CN114452390A

CN114452390A - Application of FXYD 3protein or coding gene thereof as target in preparation of medicine for preventing and treating psoriasis

Info

Publication number: CN114452390A
Application number: CN202210077545.7A
Authority: CN
Inventors: 王青青; 来利华; 夏梦; 杨文娟; 连雯雯; 薛越; 潘婷
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2022-01-24
Filing date: 2022-01-24
Publication date: 2022-05-10

Abstract

The invention discloses an application of FXYD 3protein or a coding gene thereof as a target point in preparation of a medicament for preventing and treating psoriasis, and relates to the technical field of biological medicines. The invention discovers that FXYD 3protein promotes psoriasis development, and induces a mouse psoriasis model through IMQ (inertial measurement of quality), and the wild type (FXYD 3)^flox/flox) Epidermal keratinocytes lack FXYD3 (K14) in comparison to mice^cre FXYD3^flox/flox) The mouse can obviously reduce the thickness of skin, scales and epidermis, and the deletion of FXYD3 in keratinocytes can obviously reduce IL-17 signals and the expression of downstream chemokines CXCL1, CCL20 and antibacterial peptides S100A8 and S100A9, reduce the infiltration of immune cells, and further weaken the progress of psoriasisThe process. Therefore, the discovery of the invention indicates that the FXYD 3protein or the coding gene thereof can be used as a new action target for preventing and treating psoriasis.

Description

Application of FXYD 3protein or coding gene thereof as target in preparation of medicine for preventing and treating psoriasis

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of FXYD 3protein or a coding gene thereof serving as a target point in preparation of a medicine for preventing and treating psoriasis.

Background

Psoriasis, commonly known as psoriasis, is a chronic skin disease characterized by massive inflammatory immune cell infiltration, abnormal thickening of the epidermis and incomplete keratinocyte differentiation, and is clinically manifested as red and silvery-white thick-layer scales. According to statistics, the global incidence rate of psoriasis is about 1% -3%, the psoriasis has repeated attack and is difficult to cure radically, the physical and mental health of patients is seriously affected, and economic losses are caused to individuals and society. Numerous clinical studies have shown that psoriasis, while not fatal in itself, has its complications including psoriatic arthritis, cardiovascular disease, diabetes, etc., all of which can be life threatening to the patient.

It is currently generally accepted that the pathogenesis of psoriasis is mainly caused by abnormal interaction of epidermal keratinocytes with immune cells. The local skin dendritic cells can recognize self-antigens to generate various cytokines, such as IL-23, IL-1 beta, IL-6, TNF and the like, and the cytokines further induce T cells to generate inflammatory factors such as IL-17A, IL-17F, IL-22 and the like. IL-17A, IL-17F and IL-22 act on keratinocytes, on one hand, the keratinocytes cause psoriasis pathological changes such as abnormal thickening of epidermis and hyperkeratosis, on the other hand, the keratinocytes produce more inflammatory factors and chemokines, and form IL-23/Th17 positive feedback circulation, so that psoriasis chronic inflammatory lesions are amplified and aggravated.

At present, the treatment means of psoriasis mainly comprises drugs such as glucocorticoid, methotrexate and the like or some biological agents, such as anti-TNF drugs (etanercept, adalimumab and the like), anti-IL-17 antibodies (securituzumab and eculizumab) and the like. However, the above drug treatment methods have different side effects and relatively single action target links, so that the treatment effect and application prospect are not completely satisfactory. Therefore, the intensive research on the pathogenesis of psoriasis is imperative to continuously research and develop high-activity therapeutic drugs with good curative effect and small side effect.

