CN114438125B

CN114438125B - Method for enhancing LGI1 immunofluorescence, and immunofluorescence detection method and application of LGI1 antibody

Info

Publication number: CN114438125B
Application number: CN202210135752.3A
Authority: CN
Inventors: 闫亚平; 赵子越; 郝文斌; 陈倩文; 刘龙月; 李科
Original assignee: Shaanxi Mybiotech Co ltd
Current assignee: Shaanxi Mybiotech Co ltd
Priority date: 2022-02-15
Filing date: 2022-02-15
Publication date: 2023-02-03
Anticipated expiration: 2042-02-15
Also published as: CN114438125A

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for enhancing LGI1 immunofluorescence, an immunofluorescence detection method of an LGI1 antibody and application. The present invention utilizes co-expression of LGI1 and ADAM22; or LGI1 immunofluorescence is enhanced in a mode of co-expressing LGI1 and ADAM23, the ADAM22 protein or ADAM23 protein can promote LGI1 in cells to stay on cell membranes and capture LGI1 outside the cells, an LGI1 immunofluorescence signal can be enhanced, the LGI1 signal can be detected only by a small amount of ADAM22 or ADAM23 plasmid, and the problem of poor LGI1 autoantibody signal in immunofluorescence detection serum is solved.

Description

Method for enhancing LGI1 immunofluorescence, and immunofluorescence detection method and application of LGI1 antibody

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for enhancing LGI1 immunofluorescence, an LGI1 antibody immunofluorescence detection method and application.

Background

LGI1 (Leu-Rich glioma inactivating gene 1) is a secreted protein present in the central nervous system, is a specific component of the Voltage-gated potassium Channel (VGKC) complex, and is highly expressed in neocortex and hippocampus. Impaired function of this protein affects synaptic protein connections and reduces synaptic transmission mediated by the relevant receptor.

LGI1 antibody encephalitis is an autoimmune encephalitis with seizures, hyponatremia and cognitive dysfunction as main clinical manifestations, and is frequently seen in middle-aged and elderly people between 50 and 70 years of age. The incidence and age of men are higher than those of women, and the incidence and age of men are about 60 to 70 percent. Detection of the LGI1 antibody is a characteristic index for diagnosing the encephalitis of the LGI1 antibody, and commonly used methods include immunohistochemistry, immunofluorescence, immunocolloidal gold, enzyme-linked immunosorbent assay (ELISA), and the like. The immunofluorescence method is widely applied to the detection of the autoantibody due to simplicity, rapidness and intuitive result. However, since LGI1 is a secreted protein, after overexpression, when serum of a patient is subjected to immunofluorescence detection, signals are extremely weak, so that the serum of many LGI 1-positive patients cannot detect the signals, the detection rate is extremely low, and the detection is easy to miss. In order to enhance the LGI1 immunofluorescence signal, studies have shown (Autoantibodies to Epilepsy-Related LGI1 in Limbic Encephalitis neural LGI1-ADAM22 Interaction and reduction synthetic AMPA Receptors) that LGI1 protein plus membrane localization signal GPI can enhance the LGI1 immunofluorescence signal, but the enhancement is not of a desirable magnitude. How to improve the immunofluorescence signal of LGI1 remains to be explored.

Disclosure of Invention

The invention aims to provide a method for enhancing LGI1 immunofluorescence, an immunofluorescence detection method of an LGI1 antibody and application, which are used for enhancing an LGI1 immunofluorescence signal and detecting an LGI1 autoantibody with high sensitivity.

The invention provides a method for enhancing LGI1 immunofluorescence, which comprises the following steps:

co-expressing LGI1 and ADAM22; or co-expressing LGI1 and ADAM23.

Preferably, the amino acid sequence of the LGI1 is shown in SEQ ID NO. 1; the amino acid sequence of the ADAM22 is shown as SEQ ID NO. 3; the amino acid sequence of ADAM23 is shown in SEQ ID NO. 5.

The invention also provides an immunofluorescence detection method of LGI1, which comprises the following steps:

inserting a DNA fragment for coding LGI1 into an expression vector, and extracting a plasmid to obtain an LGI1 recombinant expression plasmid;

inserting a DNA fragment for coding ADAM22 into an expression vector, and extracting plasmids to obtain ADAM22 recombinant expression plasmids; or inserting the DNA segment for coding ADAM23 into an expression vector, and extracting plasmids to obtain ADAM23 recombinant expression plasmids;

transfecting the LGI1 recombinant expression plasmid and the ADAM22 recombinant expression plasmid into cells simultaneously, and performing immunofluorescence staining after the cells are cultured; or transfecting the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid into cells at the same time, and performing immunofluorescence staining after the cells are cultured.

Preferably, the mass ratio of the ADAM23 recombinant expression plasmid to the LGI1 recombinant expression plasmid during transfection is 1;

the mass ratio of the ADAM22 recombinant expression plasmid to the LGI1 recombinant expression plasmid is 1.

Preferably, the expression vector comprises a eukaryotic vector.

Preferably, the temperature of the cell culture is 37 ℃ and the time is 48h.

Preferably, the LGI 1-encoding DNA fragment, the ADAM 22-encoding DNA fragment, and the ADAM 23-encoding DNA fragment are each obtained by a PCR amplification method.

Preferably, the transfection comprises PEI transfection, lipofectamin 2000 transfection, lipofectamin 3000 transfection or electroporation.

Preferably, the volume-to-mass ratio of the PEI to the LGI1 recombinant expression plasmid is1:2～4。

The invention also provides application of the immunofluorescence detection method in detecting the LGI1 autoantibody.

The present invention provides a method of enhancing the immunofluorescence of LGI1, comprising co-expressing LGI1 and ADAM22; or coexpressing LGI1 and ADAM23.ADAM22 or ADAM23 proteins can promote intracellular LGI1 to reside on the cell membrane and capture extracellular LGI1, and can enhance the LGI1 immunofluorescence signal.

The ADAM22 recombinant expression plasmid or the ADAM23 recombinant expression plasmid and the LGI1 recombinant expression plasmid are transfected into cells simultaneously and used for immunofluorescence detection of LGI1 antibodies, LGI1 signals can be detected only by a small amount of ADAM22 or ADAM23 plasmids, and the problem of poor LGI1 autoantibody signals in serum of immunofluorescence detection is solved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required in the embodiments will be briefly described below.

FIG. 1 is a 17T2A plasmid map;

FIG. 2 shows the immunofluorescence staining results of transfected LGI1, LGI1-GPI living cells;

FIG. 3 shows the results of immunofluorescence staining after fixation of LGI 1-and LGI 1-GPI-transfected cells;

FIG. 4 shows the results of the effect of ADAM22 on the immunofluorescence signal of LGI 1;

FIG. 5 shows the results of immunofluorescence staining of LGI1 and ADAM23 co-transformed living cells;

FIG. 6 shows the results of immunofluorescence staining after cell fixation of LGI1 and ADAM23 cotransformed;

FIG. 7 shows the results of the effect of ADAM23 transfection amount on LGI1 signal, specifically living cell immunofluorescence;

FIG. 8 shows the results of the effect of ADAM23 transfection amount on LGI1 signal, specifically, the results of immobilized cell immunofluorescence;

FIG. 9 shows the results of the effect of ADAM23 transfection amount on LGI1 and ADAM23 signals, specifically, the results of immobilized cell immunofluorescence;

fig. 10 is a result of ADAM23 affecting the signal of LGI1 by binding to LGI1 secreted outside the cell;

FIG. 11 is a result of comparing the effect of ADAM22 and ADAM23 on the enhancement of the fluorescence signal of LGI 1;

FIG. 12 shows the results of immunofluorescence staining of cells co-transformed with LGI1 and ADAM23 after cell fixation by transfection of the constructed fusion plasmid LGI1-ADAM 23.

