctgttt aagcgtcgag 1620

caggaagacc cttgatagac aaagatcggc gatggatcct tctttcgagg cttgcttatt 1680

tcccttagcc tccgcggtgt tcagactgca cagccagcaa tgacttcgga ttggccggcc 1740

atcgtggcga ggaacgattg ttcaggaaga ccatcttgac ttgcgcgcct cgggggacag 1800

cactgttgcg ccgccccgag cgaatggccg tggccgtggg ctagcaggac tctggacttc 1860

tatcttggga tgcttcacga tacgtgatcg acaaaggttc cagcgtctcc attggagcaa 1920

ggcagaaatg gcagtacagc acgctctcgg ccgacctttc ttggtgggct agggaaccag 1980

gcacgccctc cacatggatg ccacccctgg acgcggatgc ttcattcgct cgcgggccgg 2040

ccacgacgac ctacagccat ctggcctgat tgcggagatc aattccacca tctcgactcc 2100

tcctgccatc accatgcccc ccagcaagtg tgtgaagctc ggggagaatg gcgcaaaccg 2160

accttcctaa accatgctct tgaggccgtc aacaacgaca atgcctcgga gacgcgagat 2220

tatcgacgag cgttgtcagt tgaactcaaa gggatataaa gacgtccggc ttccctccac 2280

ctggtgttgt tggagctctc ttctcatcag cctcatcagc cttcaagaca agtccagtcg 2340

cggccgcgcc atgaattcca tctttcgagg acggacgaag atactgtacg attaatgaaa 2400

ggagggagca ttcttcgact tgcggcaatt gcatgcacat gtacgattgg aagcgcgggc 2460

gatgtattcg caatcatgtt tagaaggacg gcgtttggaa acgttgggat gctgttgaag 2520

cgttggaaac aggggcaatt agaaacaccg agccagacag agtcaatggt acgaggtcag 2580

ccagtatcat gacctgtgtg cgcatggtgg cgagagattc cgagccatgc cacgggagac 2640

gagcaatgaa aaaactcttc actcacttgt cgaggctctc tcaacctatc gacttatcaa 2700

gtagacgatg aaagccttgc aactgtggtg atgtggctca tcaatgtgcg acgtcgtatc 2760

catgtctgag gccattcgat atcgtgatgc gactacctag taaagcccgg ccagagggca 2820

aaccggggcg acaggggcag gcaattgacc ggatggctgc atgtgccgaa gcagccccga 2880

tggaatcgag atgtctgtcg gatggaccgc tgagcggcct ggcaaggtgt cccagatacg 2940

aagatggaag tgaagtcaga ggtggtcgtt aattgtccga cgagcgaatc ggccgctcct 3000

tcggattgcc ggctctgctg tatgtaccgt gcatgaagcc acccgggatc catgttacga 3060

tggataggtt ccaactctct agtagctata gtggacctga ggctatctag tatcactgga 3120

ggagcagccg tccactatcg tcgagcgctg tagaagcagc tgcattagcg gctgcccacc 3180

cgcgcagaaa tggccccatt acatcactat catgacagcg gcgcgtccaa aagtgagctc 3240

atgcttgccg atggcacgag cagctgcaac tggcggggct cctgcctgcc gtctccggtg 3300

ccgctgccca tttgagtttg tccgagctgt tgatggttga aaccgagacc gatggatgat 3360

tcaacacttc gaagtctagg tagataaaaa acatctatat atcctcattc attgccctgt 3420

cagtgtgttg gctcacgtct ccaatcctcc gcccctcctc ctgcaaagta aataccttct 3480

caaaacacgt ctggaatcct gcaagtctcc atcacaagga gcttcttcat caaccacctt 3540

atacgagcaa catcatttgc atcatcgttg atccacatct cctcgcgcct cagagtgtcg 3600

tcaccagtat aaataaccgc atcaagctct cgtccttctt cgttccacaa tccaagaagc 3660

acctcaaaac gatcaaagca gcgcagctac agcacaatca tggtctcctt cacctccctc 3720

ctcgccggcg tcgccgccat ctccggcgtc ctggccgctc ccgccgccga tgtcgccgag 3780

tccgtggccg tcgagaagcg ccagacgatc cagcccggca cgggctacaa caacggctac 3840

ttctactcgt actggaacga cggccacggc ggtgtgacgt acaccaacgg ccccggcgga 3900

cagttctccg tcaactggtc caactcgggc aactttgtcg gcggcaaggg atggcagccc 3960

ggcaccaaga acaaggtcat caacttctcg ggctcctaca accccaacgg caacagctac 4020

ctctccgtct acggctggtc ccgcaacccg ctgatcgagt actacatcgt cgagaacttt 4080

ggcacctaca acccgtccac cggcgccacc aagctgggcg aggtcacctc ggacggcagc 4140

gtctacgaca tctaccgcac gcagcgcgtc aaccagccgt ccatcatcgg caccgccacc 4200

ttttaccagt actggtccgt ccgccgcaac caccgctcga gcgggtccgt caacacggcg 4260

aaccacttca acgcgtgggc gcagcagggc ttgacgctcg ggactatgga ttaccagatt 4320

gtggccgtcg agggttactt tagctctggc tctgcttcca tcaccgtcag ctaacccggc 4380

atgaagtctg accgggtagt atgagggttc atcgtcacct tgatagaata atagacgata 4440