The FXYD (FXYD domain-containing transport regulator) family molecules are specific auxiliary subunits of Na and K-ATP enzyme, the families of the FXYD and K-ATP enzyme are encoded by 6 to 9 genes of small exons, the protein size is about 60 to 160 amino acids, the common structure is a core structure consisting of a single transmembrane segment and 35 amino acid residues around the single transmembrane segment, and the core structure is mainly responsible for maintaining the balance of Na ion and K ion concentrations on a cell membrane. FXYD3, also known as Mat-8, is a member of the FXYD family and was first identified as a specific regulatory protein for the β subunit of Na, K-atpase. FXYD3 is mainly expressed in epithelial tissues such as gastrointestinal tract, skin, pancreas, etc., and studies have shown that FXYD3 has a regulatory role in the development and progression of tumors (Zhu z.l., Zhao z.r., Zhang y., Yang y.h., Wang z.m., Cui d.s., Wang m.w., kleef j., Kayed h., Yan B.Y. & Sun x.f.expression and signaliciness of FXYD-3 proteiningasemarkers, 28:63-69 (2010)), but the role and specific mechanism of FXYD3 in skin homeostasis and psoriasis are not clear.

Disclosure of Invention

The invention aims to provide application of FXYD3 as a target point in preparation of a medicine for preventing and treating psoriasis, so as to solve the problems in the prior art and realize effective prevention and treatment of psoriasis by taking FXYD3 as a medicine target point.

The FXYD3 gene sequence is shown as SEQ ID No.21, and the GeneBank number of the amino acid sequence of the FXYD 3protein is as follows: NP _ 032583.1.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides application of FXYD 3protein or a coding gene thereof as a target point in preparation of a medicament for preventing and treating psoriasis.

Preferably, the drug is an antibody against FXYD3 protein.

Preferably, the medicament is a pharmaceutical preparation of an inhibitor against FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof.

Preferably, the drug is DNA or RNA that blocks expression or transcription of FXYD3 protein.

Preferably, the drug is a drug that blocks or inhibits NF-kB and MAPK signaling activation by FXYD3 protein.

The invention also provides application of the antibody aiming at the FXYD 3protein in preparing a medicament for preventing and treating psoriasis.

The invention also provides application of a pharmaceutical preparation of an inhibitor against FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof in preparing a medicament for preventing and treating psoriasis.

The invention also provides application of the vector for knocking FXYD3 gene out by siRNA in preparation of a medicament for preventing and treating psoriasis.

The invention also provides a medicament for preventing and treating psoriasis, which is one of the following medicaments:

(1) antibodies against FXYD3 protein;

(2) a pharmaceutical formulation of an inhibitor against FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof;

(3) DNA or RNA that blocks the expression or transcription of FXYD3 protein.

The medicine is siRNA for knocking out FXYD3 gene or a carrier for expressing the siRNA, and the sequence of the siRNA is 5'-GCCAAUGACCUAGAAGAUAAA-3' or 5'-UUUAUCUUCUAGGUCAUUGGC-3'.

The invention adopts the technologies of immunohistochemistry, immunofluorescence, real-time quantitative PCR, clinical database statistical analysis and the like to analyze the expression condition of FXYD 3protein in psoriasis skin lesions of psoriasis patients and mouse psoriasis skin lesions induced by Imiquimod (IMQ), and the result shows that the FXYD 3protein promotes the development of psoriasis. Induction of the psoriasis model in mice by IMQ, in contrast to wild type (FXYD 3)^flox/flox) Epidermal keratinocytes deficient in FXYD3 (K14) in comparison with mice^cre FXYD3^flox/flox) The mouse can obviously reduce the skin thickness, the scale and the epidermis thickness, and the deletion of FXYD3 in keratinocytes can obviously reduce IL-17 signals and the expression of downstream chemokines CXCL1, CCL20 and antibacterial peptides S100A8 and S100A9, reduce the infiltration of immune cells and further weaken the psoriasis process. Thus, the findings of the present invention are predictive of FXYD 3proteinOr the coding gene can be used as a new action target for preventing and treating psoriasis.