Detailed Description

co-expressing LGI1 and ADAM22; or coexpressing LGI1 and ADAM23.

The amino acid sequence of the LGI1 of the present invention is preferably shown in SEQ ID NO.1, and the nucleotide sequence encoding the LGI1 is preferably shown in SEQ ID NO. 2. The amino acid sequence of the ADAM22 disclosed by the invention is preferably shown as SEQ ID NO.3, and the nucleotide sequence for coding the ADAM22 is preferably shown as SEQ ID NO. 4. The amino acid sequence of the ADAM23 disclosed by the invention is preferably shown as SEQ ID NO.5, and the nucleotide sequence for coding the ADAM23 is preferably shown as SEQ ID NO. 6.

The present invention does not strictly require the source of the LGI1, ADAM22 and ADAM23, and can be obtained by chemical synthesis or by amplification using a corresponding nucleotide sequence as a template.

The ADAM22 protein or ADAM23 protein of the present invention can promote LGI1 in cells to stay on the cell membrane and capture LGI1 outside the cells, and can enhance the immunofluorescence signal of LGI 1.

The method of co-expression according to the invention preferably comprises: inserting the DNA segment coding LGI1, the DNA segment coding ADAM22 and the DNA segment coding ADAM23 into expression vectors respectively, and extracting plasmids to obtain LGI1 recombinant expression plasmids, ADAM22 recombinant expression plasmids and ADAM23 recombinant expression plasmids;

transfecting the LGI1 recombinant expression plasmid and the ADAM22 recombinant expression plasmid into cells simultaneously, and performing immunofluorescence staining after the cells are cultured;

or transfecting the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid into a cell simultaneously.

In the present invention, the specific sources of the DNA fragment encoding LGI1, ADAM22 and ADAM23 are not particularly limited, but in the examples, they are preferably obtained by a PCR amplification method, but they cannot be considered as the full scope of the present invention. In the present invention, it is preferable to obtain the LGI1 gene sequence (accession No. NM-005097.4) from the GenBank sequence database, synthesize the gene sequence, ligate the LGI1 gene of interest to an expression vector, and amplify the LGI 1-encoding DNA fragment. The upstream primer used for amplification in the invention is preferably LGI1-NheI-F, and the nucleotide sequence is shown in SEQ ID NO. 7; the downstream primer is preferably LGI1-NotI-R, and the nucleotide sequence is shown in SEQ ID NO. 8.

In the present invention, it is preferable to search the GenBank sequence database for an ADAM22 gene sequence (accession No. NM-021723.5), synthesize the gene sequence, join ADAM22 to an expression vector, and amplify the DNA fragment encoding ADAM22. The upstream primer used for amplification in the invention is preferably ADAM22-NheI-F, and the nucleotide sequence is shown in SEQ ID NO. 9; the downstream primer is preferably ADAM22-NotI-R, and the nucleotide sequence is shown as SEQ ID NO. 10.

In the present invention, it is preferable to search the GenBank sequence database for an ADAM23 gene sequence (accession No. NM-003812.4), synthesize the gene sequence, join the gene ADAM23 to an expression vector, and amplify the DNA fragment encoding ADAM23. The upstream primer used for amplification in the invention is preferably ADAM23-NheI-F, and the nucleotide sequence is shown in SEQ ID NO. 11; the downstream primer is preferably ADAM23-NotI-R, and the nucleotide sequence is shown in SEQ ID NO. 12.

The base sequences of the primers of the invention are as follows from 5 'to 3':

LGI1-NheI-F：ATCCGCTAGCCGCCACCATGGAATCAGAAAGAAGCAA

LGI1-NotI-R：TTTATAGCGGCCGCTGCGCTTAAGTCAACTATGACA

ADAM22-NheI-F：ATCCGCTAGCCGCCACCATGCAGGCGGCAGTGGCTGTGT

ADAM22-NotI-R：TTTATAGCGGCCGCTTAAATGGATGTCTCCCATAGC

ADAM23-NheI-F：ATCCGCTAGCCGCCACCATGAAGCCGCCCGGCAGCAGCT

ADAM23-NotI-R：TTTATAGCGGCCGCTCAGATGGGGCCTTGCTGAGTA

the present invention inserts a DNA fragment encoding LGI1, a DNA fragment encoding ADAM22 and a DNA fragment encoding ADAM23 into expression vectors, respectively, and extracts plasmids to obtain LGI1 recombinant expression plasmids, ADAM22 recombinant expression plasmids and ADAM23 recombinant expression plasmids. The present invention does not require a specific kind of the expression vector, and a eukaryotic vector is preferably used. In the specific implementation process of the invention, the 17T2A carrier is taken as an example for explanation. The map of the 17T2A vector of the invention is shown in FIG. 1. In the present invention, it is preferable that the LGI 1-encoding DNA fragment, the ADAM 22-encoding DNA fragment and the ADAM 23-encoding DNA fragment are inserted into the NheI and NotI sites of the 17T2A vector, respectively. The method has no strict requirement on the plasmid extraction mode, and the plasmid extraction kit is used for extraction. In the practice of the present invention, the extraction kit used is preferably purchased from TIANGEN BIOTECH.

When the LGI1 recombinant expression plasmid and the ADAM22 recombinant expression plasmid are transfected, the mass ratio of the ADAM22 recombinant expression plasmid to the LGI1 recombinant expression plasmid is 1. In the specific implementation process of the present invention, any ratio in the ratio range of 1 to 599 can be selected as the mass ratio of the ADAM22 recombinant expression plasmid to the LGI1 recombinant expression plasmid during transfection, such as 1. According to the invention, the DNA fragment for coding LGI1 and the DNA fragment for coding ADAM22 are respectively inserted into an expression vector and then are co-transfected, so that the purposes of enhancing LGI1 signals and detecting LGI1 antibodies can be realized by using a small amount of ADAM22 and LGI1 for co-expression, the original functions of LGI1 proteins and ADAM22 proteins are maintained, the mutual influence between LGI1 proteins and ADAM22 proteins is avoided, and a reaction effect is realized.

When the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid are transfected, the mass ratio of the ADAM23 recombinant expression plasmid to the LGI1 recombinant expression plasmid is preferably 1 to 599; more preferably 1. In the specific implementation process of the present invention, any ratio in the ratio range of 1 to 599 can be selected as the mass ratio of the ADAM23 recombinant expression plasmid to the LGI1 recombinant expression plasmid at the time of transfection, such as 1. According to the invention, the DNA segment coding LGI1 and the DNA segment coding ADAM23 are respectively inserted into an expression vector and then are co-transfected, so that the purposes of enhancing an LGI1 signal and detecting an LGI1 antibody can be realized only by using a small amount of ADAM23 and LGI1 for co-expression, the original functions of LGI1 protein and ADAM23 protein are maintained, the mutual influence between LGI1 protein and ADAM23 protein is avoided, and the reverse effect is achieved.

The transfection method according to the present invention preferably includes PEI transfection, lipofectamin 2000 transfection, lipofectamin 3000 transfection or electroporation, and more preferably PEI transfection. The volume-to-mass ratio of the PEI and the LGI1 recombinant expression plasmid is preferably 2 muL to 1 mug.

The present invention transfects the LGI1 recombinant expression plasmid and the ADAM22 recombinant expression plasmid into cells at the same time, or transfects the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid into cells at the same time, to obtain transfected cells. The present invention preferably performs immunofluorescent staining after culturing the transfected cells. The temperature of the culture of the invention is preferably 37 ℃; the time for the cultivation is preferably 48h. The invention has no strict requirement on the type of cells into which the recombinant expression plasmid is transfected, and 293T cells are preferably transfected.

transfecting the LGI1 recombinant expression plasmid and the ADAM22 recombinant expression plasmid into cells at the same time, and performing immunofluorescence staining after the cells are cultured;

or transfecting the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid into cells simultaneously, and performing immunofluorescence staining after the cells are cultured.