aagcaggcca cgggcaggta ccgattgtca atccggcagg ttcggaggcg tgttggaaat 4500

gagtttatgg gttatggtca aatcggatag tatgaggtac atagtttgta aatctcaaga 4560

ttattttctt ccttaatctt gcacgtcgca tgagagggac cgagaagaga attgatgaag 4620

ggctcttgaa gatgagatga atcacgtggt tgctgaagct tcagtagtct cgggtacctg 4680

ttctttccca caaacagtag ccaggctaga ggtactgagt acccgctcac cgtatctaat 4740

catccgacct gaaatcttca agctgtttta ttgacacttc gagtccatct tcattcacgt 4800

aaggagaact tctaggacat cacttatccc gccatattta gctgcaagga gtcaattgca 4860

atgtcagatt ccgctcctaa gaggaaacag ggccctggcg gctcagatgg ctcggcattg 4920

aagaagagaa aggtatgatg acaagaatgc ttcttttaca tatttacgaa gaatgccacc 4980

acccttctct ctggctacct atgtccatgg acaacgagct tgctgacaat gggactatga 5040

atgggtacct aggagggcac gggaggaaga tggaagacgc cagctcaaaa ggcaaagcag 5100

gcctcgtggg tcgagatggg caaggctctc gaggtgggcg acgaaggcat ctgggtcacg 5160

tatgcgagaa ctagtgatct ttcgacactg aaatacgtcg agcctgctcc gcttggaagc 5220

ggcgaggagc ctcgtcctgt cacaactacc aacatggagt acgataaggg ccagttccgc 5280

cagctcatta agagccagtt catgggcgtt ggcatgatgg ccgtcatgca tctgtacttc 5340

aagtacacca accctcttct gatccagtcg atcatcccgc tgaagggcgc tttcgaatcg 5400

aatctggtta agatccacgt cttcgggaag ccagcgactg gtgacctcca gcgtcccttt 5460

aaggctgcca acagctttct cagccagggc cagcccaaga ccgacaaggc ctccctccag 5520

aacgccgaga agaactggag gggtggtgtc aaggaggagt aagctcctta ttgaagtcgg 5580

aggacggagc ggtgtcaaga ggatattctt cgctctgtat tatagataag atgatgagga 5640

attggaggta gcatagcttc atttggattt gctttccagg ctgagactct agcttggagc 5700

atagagggtc cctttggctt tcaatattct caagtatctc gagtttgaac ttattcccgt 5760

gaacctttta ttcaccaatg agcattggaa tgaacatgaa tctgaggact gcaatcgcca 5820

tgaggttttc gaaatacatc cggatgtcga aggcttgggg cacctgcgtt ggttgaattt 5880

agaacgtggc actattgatc atccgatagc tctgcaaagg gcgttgcaca atgcaagtca 5940

aacgttgcta gcagttccag gtggaatgtt atgatgagca ttgtattaaa tcaggagata 6000

tagcatgatc tctagttagc tcaccacaaa agtcagacgg cgtaaccaaa agtcacacaa 6060

cacaagctgt aaggatttcg gcacggctac ggaagacgga gaagcccacc ttcagtggac 6120

tcgagtacca tttaattcta tttgtgtttg atcgagacct aatacagccc ctacaacgac 6180

catcaaagtc gtatagctac cagtgaggaa gtggactcaa atcgacttca gcaacatctc 6240

ctggataaac tttaagccta aactatacag aataagatgg tggagagctt ataccgagct 6300

cccaaatctg tccagatcat ggttgaccgg tgcctggatc ttcctataga atcatcctta 6360

ttcgttgacc tagctgattc tggagtgacc cagagggtca tgacttgagc ctaaaatccg 6420

ccgcctccac catttgtaga aaaatgtgac gaactcgtga gctctgtaca gtgaccggtg 6480

actctttctg gcatgcggag agacggacgg acgcagagag aagggctgag taataagcgc 6540

cactgcgcca gacagctctg gcggctctga ggtgcagtgg atgattatta atccgggacc 6600

ggccgcccct ccgccccgaa gtggaaaggc tggtgtgccc ctcgttgacc aagaatctat 6660

tgcatcatcg gagaatatgg agcttcatcg aatcaccggc agtaagcgaa ggagaatgtg 6720

aagccagggg tgtatagccg tcggcgaaat agcatgccat taacctaggt acagaagtcc 6780

aattgcttcc gatctggtaa aagattcacg agatagtacc ttctccgaag taggtagagc 6840

gagtacccgg cgcgtaagct ccctaattgg cccatccggc atctgtaggg cgtccaaata 6900

tcgtgcctct cctgctttgc ccggtgtatg aaaccggaaa ggccgctcag gagctggcca 6960

gcggcgcaga ccgggaacac aagctggcag tcgacccatc cggtgctctg cactcgacct 7020

gctgaggtcc ctcagtccct ggtaggcagc tttgccccgt ctgtccgccc ggtgtgtcgg 7080

cggggttgac aaggtcgttg cgtcagtcca acatttgttg ccatattttc ctgctctccc 7140

caccagctgc tcttttcttt tctctttctt ttcccatctt cagtatattc atcttcccat 7200

ccaagaacct ttatttcccc taagtaagta ctttgctaca tccatactcc atccttccca 7260

tcccttattc ctttgaacct ttcagttcga gctttcccac ttcatcgcag cttgactaac 7320