Drawings

FIG. 1 shows that FXYD3 is found to be expressed mainly in epidermal keratinocytes; a: immunofluorescence detects the profile of FXDY3 in the skin of patients with psoriasis; scale bar: 50 μm; b: analyzing databases GSE13355 and GSE14905 to detect the expression level of FXYD3 in healthy controls, lesion tissues of patients with psoriasis and tissues beside psoriasis; c: analyzing databases GSE11903 and GSE53552 to detect the expression level of FXYD3 after the psoriasis patient receives anti-TNF medicine and anti-IL-17R medicine; data represent one independent experiment; ns means no statistical significance, p <0.01, p <0.001, p < 0.0001.

FIG. 2 is a graph of FXYD3 expression in psoriatic lesions in psoriasis patients and Imiquimod (IMQ) -induced psoriatic lesions in mice; a: immunofluorescence detecting the expression of FXYD3 of skin lesions and healthy skin of patients with psoriasis; scale bar: 50 μm; b: immunohistochemical detection of expression of FXYD3 in skin lesions and healthy skin of psoriatic patients; scale bar: 100 μm; c: quantifying the expression level of FXYD3 in the epidermis of healthy controls (n-16) and psoriatic patients (n-26); d: immunohistochemical detection of Imiquimod (IMQ) -induced psoriasis lesions and normal skin FXYD3 expression in mice; scale bar: 50 μm; e: detecting the expression level of FXYD3 in the psoriasis induction process of the mice by virtue of fluorescent quantitative PCR (polymerase chain reaction); data represent two independent experiments, 4 mice per group, expressed as mean ± standard error of mean; p < 0.001.

FIG. 3 shows the Imiquimod (IMQ) -induced K14^cre FXYD3^flox/flox(cKO) mice and FXYD3^flox/flox(WT) mouse psoriasis model and phenotyping; a: IMQ was smeared over a representative picture of the skin on the back of a three-day mouse; b: representative pictures of the skin on the back of a six-day mouse were smeared with IMQ; c: scoring curves for back skin thickness, erythema and scaling; d: performing statistical analysis on the thickness of the skin of the mouse ear; e: dorsal skin section H&E, dyeing; scale bar: 200 mu m; f: ear skin section H&E, dyeing; scale bar: 200 mu m; data represent two independent experiments, 6 mice per group, expressed as mean ± standard error of mean;ns means no statistical significance,. p<0.01。

FIG. 4 shows the Imiquimod (IMQ) -induced K14^cre FXYD3^flox/flox(cKO) mice and FXYD3^flox/flox(WT) mouse psoriasis model and performing specific skin immune cell subpopulation profile analysis; a: a graph of changes in skin immune cell subpopulations; b: total number of each immune cell in mouse ear skin (left) and proportion of each immune cell in mouse ear skin to CD45 positive cell (right); data represent two independent experiments, 5 mice per group, expressed as mean ± standard error of mean; ns means no statistical significance, p<0.05，**p<0.01。

FIG. 5 is a graph showing the results of an assay in which IL-17A is used to stimulate epidermal keratinocytes to mimic the environment of psoriasis cells; a: western blot detection of protein levels of primary keratinocytes NF-kappa B p65, p-NF-kappa B p65, ERK, p-ERK, JNK and p-JNK of WT and cKO mouse epidermis; b: western blot after knocking FXYD3 out by using si-negative and si-FXYD3 is used for detecting the protein levels of NF-kappa B p65, p-NF-kappa B p65, ERK, p-ERK, JNK and p-JNK of the human-origin keratinocyte; c: real-time fluorescent quantitative PCR detection of expression of chemotactic factor and antibacterial peptide; data represent two independent experiments, expressed as mean ± standard error of the mean; ns indicates no statistical significance, p <0.05, p <0.01, p < 0.001.