The immunofluorescence detection method of LGI1 in the invention is preferably to perform co-expression of LGI1 and ADAM22 or LGI1 and ADAM23 on cells, then culture the obtained cells, and then perform immunofluorescence staining, wherein the co-expression method is preferably the same as the above method, and is not repeated herein. The present invention does not strictly require the immunofluorescent staining method, and the staining method known in the art can be adopted, for example, the immunofluorescent staining can be performed by using living cells, and the staining can be performed after cell slide is obtained by using a fixing solution to fix cells.

The invention also provides application of the immunofluorescence detection method in detecting the LGI1 autoantibody. After the co-expression, the ADAM22 protein or ADAM23 protein can promote LGI1 in cells to stay on cell membranes and capture LGI1 outside the cells, so that LGI1 signals can be detected only by a trace amount of ADAM22 or ADAM23 plasmid, and the problem of poor LGI1 autoantibody signals in immunofluorescence detection serum is solved.

In order to further illustrate the present invention, the following detailed description of the technical solutions provided by the present invention is made with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of LGI1 recombinant expression plasmids

1. Gene synthesis:

the gene sequence of LGI1 (accession No. NM-005097.4) was searched from GenBank sequence database and synthesized (GENEWIZ).

2. Vector construction

The method comprises the following specific steps of selecting NheI and NotI enzyme cutting sites, and connecting a target gene LGI1 into a 17T2A vector:

2.1. using a synthesized plasmid containing a target gene LGI1 (1674 bp) as a template, and performing PCR amplification on an upstream primer LGI1-NheI-F and a downstream primer LGI1-NotI-R to obtain an LGI1 gene;

PCR amplification System (50. Mu.l): template 50ng, LGI1-NheI-F (10. Mu.M) 1. Mu.l, LGI1-NotI-R (10. Mu.M) 1. Mu.l, fastPfu DNA Polymerase (2.5 units) 1. Mu.l, 5 XFastPfu buffer 10. Mu.l, 2.5mM dNTP 4. Mu.l and the balance nucleic-free Water.

PCR amplification procedure: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 20s, annealing at 58 ℃ for 20s, and extension at 72 ℃ for 50s, wherein the denaturation is carried out for 35 cycles; re-extending at 72 deg.c for 5min; storing at 4 ℃.

And 2.2, carrying out agarose gel electrophoresis on the PCR product to successfully amplify a band, and cutting and recovering the target band (the gel recovery kit is purchased from TIANGEN BIOTECH).

2.3. The gel recovery product and the 17T2A vector (the map is shown in figure 1) are subjected to double enzyme digestion by NheI and NotI respectively, and the enzyme digestion system (40 mu l): gel recovery products and 17T2A each 1. Mu.g, nheI 1. Mu.l, notI 1. Mu.l, 10 XFastDigel buffer, the remainder being Nuclear-free Water; enzyme cutting conditions are as follows: 30min at 37 ℃.

2.4. And (3) carrying out agarose gel electrophoresis on the enzyme digestion product, and cutting and recovering the target band. Connecting the recovered enzyme-digested target fragment with a vector by using T4 enzyme at 16 ℃ for 1h; the ligation products were then transformed into DH5a competent cells (purchased from TIANGEN BIOTECH), heat-shocked, then added with 500ml LB medium, placed on a shaker at 37 ℃ for 30min, spread evenly on LB plates containing ampicillin, and cultured overnight at 37 ℃.

2.5. And (3) selecting the monoclonal on the plate to be in an LB liquid culture medium containing ampicillin, shaking bacteria, extracting plasmids (a plasmid extraction kit is purchased from TIANGEN BIOTECH), carrying out enzyme digestion identification, and sequencing positive plasmids. The sequencing results are compared correctly, and the plasmid construction is successful.

Example 2

Construction of ADAM22 recombinant expression plasmid

An ADAM22 gene sequence (accession No. NM-021723.5) was searched from a GenBank sequence database and synthesized. The gene is connected to a 17T2A vector, enzyme cutting sites are NheI and NotI, an upstream primer is ADAM22-NheI-F, a downstream primer is ADAM22-NotI-R, and after the sequencing is correct, a plasmid is extracted for subsequent transfection, and the specific construction method is the same as that in example 1.

Example 3

Construction of ADAM23 recombinant expression plasmid

The sequence of ADAM23 gene (accession No. NM-003812.4) was searched from GenBank sequence database and synthesized. The gene is connected to a 17T2A vector, enzyme cutting sites are NheI and NotI, an upstream primer is ADAM23-NheI-F, a downstream primer is ADAM23-NotI-R, and after the sequencing is correct, a plasmid is extracted for subsequent transfection, and the specific construction method is the same as that in example 1.

Comparative example 1

Construction of LGI1-GPI recombinant expression plasmid

GPI is connected to the C terminal of LGI1 to construct a plasmid for expressing LGI1-GPI fusion protein, specifically: the plasmid containing the target gene LGI1 (1674 bp) in example 1 is used as a template, the nucleotide sequence of 5'-3' of the upstream primer LGI1-GPI-NheI-F is the same as that of LGI1-NheI-F in example 1, and the nucleotide sequence of the downstream primer LGI1-GPI-NotI-R (shown as SEQ ID NO. 13) is: TTTATAGCGGCCGCTCAAG CAAGCTCCAGAAGGTAGCTAGGAGTGCTGGGACCAGGGCCAAGGTCACCGGGGGGTAGCAAAGCC AGCACCGTTGCATGCTTAAGTCAACTATGACA, PCR-amplifying LGI1-GPI gene; the subsequent construction was the same as in example 1.

Comparative example 2

Construction of LGI1-ADAM23 recombinant expression plasmids

Using the 17T2A vector to which ADAM23 was ligated in example 3 as a template, an ADAM23 gene (with NotI cleavage sites upstream and downstream) was amplified using an upstream primer LGI1-ADAM23-NotI-F (shown as SE Q ID NO.14:5 'and AAATATGCGGCCGCATGAAGCCGCCCGGCAGCAGCT-3') and a downstream primer LGI1-ADA M23-NotI-R (shown as SEQ ID NO.15:5 'and TTTATAGCGGCCGCTCAGATGGGGCCTTGCTGAGTAG-3'); performing single enzyme digestion on the amplified ADAM23 gene fragment by using NotI; the 17T2A vector connected with LGI1 in example 1 is subjected to single digestion by NotI; respectively recovering the ADAM23 single enzyme cutting gene segment and the single enzyme cutting vector, and connecting the gene segment and the single enzyme cutting vector by T4 ligase at 16 ℃. After the sequencing is correct, plasmids are extracted for subsequent transfection, the constructed fusion plasmid is marked as LGI1-ADAM23, and the specific construction steps are the same as those in example 1.

Example 4

Cell transfection:

1. digesting the cultured 293T cells by pancreatin, stopping digestion by using a DMEM complete culture medium containing 10% serum, sucking the digested cells into a centrifuge tube, centrifuging at 800-1000 rpm for 5min, pouring off the supernatant, adding the DMEM complete culture medium containing 10% serum, and lightly blowing and uniformly mixing by using a pipettor to prepare a cell suspension; and (3) placing the autoclaved slide in a 10cm cell culture dish, treating with polylysine, adding the prepared cell suspension into the culture dish after the slide in the dish is dried, and slightly and uniformly mixing. Standing at 37 deg.C, 5% CO ₂ The incubator was used for overnight culture. Cells were observed the next day and transfected at a density of 30-40%.