agctaccccg cttgagcaga catcaccatg attgaacaag atggattgca cgcaggttct 7380

ccggccgctt gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc 7440

tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc 7500

gacctgtccg gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc 7560

acgacgggcg ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg 7620

ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag 7680

aaagtatcca tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc 7740

ccattcgacc accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt 7800

cttgtcgatc aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc 7860

gccaggctca aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc 7920

tgcttgccga atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg 7980

ctgggtgtgg cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag 8040

cttggcggcg aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg 8100

cagcgcatcg ccttctatcg ccttcttgac gagttcttct gaagtagatg ccgaccggga 8160

tccacttaac gttactgaaa tcatcaaaca gcttgacgaa tctggatata agatcgttgg 8220

tgtcgatgtc agctccggag ttgagacaaa tggtgttcag gatctcgata agatacgttc 8280

atttgtccaa gcagcaaaga gtgccttcta gtgatttaat agctccatgt caacaagaat 8340

aaaacgcgtt tcgggtttac ctcttccaga tacagctcat ctgcaatgca ttaatgcatt 8400

ggacctcgca accctagtac gcccttcagg ctccggcgaa gcagaagaat agcttagcag 8460

agtctatttt cattttcggg agacgagatc aagcagatca acggtcgtca agagacctac 8520

gagactgagg aatccgctct tggctccacg cgactatata tttgtctcta attgtacttt 8580

gacatgctcc tcttctttac tctgatagct tgactatgaa aattccgtca ccagcccctg 8640

ggttcgcaaa gataattgca ctgtttcttc cttgaactct caagcctaca ggacacacat 8700

tcatcgtagg tataaacctc gaaaatcatt cctactaaga tgggtataca atagtaacca 8760

tgcatggttg cctagtgaat gctccgtaac acccaatacg ccggccgaaa cttttttaca 8820

actctcctat gagtcgttta cccagaatgc acaggtacac ttgtttagag gtaatccttc 8880

ttatttaaat aggcacggac agagtaagtg cacctcaatc tccttattgt acgcagtaga 8940

ctgacagaac caaaaacaga cggcagctac aactttggct acattgacac cagcgtcgcc 9000

aagggccccg ttgcctacac gcccgttgac aacagccagg gcttctggga gtttactgcc 9060

acgggctacg ctgtcggcag cggcaagctg aaccgcaact ccatcgacgg tattgccgac 9120

accggcacca ccctgctcct cctcgacgac gacgttgtca acgcctacta cgccaacgtc 9180

cgctcggccg agtacgacaa ccagcaggag ggtgtcgtct tcgactgcga cgaggacctg 9240

ccttcgttca gcttcggcgt gggaggctcc accatcacca tccccggcaa cctgctgaac 9300

ctgactcccc tcgaggaggg cagctccacc tgcttcggtg gtctccagag cagctctggc 9360

attggcatca acatctttgg tgatgttgcc ctcaaggctg ccctggttgt ctttgacctt 9420

ggcaacgagc gtctgggctg ggctcagaaa taagcggtgg cgtggactta atgaaaaggt 9480

tatgggatca atgatgattg gaaaaaaagg ctctcaagac ttgtaaatac ccttggtgta 9540

tatagccaga agtcggcaca tagtggagca atgacgaagt tattgaaagg aagctttggg 9600

tttcatagac tgtgagatgt gtgattggtt accgtatccg attgtctttc gtattcatca 9660

caactcagct ggcaatctac ctacgatgct tggattgagc ttttacatca tacactggtc 9720

catcatagcc gtgaatagtg gtttgagagg ctgatatatg atgtactcga gaatagtcaa 9780

ggttgattac ggctcgtaac tctccattcc cagtttgccc cccagtgtgt ggacggaggc 9840

tgctcatcca ctatcctttg cggacgggcc gataatttgt tctaatcttg aagtgtattc 9900

ctgttgatgc tcaagtattg agtgcgttgg ttaagaccaa gatggggagg tggtggccgt 9960

gaaggatgcg aaactttgga ggtgatgact ttctcgagcg agtcggaggc gggctacata 10020

tcaaggagag taactaacgc tgttgtatac acactttgtc cgtcctttta catgaagcca 10080

cgcatactag ataggcaagt gaatgttatt ccacttcgac taacagttga caaacagctc 10140

ctcctcatca tctccctgcc tgacatgctt ctccttgaaa ccccccttca gctaacaata 10200