Detailed Description

Example 1

(1) Immunofluorescence detection of expression of FXYD 3protein (GeneBank number: NP-032583.1) in skin

Selected from dermatology outpatients of a second subsidiary hospital of Zhejiang university and psoriasis patients with typical clinical manifestations (29 cases) (ethical Committee of human research of the second hospital affiliated to the medical institute of Zhejiang university, project acceptance No. 2021 + 0268 and incident acceptance No. IR2021001150), wherein 2 cases of skin lesion sites are taken by a conventional method and placed in physiological saline, and a pathological section is prepared by treating a sample on the same day; paraffin sections were deparaffinized and antigen retrieval was performed with 0.01M (pH 6.0) sodium citrate; with 3% H₂O₂Blocking endogenous peroxidase, and blocking nonspecific protein with blocking solution; a primary antibody(FXYD3 antibody, abcam, ab205534) was incubated overnight at 4 ℃ and a fluorescent secondary antibody was incubated at 37 ℃ for 30min, stained with DAPI for nuclei, oven-dried, and mounted.

(2) FXYD 3protein expression analysis of psoriasis patients in database

Detecting the expression level of FXYD3 in healthy controls, diseased tissues of patients with psoriasis and tissues beside psoriasis selected from GEO databases GSE13355 and GSE 14905; selected from the GEO databases GSE11903 and GSE53552 to measure the expression level of FXYD3 in psoriasis patients after treatment with anti-TNF drugs and anti-IL-17R drugs.

As shown in fig. 1, FXYD3 is expressed mainly in epidermal keratinocytes in skin. Clinical database results showed that FXYD3 levels were significantly higher in psoriatic skin tissues than in parapsoriatic and normal skin sites. After the psoriasis patient is treated by the biological preparation, the expression level of FXYD3 is obviously reduced.

Example 2

(1) Preparation of skin lesion samples for psoriasis patients

Selected from the patients in the dermatology clinic of the second subsidiary hospital of Zhejiang university and the patients with psoriasis with typical clinical manifestations (29 cases) (ethical Committee for human research in the second hospital subsidiary of Zhejiang university medical college, project Accept No.: study No. 2021 + 0268 and incident Accept No. IR2021001150), wherein 29 cases of skin lesion sites and 16 cases of skin lesion border normal skin samples were taken by the conventional method and placed in physiological saline, the samples were processed on the same day, pathological sections were prepared, and the immunofluorescent staining procedure was the same as that of the step (1) in example 1.

(2) Immunohistochemical staining of human and mouse skin tissues

Human and mouse skin tissues were harvested, fixed in 10% formalin, paraffin embedded for one week, and sectioned. Paraffin sections were placed in a 67 ℃ oven, baked for 2 hours, dewaxed to water, and rinsed three times with PBS pH 7.4 for 3 minutes (3X 3') each. Adding a certain amount of citrate buffer solution with the pH value of 6.0 into a microwave box, heating the citrate buffer solution to boiling by microwave, placing the dewaxed and hydrated tissue slices on a high-temperature-resistant plastic slice frame, placing the tissue slices into the boiling buffer solution, carrying out medium-grade microwave treatment for 10 minutes, taking out the microwave box flow water, naturally cooling, taking out the slide from the buffer solution, firstly washing the slide twice by distilled water, and then using PB (phosphate buffer) to wash the slide twice, and finally using PB (phosphate buffer) to cool the slide naturallyS flush 2 × 3'. Adding 1 drop of 3% H into each slice₂O₂Incubated at room temperature for 10 minutes to block the activity of endogenous peroxidase. PBS washed 3 × 3'. The PBS was removed, and 1 drop of anti-human FXYD3 antibody (abcom, ab205534) (corresponding dilution factor) was added to each section, followed by incubation at room temperature for 2 hours. PBS washed 3 × 5'. The PBS was removed and 1 drop of polymer enhancer was added to each section and incubated at room temperature for 20 minutes. PBS washed 3 × 3'. PBS was removed and 1 drop of enzyme-labeled anti-rabbit polymer was added to each section and incubated at room temperature for 30 minutes. PBS washed 3 × 5'. PBS was removed and 1 drop of freshly prepared DAB solution (diaminobenzidine) was added to each section and observed under the microscope for 5 minutes. Hematoxylin counterstaining, 0.1% HCl differentiation, tap water washing, bluing, gradient alcohol dehydration and drying of slices, xylene transparency, neutral gum sealing, air drying and microscopic observation.