2. LGI1 (6 ug) prepared in example 1 was mixed with the transfection reagent PEI at a mass to volume ratio of 1 ₂ Culturing for 48h;

LGI1-GPI (6 ug) plasmid prepared in comparative example 1 was mixed with PEI as a transfection reagent at a mass to volume ratio of 1 ₂ Culturing for 48h.

3. Live cell immunofluorescent staining

Cells transfected 48h after transfection in step 2 were incubated with commercial LGI1 antibody (1; washing with PBS for 5min for 3 times; fluorescently labeled secondary antibody (purchased from Jackson ImmunoResearch) was incubated for 30min; washing with PBS for 5min for 3 times; the results of observation under a microscope were photographed, and the photographing results are shown in FIG. 2.

As can be seen from FIG. 2, after LGI1 and LGI1-GPI expression plasmids are transfected, LGI1 positive serum is directly incubated for live cell immunofluorescence staining, and no signal appears in LGI1 and LGI1 positive serum after transfection, while obvious signals appear in LGI1-GPI and LGI1 positive serum after transfection. It was demonstrated that LGI1-GPI was expressed on the cell membrane surface, and GPI anchored secretory LGI1 to the cell membrane surface and bound to LGI1 autoantibodies in serum, thereby developing a positive signal.

4. FIXED-IMMUNOFLUORESCENT DYEING

Cells transfected for 48h were fixed with acetone to make cell crawlers, which were separately diluted with commercial LGI1 antibody (1; washing with PBS for 5min for 3 times; fluorescently labeled secondary antibody (purchased from Jackson ImmunoResearch) was incubated for 30min; washing with PBS for 5min for 3 times; the results of observation under a microscope were photographed, and the photographing results are shown in FIG. 3.

As can be seen from FIG. 3, after cell fixation, LGI 1-positive blood detected a signal on LGI 1-transfected cells, but was weaker than LGI1-GPI, indicating that GPI can enhance the signal of LGI 1.

Example 5

The difference from example 4 is that in step 2: LGI1, LGI1-GPI were transfected separately, LGI1 and ADAM22 were co-transfected, specifically:

LGI1 (6 ug) prepared in example 1 was mixed with the transfection reagent PEI at a mass to volume ratio of 1 ₂ Culturing for 48h;

LGI1 (3 ug) prepared in example 1 and ADAM22 (3 ug) plasmid prepared in example 2 were mixed, mixed with PEI as a transfection reagent at a mass to volume ratio of 1 ₂ Culturing for 48h;

LGI1-GPI (6 ug) plasmid prepared in comparative example 1 was mixed with PEI as a transfection reagent at a mass to volume ratio of 1 ₂ Culturing for 48h;

fixation-immunofluorescence staining procedure as in example 4, step 4, with patient serum (1; washing with PBS for 5min for 3 times; fluorescently labeled secondary antibody (purchased from Jackson ImmunoResearch) was incubated for 30min; washing with PBS for 5min for 3 times; the result of observation under a microscope was photographed, and the result of fluorescent photographing was shown in FIG. 4.

As can be seen from fig. 4, when LGI1 and ADAM22 were co-transfected, respectively, 3ug, and LGI 1-positive serum signals were significantly stronger than LGI1-GPI (6 ug) alone, and even stronger than LGI1 (6 ug) alone, the interaction between GI1 and ADAM22 enhanced the retention of LGI1 on the cell membrane, thereby enhancing the signaling of LGI 1.

Example 6

The difference from example 4 is that in step 2: LGI1, LGI1-GPI, ADAM23 were transfected separately, LGI1 and ADAM23 were co-transfected, specifically:

the ADAM23 (6 ug) plasmid prepared in example 3 was mixed with PEI as a transfection reagent at a mass/volume ratio of 1 ₂ Culturing for 48h;

LGI1 (3 ug) prepared in example 1 and ADAM23 (3 ug) plasmid prepared in example 3 were mixed, then mixed with the transfection reagent PEI at a mass to volume ratio of 1 ₂ Culturing for 48h;

the live cell immunofluorescent staining procedure was the same as in step 3 of example 4, with commercial ADAM23 antibody (1;

fixation-immunofluorescence staining procedure as in step 4 of example 4, cells transfected for 48h in step 2 were incubated for 1h with commercial LGI1 antibody (1; washing with PBS for 5min for 3 times; fluorescently labeled secondary antibody (purchased from Jackson ImmunoResearch) was incubated for 30min; washing with PBS for 5min for 3 times; the result of observation under a microscope was photographed, and the result of fluorescent photographing was shown in FIG. 6.

As can be seen from fig. 5 and 6, when LGI1 and ADAM23 were co-transfected, each transfection was 3ug, and LGI 1-positive serum signals were significantly stronger than LGI1-GPI (6 ug) alone, and more than LGI1 (6 ug) alone, the interaction of GI1 and ADAM23 enhanced LGI1 retention on the cell membrane, thereby enhancing LGI1 signals.

Example 7

Amount of ADAM23 transfection required to enhance LGI1 immunofluorescence Signal

The difference from example 4 is that in step 2: LGI1 and ADAM23 were co-transfected, the total mass of LGI1 and ADAM23 transfected was constant, the plasmid amount of LGI1 was sequentially increased, and the plasmid amount of ADAM23 was sequentially decreased, as shown in Table 1 below.

TABLE 1LGI1 and ADAM23 transfection amounts

Numbering	LGI1-GPI transfection amount (ug)	LGI1 transfection amount (ug)	ADAM23 transfection amount (ug)
				1	6	/	/
2	/	6	/
				3	/	3	3
4	/	5	1
				5	/	5.9	0.1
6	/	5.99	0.01

Mixing the plasmid according to Table 1 with the transfection reagent PEI in a mass to volume ratio of 1 ₂ Culturing for 48h; the steps of the immunofluorescence of the living cells and the immunofluorescence after fixation are respectively carried out, the steps are the same as the steps 4 to 5 of the example 4, the immunofluorescence result of the living cells is shown in a figure 7, and the immunofluorescence result of the fixation is shown in a figure 8 to 9.

As can be seen from fig. 7 to 9, ADAM23 antibody was not able to detect ADAM23 signal when ADAM23 was transfected at 0.1ug, while LGI 1-positive serum signal co-transfected with LGI1 and ADAM23 was still stronger than LGI1-GPI transfected at 6ug alone. When 0.01ug of ADAM23 was transfected, LGI1 positive serotonergic co-transfected with LGI1 and ADAM23 still detected a signal that was comparable to 6ug of LGI1-GPI signal transfected alone; when LGI13ug and ADAM233ug were co-transfected, the LGI 1-positive serum signal was significantly enhanced, whereas the ADAM 23-positive serum signal, although weak, was also detectable. When the amount of ADAM23 plasmid was reduced to 1ug, i.e., LGI15ug and ADAM231ug were co-transfected, a positive serum signal of ADAM23 was not detected. The trace amount of ADAM23 in the invention can enhance the positive signal of LGI1, and can be applied to immunofluorescence detection of LGI1 autoantibodies.

Example 8

The difference from example 4 is that in step 2:

6ug of LGI1, ADAM23 (triplicate) and 17T2A (control plasmid) are transfected separately, after 24h of culture, three portions of ADAM 23-transfected cell supernatant are discarded, the first portion is added with LGI 1-transfected cell supernatant, the second portion is added with an equal volume of 17T 2A-transfected control supernatant, the third portion is cultured normally without any treatment, the culture is carried out for 48h, after fixing and flaking, an immunofluorescence verification signal is carried out by using LGI1 positive serum, the specific steps are the same as those in step 4 of example 4, and the fluorescence detection result is shown in FIG. 10.