ctcttttcta tcgccatccg ctggcctgcg cattaggcag cggggatgtc agcgagcccg 10260

ataatccccg ttctgaacga gctgaggaat ccggctctgg gtattctgtt gatgcaatgg 10320

cggaagatgc agtgaacatg acatttgctc ccctgttttc ctcctgaaat ccccaactgt 10380

catgaggacg gtgtatgata aggtgcagct agtatgtgtg aactttcttt ccgaagggag 10440

atttctcggg catggtgtta gtgatagacg tggggagcct cgggagggtg catacctttg 10500

ctgaaggcga gtgcatgttc ttcacctcca aacgtggaag atgaagtccg ttgagcggac 10560

acacctcgaa actccgaaag gtcaaatgcg tcaagcagta ataggttatt cctcgctttg 10620

atgtgagttg atattgagtt gttgcgtagg tgattatgtg agttctcctt tcctatcgag 10680

ttgcggtttg gctgatatgt tagaggaggg ggagttgaga attgatgagg ctatacagga 10740

tatcggtaga gcattttgag gaccttgcta cggagcttgc tgttgctgcg atggattaat 10800

ggatgtatgg agccgagggg tgatatttgt atgacgagtg tcgaaaccgc cccctgaact 10860

ttacggcgcc attatacaga gcgtttgctg aagaagtact tgtatcaatg ccgtctaact 10920

accgccacct cttcgaaaca accactcgtc tcacaaatac acatctgtgg cactcttcat 10980

gaacaaagga cagcgaagaa aaagccggtc agcagccaaa ccggccccct gaccgaaaag 11040

ctacccactc ccacccagcc acaccgaggt cgcttccaac ctataaccgg cggttacaaa 11100

gccgatttca ctacctctct ttcagcatgt aatacattta tcagtcaatc aggcagtcac 11160

accgcgtcag ttggaatcat gacaatgttt ccttggcggg ttacatccga tgagaatctt 11220

tgtatatcaa acgtccggaa taggcaggag aaatacgagg actctcgaga tctgttaatc 11280

cggtgaaggg ggatgtcatg aatggacttg ttcgtgttat caaccggact ttctgagcgt 11340

agttggatgc ccgtctacct gcaggcatgc aagcttggcg taatcatggt catagctgtt 11400

tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 11460

gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 11520

gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 11580

ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 11640

ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 11700

cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 11760

gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 11820

tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 11880

ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 11940

atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 12000

gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 12060

tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 12120

cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 12180

cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt 12240

tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 12300

cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 12360

cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 12420

gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 12480

gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 12540

gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 12600

ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 12660

atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 12720

agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 12780

ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 12840

tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 12900

ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 12960

caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 13020

gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 13080

atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 13140

accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 13200

aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 13260

gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 13320

tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 13380

aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 13440

ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 13500

aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat 13560

tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 13610

Claims (10)

1. A carrier skeleton is characterized in that the gene sequence is shown as SEQ ID NO. 1.

2. The carrier skeleton of claim 1, wherein: obtained by inserting an expression cassette containing a resistance selection marker gene between the UAsp and the DAsp of a vector pUC-eASP comprising the 5 'flanking sequence and the 3' flanking sequence of an aspartic acid proteolytic enzyme.

3. The carrier skeleton of claim 2, wherein: the sequence of the vector pUC-eASP is shown in SEQ ID NO. 2.

4. The carrier skeleton of claim 3, wherein: the resistance selection marker gene is G418.

5. A positioning expression system based on a vector framework and a low background engineering strain of hypocrea orientalis, which is characterized by comprising the vector framework as claimed in any one of claims 1 to 4, hypocrea orientalis delta xyr1-3, a promoter and a terminator;

the hypocrea orientalis delta xyr1-3 is obtained by knocking xyr1 gene out by using hypocrea orientalis EU7-22 as an initial strain;

the culture number of the hypocrea orientalis EU7-22(Trichoderma orientalis EU7-22) is CCTCC NO: m20211189.

6. The system of claim 5, wherein the vector backbone and hypocrea orientalis low background engineering strain-based localized expression system is characterized in that: the hypocrea orientalis delta xyr1-3 is obtained by converting protoplasts of hypocrea orientalis EU7-22 through a xyr1 knockout box, and the gene sequence of the xyr1 knockout box is shown in SEQ ID NO. 3.

7. The system of claim 5, wherein the vector backbone and hypocrea orientalis low background engineering strain-based localized expression system is characterized in that: the promoter and the terminator are respectively a promoter Ppdc and a terminator Tpdc of a pyruvate decarboxylase gene pdc in Trichoderma reesei QM 9414.

8. An application of the vector framework and hypocrea orientalis low background engineering strain-based positioning expression system in construction of engineering bacteria according to any one of claims 5 to 7.

9. A method for constructing engineering bacteria by adopting the carrier skeleton and the positioning expression system of the low background engineering strain of the hypocrea orientalis as claimed in any one of claims 5 to 7, which is characterized by comprising the following steps:

carrying out enzyme digestion, connection and transformation on the vector skeleton and the expression cassette containing the target gene, and then carrying out positive cloning to obtain a vector containing a target gene positioning expression cassette;

and then cloning an expression cassette containing a target gene by using a vector containing the target gene positioning expression cassette as a template, converting the expression cassette into the hypocrea orientalis delta xyr1-3 to obtain a positive transformant, and verifying a positive clone.

10. The method for constructing engineered bacteria of claim 9, wherein:

the expression cassette containing the target gene is transformed into hypocrea orientalis delta xyr1-3 through PEG mediation.

Images