(3) C57BL/6J wild-type female mice (8 weeks old) were obtained from the center of Experimental animals at university of Zhejiang. Animals were kept in a light-dark cycle rearing room at constant temperature and humidity for 12 hours. The feed and water can be taken freely. Procedures for all animals were performed following procedures approved by the animal welfare ethics committee. An international universal psoriasis mouse model was used: 6-8 week old C57BL/6 mice were treated with 5% IMQ applied to shaved back skin of the mice at 62.5mg per day for 9 consecutive days. C57BL/6 mice 6-8 weeks old were used as controls.

(4) Obtaining mouse skin tissue coated with IMQ for a certain number of days, adding Trizol homogenate for cracking, extracting mouse tissue RNA, and detecting FXYD3mRNA level change.

The Trizol method is used for extracting total RNA according to a reagent instruction and carrying out reverse transcription to obtain cDNA according to the steps of a TOYOBO reverse transcription kit instruction.

Reverse transcription system:

diluting cDNA by 10 times with RNase-free water, and then carrying out real-time fluorescence quantitative PCR, wherein an amplification system is as follows:

the amplification procedure was: 95 ℃ for 10 s; at 95 deg.C, 15s, 60 deg.C, 40s for 40 cycles; 95 deg.C, 15s, 60 deg.C, 1min, 95 deg.C, 15 s.

All amplification primers used are shown in table 1:

the sequence of the mouse primer is as follows:

TABLE 1

Gene	Upstream primer (5 '-3')	Downstream primer (5 '-3')
			Actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
FXYD3	TACAGCATGTCCTACTCGCAG	GAGGAAGAGGTAACCACAGGG
			CXCL1	AGAACATCCAGAGCTTGAAGG	CAATTTTCTGAACCAAGGGAGC
CXCL2	CCCAGACAGAAGTCATAGCCAC	TGGTTCTTCCGTTGAGGGAC
			CCL20	ACTGTTGCCTCTCGTACATACA	GAGGAGGTTCACAGCCCTTTT
S100A8	ACTTCGAGGAGTTCCTTGCG	TACTCCTTGTGGCTGTCTTTGT
			S100A9	CCTGGACACAAACCAGGACA	GTGGGTTGTTCTCATGCAGC

As shown in figure 2, the expression level of FXYD3 at the skin lesion part of the psoriasis patient is obviously higher than that at the normal skin part, and the expression level of FXYD3 is increased along with the aggravation of the psoriasis course in an IMQ-induced mouse psoriasis model.

Example 3

Constructing a transgenic mouse with a keratinocyte specificity knockout FXYD3 gene (shown as SEQ ID No. 21) through a Cre/loxp recombination system: namely FXYD3^flox/floxMouse and K14^creThe transgenic mice are bred in a hybridization way, and K14 is identified^cre FXYD3^flox/floxMice as cKO experimental mice, littermate FXYD3^flox/floxMice were used as WT experimental mice. Wherein, FXYD3^flox/floxMouse and K14^creThe mice are all C57BL/6 background, purchased from Nanjing university-Nanjing model animal center, and bred in Zhejiang university experimental animal center.

(1) After IMQ was smeared on the skin of the back of the mice, back imaging was performed on 3 and 5 days. Psoriasis severity was assessed by mouse skin thickness, erythema and scaling. The thickness of the mouse ear was measured with a vernier caliper. Scales and erythema scale from 0 to 4: 0, none; 1, light; 2, moderate; 3, remarkable; 4, very significant.

(2) Skin sections were prepared, stained with H & E, and stained using conventional general H & E staining methods.

(3) Statistical analysis of epidermis thickness, taking pictures of H & E stained sections in double-blind mode, and measuring epidermis thickness by using Image J software

As shown in figure 3, the psoriasis-like phenotype was reduced in cKO mice compared to WT mice, including erythema, scaling, and epidermal thickness.