As can be seen from fig. 10, when LGI 1-positive serum was used for immunofluorescence, the group cultured with added LGI1 supernatant clearly detected the LGI1 signal, while both the control supernatant and the non-added supernatant had no signal, indicating that ADAM23 could enhance the signal by binding to LGI1 secreted from the cell supernatant.

Comparative example 3

Comparison of the Effect of ADAM22 and ADAM23 on the enhancement of LGI1 fluorescence Signal

The difference from example 4 is that in step 2:

ADAM22 and ADAM23 were co-transfected with LGI1, respectively, maintaining the same transfection quality, specifically: LGI1 (6 ug) prepared in example 1 was mixed with the transfection reagent PEI at a mass to volume ratio of 1,transfection into prepared cells, 37 ℃,5% CO ₂ Culturing for 48h;

LGI1 (3 ug) prepared in example 1 and ADAM23 (3 ug) plasmid prepared in example 3 were mixed, mixed with PEI as a transfection reagent at a mass to volume ratio of 1 ₂ Culturing for 48h. The immunofluorescent staining procedure was the same as in steps 4 to 5 of example 4, and the detection results are shown in FIG. 11.

As can be seen from fig. 11, both ADAM22 and ADAM23 enhanced the signal of LGI1, and ADAM23 enhanced more than ADAM22.

Comparative example 4

The difference from example 4 is that in step 2:

LGI1 (3 ug) prepared in example 1 and ADAM23 (3 ug) plasmid prepared in example 3 were mixed, mixed with PEI as a transfection reagent at a mass to volume ratio of 1 ₂ Culturing for 48h;

LGI1-ADAM23 plasmid (3 ug) prepared in comparative example 2 was mixed with transfection reagent PEI at a mass to volume ratio of 1 ₂ Culturing for 48h. The immunofluorescent staining procedure was the same as in steps 4 to 5 of example 4, and the results of detection are shown in FIG. 12.

As can be seen from FIG. 12, LGI 1ug and ADAM23 ug were co-transfected, and LGI1-ADAM23 ug was transfected alone to express LGI1-ADAM23 fusion protein, but the LGI 1-positive serum signal was more or less strong and slightly changed in morphology. However, the LGI1-ADAM23 fusion protein enhanced LGI 1-positive serum signals, while ADAM 23-positive signals were also significantly detectable, and were significantly stronger than ADAM 23-positive signals when LGI13ug and ADAM23 ug were co-transfected. LGI1-ADAM23 is a fusion protein and does not control the amount of ADAM23 and LGI1 individually, so this approach is not an ideal way to enhance the fluorescence signal of LGI 1.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and all of the embodiments are included in the scope of the present invention.

Sequence listing

<110> Shanxi vessel Biotechnology GmbH

<120> method for enhancing LGI1 immunofluorescence, and immunofluorescence detection method and application of LGI1 antibody

<160> 15

<170> SIPOSequenceListing 1.0

<210> 2

<211> 557

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Glu Ser Glu Arg Ser Lys Arg Met Gly Asn Ala Cys Ile Pro Leu

1 5 10 15

Lys Arg Ile Ala Tyr Phe Leu Cys Leu Leu Ser Ala Leu Leu Leu Thr

20 25 30

Glu Gly Lys Lys Pro Ala Lys Pro Lys Cys Pro Ala Val Cys Thr Cys

35 40 45

Thr Lys Asp Asn Ala Leu Cys Glu Asn Ala Arg Ser Ile Pro Arg Thr

50 55 60

Val Pro Pro Asp Val Ile Ser Leu Ser Phe Val Arg Ser Gly Phe Thr

65 70 75 80

Glu Ile Ser Glu Gly Ser Phe Leu Phe Thr Pro Ser Leu Gln Leu Leu

85 90 95

Leu Phe Thr Ser Asn Ser Phe Asp Val Ile Ser Asp Asp Ala Phe Ile

100 105 110

Gly Leu Pro His Leu Glu Tyr Leu Phe Ile Glu Asn Asn Asn Ile Lys

115 120 125

Ser Ile Ser Arg His Thr Phe Arg Gly Leu Lys Ser Leu Ile His Leu

130 135 140

Ser Leu Ala Asn Asn Asn Leu Gln Thr Leu Pro Lys Asp Ile Phe Lys

145 150 155 160

Gly Leu Asp Ser Leu Thr Asn Val Asp Leu Arg Gly Asn Ser Phe Asn

165 170 175

Cys Asp Cys Lys Leu Lys Trp Leu Val Glu Trp Leu Gly His Thr Asn

180 185 190

Ala Thr Val Glu Asp Ile Tyr Cys Glu Gly Pro Pro Glu Tyr Lys Lys

195 200 205

Arg Lys Ile Asn Ser Leu Ser Ser Lys Asp Phe Asp Cys Ile Ile Thr

210 215 220

Glu Phe Ala Lys Ser Gln Asp Leu Pro Tyr Gln Ser Leu Ser Ile Asp

225 230 235 240

Thr Phe Ser Tyr Leu Asn Asp Glu Tyr Val Val Ile Ala Gln Pro Phe

245 250 255

Thr Gly Lys Cys Ile Phe Leu Glu Trp Asp His Val Glu Lys Thr Phe

260 265 270

Arg Asn Tyr Asp Asn Ile Thr Gly Thr Ser Thr Val Val Cys Lys Pro

275 280 285

Ile Val Ile Glu Thr Gln Leu Tyr Val Ile Val Ala Gln Leu Phe Gly

290 295 300

Gly Ser His Ile Tyr Lys Arg Asp Ser Phe Ala Asn Lys Phe Ile Lys

305 310 315 320

Ile Gln Asp Ile Glu Ile Leu Lys Ile Arg Lys Pro Asn Asp Ile Glu

325 330 335

Thr Phe Lys Ile Glu Asn Asn Trp Tyr Phe Val Val Ala Asp Ser Ser

340 345 350

Lys Ala Gly Phe Thr Thr Ile Tyr Lys Trp Asn Gly Asn Gly Phe Tyr

355 360 365

Ser His Gln Ser Leu His Ala Trp Tyr Arg Asp Thr Asp Val Glu Tyr

370 375 380

Leu Glu Ile Val Arg Thr Pro Gln Thr Leu Arg Thr Pro His Leu Ile

385 390 395 400

Leu Ser Ser Ser Ser Gln Arg Pro Val Ile Tyr Gln Trp Asn Lys Ala

405 410 415

Thr Gln Leu Phe Thr Asn Gln Thr Asp Ile Pro Asn Met Glu Asp Val

420 425 430

Tyr Ala Val Lys His Phe Ser Val Lys Gly Asp Val Tyr Ile Cys Leu

435 440 445

Thr Arg Phe Ile Gly Asp Ser Lys Val Met Lys Trp Gly Gly Ser Ser

450 455 460

Phe Gln Asp Ile Gln Arg Met Pro Ser Arg Gly Ser Met Val Phe Gln

465 470 475 480

Pro Leu Gln Ile Asn Asn Tyr Gln Tyr Ala Ile Leu Gly Ser Asp Tyr

485 490 495

Ser Phe Thr Gln Val Tyr Asn Trp Asp Ala Glu Lys Ala Lys Phe Val

500 505 510

Lys Phe Gln Glu Leu Asn Val Gln Ala Pro Arg Ser Phe Thr His Val

515 520 525

Ser Ile Asn Lys Arg Asn Phe Leu Phe Ala Ser Ser Phe Lys Gly Asn

530 535 540

Thr Gln Ile Tyr Lys His Val Ile Val Asp Leu Ser Ala

545 550 555

<210> 2

<211> 1674

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggaatcag aaagaagcaa aaggatggga aatgcctgca ttcccctgaa aagaattgct 60