Example 4

IMQ was smeared on mouse ears for three days, the mouse ears were harvested, washed twice with PBS, soaked in 75% alcohol for 30s, washed clean with PBS, minced, and digested in 0.1mg/mL Liberase TM (Roche, Cat.: 5401127001), 0.1mg/mL DNaseI (Sigma, Cat.: D5319) and 20mM HEPES in RPMI 1640 medium for 90 minutes. The digested tissue was filtered through a 70 μm nylon mesh to remove tissue debris and additional RPMI 1640 was added to the suspension to stop the enzymatic digestion. The following antibodies APC-CD45, PE-CF594-CD3, FITC- β TCR, PE- γ δ TCR, BV605-CD11b, BV650-LY6G, PE-Cy7-CD11c, AF700-MHCII, BV421-F4/80 and APC-Cy7-LY6C were then used, and Zombie Aqua was used^TMThe Fixable visual Kit was stained for 15 minutes in the dark and subjected to immunocytological analysis using BD Fortessa.

As shown in fig. 4, the total number of CD45 positive cells in the skin of IMQ-induced WT mice was significantly increased compared to cKO mice. The total number of cells positive for WT neutrophils, monocytes, macrophages, and CD3 was higher than that of cKO mice. In proportion, the proportion of the neutrophils and the monocytes/macrophages in the CD45 positive cells of the WT mice is obviously higher than that of the cKO mice. Namely, FXYD3 promotes the infiltration of immune cells at the psoriasis skin lesion to aggravate the disease process.

Example 5

(1) Newborn mice (within 24 hours) were soaked in 70% ethanol for sterilization, and the skin of the mice was separated with an ophthalmic scissors and an ophthalmic forceps, and then placed in Dispase II (2mg/mL) formulated in HBSS, and the skin was allowed to float at 4 ℃ and digested overnight in the dark. The next day, the epidermis was gently peeled off with a sharp-pointed forceps, washed in precooled HBSS to remove Dispase II remaining on the epidermis, digested in TryplE in a 37 ℃ water bath for 10min, sieved through a 70 μm cell sieve, and centrifuged at 400 Xg and 4 ℃ for 5min to obtain primary epidermal keratinocytes. 154CF medium was used to resuspend cells, which were plated on type I collagen-coated cell culture plates for culture. And (5) changing the solution every other day, and removing dead cells to obtain adherent primary epidermal cells. After successful cell culture, IL-17A (100ng/mL) stimulation was given, and then cells were collected and proteins were extracted, and changes in signal pathways were detected by Western blot.

(2) NHEK cells with good growth state are selected according to the ratio of 2X 10⁴The density per well was seeded in 24-well plates. After the cells were cultured stably for 12 hours, siRNA-FXYD3 (gemma gene) and control NC-were added to the cells as described in lipo3000, transfected for 24 hours, then stimulated with IL-17A (final concentration of 100ng/mL), and then the cells were harvested and the proteins were extracted, and changes in the signal pathway were detected using Western blot.

The siRNA sequences against human-FXYD3 are shown in Table 2.

TABLE 2

(3) Collecting the primary epidermal keratinocytes in the step (1), respectively stimulating the cells with WT and epidermal cells IL-17A with FXYD3 knocked out for three hours, adding Trizol reagent into the cells, extracting RNA, performing reverse transcription to obtain cDNA, and respectively detecting the relative expression amounts of CXCL1, CXCL2, CCL20, S100A8 and S100A9 genes by using real-time fluorescence quantitative PCR.

As shown in FIG. 5, NF-kB and MAPK signaling pathways were significantly stronger in WT primary epidermal cells compared to cKO primary epidermal cells following IL-17A stimulation than in cKO cells. And in primary epidermal cells, effector molecules CXCL1, CXCL2, CCL20, S100a8 and S100a9 downstream of IL-17 signaling in WT cells produced significantly more than cKO cells.