tatttcctat gtctcttatc tgcgcttttg ctgactgagg ggaagaaacc agcgaagcca 120

aaatgccctg ccgtgtgtac ttgtaccaaa gataatgctt tatgtgagaa tgccagatcc 180

attccacgca ccgttcctcc tgatgttatc tcattatcct ttgtgagatc tggttttact 240

gaaatctcag aagggagttt tttattcacg ccatcgctgc agctcttgtt attcacatcg 300

aactcctttg atgtgatcag tgatgatgct tttattggtc ttccacatct agagtattta 360

ttcatagaaa acaacaacat caagtcaatt tcaagacata ctttccgggg actaaagtca 420

ttaattcact tgagccttgc aaacaacaat ctccagacac tcccaaaaga tattttcaaa 480

ggcctggatt ctttaacaaa tgtggacctg aggggtaatt catttaattg tgactgtaaa 540

ctgaaatggc tagtggaatg gcttggccac accaatgcaa ctgttgaaga catctactgc 600

gaaggccccc cagaatacaa gaagcgcaaa atcaatagtc tctcctcgaa ggattttgat 660

tgcatcatta cagaatttgc aaagtctcaa gacctgcctt atcaatcatt gtccatagac 720

actttttctt atttgaatga tgagtatgta gtcatcgctc agccttttac tggaaaatgc 780

attttccttg aatgggacca tgtggaaaag accttccgga attatgacaa cattacaggc 840

acatccactg tagtatgcaa gcctatagtc attgaaactc agctctatgt tattgtggcc 900

cagctgtttg gtggctctca catctataag cgagacagtt ttgcaaataa attcataaaa 960

atccaggata ttgaaattct caaaatccga aaacccaatg acattgaaac attcaagatt 1020

gaaaacaact ggtactttgt tgttgctgac agttcaaaag ctggttttac taccatttac 1080

aaatggaacg gaaacggatt ctactcccat caatccttac acgcgtggta cagggacact 1140

gatgtggaat atctagaaat agtcagaaca cctcagacac tcagaacgcc tcatttaatt 1200

ctgtctagta gttcccagcg tcctgtaatt tatcagtgga acaaagcaac acaattattc 1260

actaaccaaa ctgacattcc taacatggag gatgtgtacg cagtgaagca cttctcagtg 1320

aaaggggacg tgtacatttg cttgacaaga ttcattggtg attccaaagt catgaaatgg 1380

ggaggctcct cgttccagga tattcagagg atgccatcgc gaggatccat ggtgttccag 1440

cctcttcaaa taaataatta ccaatatgca attcttggaa gtgattactc ctttactcaa 1500

gtgtataact gggatgcaga gaaagccaaa tttgtgaaat ttcaggaatt aaatgttcag 1560

gcaccaagat cattcacaca tgtgtccatt aataagcgta attttctttt tgcttccagt 1620

tttaagggaa atacacagat ttacaaacat gtcatagttg acttaagcgc atga 1674

<210> 3

<211> 906

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Gln Ala Ala Val Ala Val Ser Val Pro Phe Leu Leu Leu Cys Val

1 5 10 15

Leu Gly Thr Cys Pro Pro Ala Arg Cys Gly Gln Ala Gly Asp Ala Ser

20 25 30

Leu Met Glu Leu Glu Lys Arg Lys Glu Asn Arg Phe Val Glu Arg Gln

35 40 45

Ser Ile Val Pro Leu Arg Leu Ile Tyr Arg Ser Gly Gly Glu Asp Glu

50 55 60

Ser Arg His Asp Ala Leu Asp Thr Arg Val Arg Gly Asp Leu Gly Gly

65 70 75 80

Pro Gln Leu Thr His Val Asp Gln Ala Ser Phe Gln Val Asp Ala Phe

85 90 95

Gly Thr Ser Phe Ile Leu Asp Val Val Leu Asn His Asp Leu Leu Ser

100 105 110

Ser Glu Tyr Ile Glu Arg His Ile Glu His Gly Gly Lys Thr Val Glu

115 120 125

Val Lys Gly Gly Glu His Cys Tyr Tyr Gln Gly His Ile Arg Gly Asn

130 135 140

Pro Asp Ser Phe Val Ala Leu Ser Thr Cys His Gly Leu His Gly Met

145 150 155 160

Phe Tyr Asp Gly Asn His Thr Tyr Leu Ile Glu Pro Glu Glu Asn Asp

165 170 175

Thr Thr Gln Glu Asp Phe His Phe His Ser Val Tyr Lys Ser Arg Leu

180 185 190

Phe Glu Phe Ser Leu Asp Asp Leu Pro Ser Glu Phe Gln Gln Val Asn

195 200 205

Ile Thr Pro Ser Lys Phe Ile Leu Lys Pro Arg Pro Lys Arg Ser Lys

210 215 220

Arg Gln Leu Arg Arg Tyr Pro Arg Asn Val Glu Glu Glu Thr Lys Tyr

225 230 235 240

Ile Glu Leu Met Ile Val Asn Asp His Leu Met Phe Lys Lys His Arg

245 250 255

Leu Ser Val Val His Thr Asn Thr Tyr Ala Lys Ser Val Val Asn Met

260 265 270

Ala Asp Leu Ile Tyr Lys Asp Gln Leu Lys Thr Arg Ile Val Leu Val

275 280 285

Ala Met Glu Thr Trp Ala Thr Asp Asn Lys Phe Ala Ile Ser Glu Asn

290 295 300

Pro Leu Ile Thr Leu Arg Glu Phe Met Lys Tyr Arg Arg Asp Phe Ile

305 310 315 320

Lys Glu Lys Ser Asp Ala Val His Leu Phe Ser Gly Ser Gln Phe Glu

325 330 335

Ser Ser Arg Ser Gly Ala Ala Tyr Ile Gly Gly Ile Cys Ser Leu Leu

340 345 350

Lys Gly Gly Gly Val Asn Glu Phe Gly Lys Thr Asp Leu Met Ala Val

355 360 365

Thr Leu Ala Gln Ser Leu Ala His Asn Ile Gly Ile Ile Ser Asp Lys

370 375 380

Arg Lys Leu Ala Ser Gly Glu Cys Lys Cys Glu Asp Thr Trp Ser Gly

385 390 395 400

Cys Ile Met Gly Asp Thr Gly Tyr Tyr Leu Pro Lys Lys Phe Thr Gln

405 410 415

Cys Asn Ile Glu Glu Tyr His Asp Phe Leu Asn Ser Gly Gly Gly Ala

420 425 430

Cys Leu Phe Asn Lys Pro Ser Lys Leu Leu Asp Pro Pro Glu Cys Gly

435 440 445

Asn Gly Phe Ile Glu Thr Gly Glu Glu Cys Asp Cys Gly Thr Pro Ala

450 455 460

Glu Cys Val Leu Glu Gly Ala Glu Cys Cys Lys Lys Cys Thr Leu Thr

465 470 475 480

Gln Asp Ser Gln Cys Ser Asp Gly Leu Cys Cys Lys Lys Cys Lys Phe

485 490 495

Gln Pro Met Gly Thr Val Cys Arg Glu Ala Val Asn Asp Cys Asp Ile

500 505 510

Arg Glu Thr Cys Ser Gly Asn Ser Ser Gln Cys Ala Pro Asn Ile His

515 520 525

Lys Met Asp Gly Tyr Ser Cys Asp Gly Val Gln Gly Ile Cys Phe Gly

530 535 540

Gly Arg Cys Lys Thr Arg Asp Arg Gln Cys Lys Tyr Ile Trp Gly Gln

545 550 555 560

Lys Val Thr Ala Ser Asp Lys Tyr Cys Tyr Glu Lys Leu Asn Ile Glu

565 570 575

Gly Thr Glu Lys Gly Asn Cys Gly Lys Asp Lys Asp Thr Trp Ile Gln

580 585 590

Cys Asn Lys Arg Asp Val Leu Cys Gly Tyr Leu Leu Cys Thr Asn Ile

595 600 605

Gly Asn Ile Pro Arg Leu Gly Glu Leu Asp Gly Glu Ile Thr Ser Thr

610 615 620

Leu Val Val Gln Gln Gly Arg Thr Leu Asn Cys Ser Gly Gly His Val

625 630 635 640

Lys Leu Glu Glu Asp Val Asp Leu Gly Tyr Val Glu Asp Gly Thr Pro

645 650 655

Cys Gly Pro Gln Met Met Cys Leu Glu His Arg Cys Leu Pro Val Ala

660 665 670

Ser Phe Asn Phe Ser Thr Cys Leu Ser Ser Lys Glu Gly Thr Ile Cys

675 680 685

Ser Gly Asn Gly Val Cys Ser Asn Glu Leu Lys Cys Val Cys Asn Arg

690 695 700

His Trp Ile Gly Ser Asp Cys Asn Thr Tyr Phe Pro His Asn Asp Asp

705 710 715 720

Ala Lys Thr Gly Ile Thr Leu Ser Gly Asn Gly Val Ala Gly Thr Asn

725 730 735

Ile Ile Ile Gly Ile Ile Ala Gly Thr Ile Leu Val Leu Ala Leu Ile

740 745 750

Leu Gly Ile Thr Ala Trp Gly Tyr Lys Asn Tyr Arg Glu Gln Arg Gln

755 760 765

Leu Pro Gln Gly Asp Tyr Val Lys Lys Pro Gly Asp Gly Asp Ser Phe

770 775 780

Tyr Ser Asp Ile Pro Pro Gly Val Ser Thr Asn Ser Ala Ser Ser Ser

785 790 795 800

Lys Lys Arg Ser Asn Gly Leu Ser His Ser Trp Ser Glu Arg Ile Pro

805 810 815

Asp Thr Lys His Ile Ser Asp Ile Cys Glu Asn Gly Arg Pro Arg Ser

820 825 830

Asn Ser Trp Gln Gly Asn Leu Gly Gly Asn Lys Lys Lys Ile Arg Gly

835 840 845

Lys Arg Phe Arg Pro Arg Ser Asn Ser Thr Glu Thr Leu Ser Pro Ala

850 855 860

Lys Ser Pro Ser Ser Ser Thr Gly Ser Ile Ala Ser Ser Arg Lys Tyr

865 870 875 880

Pro Tyr Pro Met Pro Pro Leu Pro Asp Glu Asp Lys Lys Val Asn Arg

885 890 895

Gln Ser Ala Arg Leu Trp Glu Thr Ser Ile

900 905

<210> 4

<211> 2721

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgcaggcgg cagtggctgt gtccgtgccc ttcttgctgc tctgtgtcct ggggacctgc 60

cctccggcgc gctgcggcca ggcaggagac gcctcattga tggagctaga gaagaggaag 120

gaaaaccgct tcgtggagcg ccagagcatc gtgccactgc gcctcatcta ccgctcgggc 180

ggcgaagacg aaagtcggca cgacgcgctc gacacgcggg tgcggggcga cctcggtggc 240

ccgcagttga ctcatgttga ccaagcaagc ttccaggttg atgcctttgg aacgtcattc 300

attctcgatg tcgtgctaaa tcatgatttg ctgtcctctg aatacataga gagacacatt 360

gaacatggag gcaagactgt ggaagttaaa ggaggagagc actgttacta ccagggccat 420

atccgaggaa accctgactc atttgttgca ttgtcaacat gccacggact tcatgggatg 480

ttctatgacg ggaaccacac atatctcatt gagccagaag aaaatgacac tactcaagag 540

gatttccatt ttcattcagt ttacaaatcc agactgtttg aattttcctt ggatgatctt 600

ccatctgaat ttcagcaagt aaacattact ccatcaaaat ttattttgaa gccaagacca 660

aaaaggagta aacggcagct tcgtcgatat cctcgtaatg tagaagaaga aaccaaatac 720

attgaactga tgattgtgaa tgatcacctt atgtttaaaa aacatcggct ttccgttgta 780

cataccaata cctatgcgaa atctgtggtg aacatggcag atttaatata taaagaccaa 840

cttaagacca ggatagtatt ggttgctatg gaaacctggg cgactgacaa caagtttgcc 900

atatctgaaa atccattgat caccctacgt gagtttatga aatacaggag ggattttatc 960

aaagagaaaa gtgatgcagt tcaccttttt tcgggaagtc aatttgagag tagccggagc 1020

ggggcagctt atattggtgg gatttgctcg ttgctgaaag gaggaggcgt gaatgaattt 1080

gggaaaactg atttaatggc tgttacactt gcccagtcat tagcccataa tattggtatt 1140

atctcagaca aaagaaagtt agcaagtggt gaatgtaaat gcgaggacac gtggtccggg 1200

tgcataatgg gagacactgg ctattatctt cctaaaaagt tcacccagtg taatattgaa 1260

gagtatcatg acttcctgaa tagtggaggt ggtgcctgcc ttttcaacaa accttctaag 1320

cttcttgatc ctcctgagtg tggcaatggc ttcattgaaa ctggagagga gtgtgattgt 1380

ggaaccccgg ccgaatgtgt ccttgaagga gcagagtgtt gtaagaaatg caccttgact 1440

caagactctc aatgcagtga cggtctttgc tgtaaaaagt gcaagtttca gcctatgggc 1500

actgtgtgcc gagaagcagt aaatgattgt gatattcgtg aaacgtgctc aggaaattca 1560

agccagtgtg cccctaatat tcataaaatg gatggatatt catgtgatgg tgttcaggga 1620

atttgctttg gaggaagatg caaaaccaga gatagacaat gcaaatacat ttgggggcaa 1680

aaggtgacag catcagacaa atattgctat gagaaactga atattgaagg gacggagaag 1740

ggtaactgtg ggaaagacaa agacacatgg atacagtgca acaaacggga tgtgctttgt 1800

ggttaccttt tgtgtaccaa tattggcaat atcccaaggc ttggagaact cgatggtgaa 1860

atcacatcta ctttagttgt gcagcaagga agaacattaa actgcagtgg tgggcatgtt 1920

aagcttgaag aagatgtaga tcttggctat gtggaagatg ggacaccttg tggtccccaa 1980

atgatgtgct tagaacacag gtgtcttcct gtggcttctt tcaactttag tacttgcttg 2040

agcagtaaag aaggcactat ttgctcagga aatggagttt gcagtaatga gctgaagtgt 2100

gtgtgtaaca gacactggat aggttctgat tgcaacactt acttccctca caatgatgat 2160

gcaaagactg gtatcactct gtctggcaat ggtgttgctg gcaccaatat cataataggc 2220

ataattgctg gcaccatttt agtgctggcc ctcatattag gaataactgc gtggggttat 2280

aaaaactatc gagaacagag acagttaccc cagggagatt atgtaaaaaa gcctggagat 2340

ggtgactctt tttatagcga cattcctccc ggagtcagca caaactcagc atctagttct 2400

aagaagaggt caaatgggct ctctcattct tggagtgaaa ggattccaga cacaaaacat 2460

atttcagaca tctgtgaaaa tgggcgacct cgaagtaact cttggcaagg taacctggga 2520

ggcaacaaaa agaaaatcag aggcaaaaga tttagacctc ggtctaattc aactgagact 2580

ttatctcctg ccaagtctcc ttcttcatca actgggtcta ttgcctccag cagaaaatac 2640

ccttacccaa tgcctccact tcctgatgag gacaagaaag tgaaccgaca aagtgccagg 2700

ctatgggaga catccattta a 2721

<210> 5

<211> 831

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Lys Pro Pro Gly Ser Ser Ser Arg Gln Pro Pro Leu Ala Gly Cys