The experimental detection shows that the FXYD3 promotes the development of psoriasis, the inhibition of the expression of FXYD3 in epidermal keratinocytes can obviously treat an imiquimod mouse psoriasis model, can improve the scale and skin lesion thickness, and reduce immune cell infiltration by inhibiting IL-17 signals and the generation of downstream chemokines so as to inhibit the development of psoriasis.

The FXYD3 can be used as a target for preparing a medicament for preventing and treating psoriasis. And FXYD3 can be used as a drug target at the gene level and/or the protein level. For example by blocking expression or transcription of FXYD3, or by blocking or inhibiting the action of FXYD 3. Meanwhile, the corresponding inhibitor preparation aiming at FXYD3 and the carrier of knocking FXYD3 out by siRNA can be applied to the preparation of the medicine for preventing and treating psoriasis.

Sequence listing

<110> Zhejiang university

Application of <120> FXYD 3protein or coding gene thereof as target in preparation of medicine for preventing and treating psoriasis

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggctgtattc ccctccatcg 20

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccagttggta acaatgccat gt 22

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tacagcatgt cctactcgca g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaggaagagg taaccacagg g 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agaacatcca gagcttgaag g 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caattttctg aaccaaggga gc 22

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cccagacaga agtcatagcc ac 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tggttcttcc gttgagggac 20

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

actgttgcct ctcgtacata ca 22

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaggaggttc acagcccttt t 21

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acttcgagga gttccttgcg 20

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tactccttgt ggctgtcttt gt 22

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cctggacaca aaccaggaca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtgggttgtt ctcatgcagc 20

<210> 15

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gccaagacca gaagaaaa 18

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gccaagacca gaagaaaa 18

<210> 17

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gccaaugacc uagaagauaa a 21

<210> 18

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

uuuaucuucu aggucauugg c 21

<210> 19

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

uucuccgaac gugucacgu 19

<210> 20

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

acgugacacg uucggagaa 19

<210> 21

<211> 267

<212> DNA

<213> mouse (Mus musculus)

<400> 21

atgcaagagg ttgttctgag cctgttggtc cttctagcag gcctgcctac tttggatgcc 60

aatgaccctg aaaataaaaa tgatcctttc tactatgatt ggtacagcct ccgagtcggc 120

gggctcattt gtgcagggat tctctgtgcc ctgggcatta tagtccttat gagtggcaaa 180

tgcaaatgca agttcagaca gaaacccagt caccgcccag gagaagggcc acctctcatc 240

acaccaggct cagctcacaa ctgctga 267

Claims

Application of FXYD 3protein or its coding gene as target in preparing medicine for preventing and treating psoriasis.
2. The use according to claim 1 wherein the medicament is an antibody directed against FXYD3 protein.
3. The use according to claim 1, wherein the medicament is a pharmaceutical formulation directed against an inhibitor of FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof.
4. The use according to claim 1, wherein the medicament is a DNA or RNA that blocks expression or transcription of FXYD3 protein.
5. The use of claim 1, wherein the agent is an agent that blocks or inhibits NF-kB and MAPK signaling activation by FXYD3 protein.
6. An antibody aiming at FXYD 3protein is applied to the preparation of a medicament for preventing and treating psoriasis.
7. The application of a medicinal preparation of an inhibitor aiming at FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof in preparing a medicament for preventing and treating psoriasis.
Application of the vector with FXYD3 gene knocked out by siRNA in preparation of medicines for preventing and treating psoriasis.
9. A medicine for preventing and treating psoriasis is characterized by comprising the following components in parts by weight:

(1) antibodies against FXYD3 protein;

(2) a pharmaceutical formulation of an inhibitor against FXYD 3protein or a pharmaceutically acceptable salt, solvate or hydrate thereof;

(3) DNA or RNA that blocks the expression or transcription of FXYD3 protein.
10. The medicament of claim 9, wherein the medicament is siRNA for knocking out FXYD3 gene or a vector for expressing the siRNA, and the sequence of the siRNA is 5'-GCCAAUGACCUAGAAGAUAAA-3' or 5'-UUUAUCUUCUAGGUCAUUGGC-3'.