1 5 10 15

Ser Leu Ala Gly Ala Ser Cys Gly Pro Gln Arg Gly Pro Ala Gly Ser

20 25 30

Val Pro Ala Ser Ala Pro Ala Arg Thr Pro Pro Cys Arg Leu Leu Leu

35 40 45

Val Leu Leu Leu Leu Pro Pro Leu Ala Ala Ser Ser Arg Pro Arg Ala

50 55 60

Trp Gly Ala Ala Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu

65 70 75 80

Lys Asn Leu Gly Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn

85 90 95

Ser Ser Ser Asn Ile Ser Tyr Ser Asn Ala Met Gln Lys Glu Ile Thr

100 105 110

Leu Pro Ser Arg Leu Ile Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro

115 120 125

Tyr His Val Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn Lys

130 135 140

Ala Val His Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser

145 150 155 160

Lys Phe Ile Leu Asp Leu Ile Leu Asn Asn Gly Leu Leu Ser Ser Asp

165 170 175

Tyr Val Glu Ile His Tyr Glu Asn Gly Lys Pro Gln Tyr Ser Lys Gly

180 185 190

Gly Glu His Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser

195 200 205

Lys Val Ala Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp

210 215 220

Asp Thr Phe Val Tyr Met Ile Glu Pro Leu Glu Leu Val His Asp Glu

225 230 235 240

Lys Ser Thr Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly Gln

245 250 255

Tyr Ser Lys Gln Met Lys Asn Leu Thr Met Glu Arg Gly Asp Gln Trp

260 265 270

Pro Phe Leu Ser Glu Leu Gln Trp Leu Lys Arg Arg Lys Arg Ala Val

275 280 285

Asn Pro Ser Arg Gly Ile Phe Glu Glu Met Lys Tyr Leu Glu Leu Met

290 295 300

Ile Val Asn Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala

305 310 315 320

His Thr Asn Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile

325 330 335

Tyr Lys Glu Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr

340 345 350

Trp Thr Glu Lys Asp Gln Ile Asp Ile Thr Thr Asn Pro Val Gln Met

355 360 365

Leu His Glu Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln His Ala Asp

370 375 380

Ala Val His Leu Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser

385 390 395 400

Leu Ser Tyr Phe Gly Gly Val Cys Ser Arg Thr Arg Gly Val Gly Val

405 410 415

Asn Glu Tyr Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser

420 425 430

Leu Ala Gln Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro

435 440 445

Lys Cys Asp Cys Thr Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr

450 455 460

Gly Val Ser His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu Tyr

465 470 475 480

Arg Asp Phe Leu Gln Arg Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro

485 490 495

Thr Lys Leu Phe Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala

500 505 510

Gly Glu Glu Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Leu Cys

515 520 525

Cys Lys Lys Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro

530 535 540

Cys Cys Asn Asn Thr Ser Cys Leu Phe Gln Pro Arg Gly Tyr Glu Cys

545 550 555 560

Arg Asp Ala Val Asn Glu Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp

565 570 575

Ser Gly Gln Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ala Cys

580 585 590

Asn Gln Asn Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp

595 600 605

Asn Gln Cys Gln Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys

610 615 620

Phe Cys Tyr Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys

625 630 635 640

Gly Lys Asp Gly Asp Arg Trp Ile Gln Cys Ser Lys His Asp Val Phe

645 650 655

Cys Gly Phe Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly

660 665 670

Gln Leu Gln Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg

675 680 685

Val Ile Asp Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr Asp

690 695 700

Val Gly Tyr Val Glu Asp Gly Thr Pro Cys Gly Pro Ser Met Met Cys

705 710 715 720

Leu Asp Arg Lys Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys

725 730 735

Pro Leu Asp Ser Lys Gly Lys Val Cys Ser Gly His Gly Val Cys Ser

740 745 750

Asn Glu Ala Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys

755 760 765

Ser Ile Arg Asp Pro Val Arg Asn Leu His Pro Pro Lys Asp Glu Gly

770 775 780

Pro Lys Gly Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly

785 790 795 800

Ala Ile Leu Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly Phe

805 810 815

Lys Asn Val Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln Gly Pro

820 825 830

<210> 6

<211> 2499

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaagccgc ccggcagcag ctcgcggcag ccgcccctgg cgggctgcag ccttgccggc 60

gcttcctgcg gcccccaacg cggccccgcc ggctcggtgc ctgccagcgc cccggcccgc 120

acgccgccct gccgcctgct tctcgtcctt ctcctgctgc ctccgctcgc cgcctcgtcc 180

cggccccgcg cctggggggc tgctgcgccc agcgctccgc attggaatga aactgcagaa 240

aaaaatttgg gagtcctggc agatgaagac aatacattgc aacagaatag cagcagtaat 300

atcagttaca gcaatgcaat gcagaaagaa atcacactgc cttcaagact catatattac 360

atcaaccaag actcggaaag cccttatcac gttcttgaca caaaggcaag acaccagcaa 420

aaacataata aggctgtcca tctggcccag gcaagcttcc agattgaagc cttcggctcc 480

aaattcattc ttgacctcat actgaacaat ggtttgttgt cttctgatta tgtggagatt 540

cactacgaaa atgggaaacc acagtactct aagggtggag agcactgtta ctaccatgga 600

agcatcagag gcgtcaaaga ctccaaggtg gctctgtcaa cctgcaatgg acttcatggc 660

atgtttgaag atgatacctt cgtgtatatg atagagccac tagagctggt tcatgatgag 720

aaaagcacag gtcgaccaca tataatccag aaaaccttgg caggacagta ttctaagcaa 780

atgaagaatc tcactatgga aagaggtgac cagtggccct ttctctctga attacagtgg 840

ttgaaaagaa ggaagagagc agtgaatcca tcacgtggta tatttgaaga aatgaaatat 900

ttggaactta tgattgttaa tgatcacaaa acgtataaga agcatcgctc ttctcatgca 960

cataccaaca actttgcaaa gtccgtggtc aaccttgtgg attctattta caaggagcag 1020

ctcaacacca gggttgtcct ggtggctgta gagacctgga ctgagaagga tcagattgac 1080

atcaccacca accctgtgca gatgctccat gagttctcaa aataccggca gcgcattaag 1140

cagcatgctg atgctgtgca cctcatctcg cgggtgacat ttcactataa gagaagcagt 1200

ctgagttact ttggaggtgt ctgttctcgc acaagaggag ttggtgtgaa tgagtatggt 1260

cttccaatgg cagtggcaca agtattatcg cagagcctgg ctcaaaacct tggaatccaa 1320

tgggaacctt ctagcagaaa gccaaaatgt gactgcacag aatcctgggg tggctgcatc 1380

atggaggaaa caggggtgtc ccattctcga aaattttcaa agtgcagcat tttggagtat 1440

agagactttt tacagagagg aggtggagcc tgccttttca acaggccaac aaagctattt 1500

gagcccacgg aatgtggaaa tggatacgtg gaagctgggg aggagtgtga ttgtggtttt 1560

catgtggaat gctatggatt atgctgtaag aaatgttccc tctccaacgg ggctcactgc 1620

agcgacgggc cctgctgtaa caatacctca tgtctttttc agccacgagg gtatgaatgc 1680

cgggatgctg tgaacgagtg tgatattact gaatattgta ctggagactc tggtcagtgc 1740

ccaccaaatc ttcataagca agacggatat gcatgcaatc aaaatcaggg ccgctgctac 1800

aatggcgagt gcaagaccag agacaaccag tgtcagtaca tctggggaac aaaggctgca 1860

gggtctgaca agttctgcta tgaaaagctg aatacagaag gcactgagaa gggaaactgc 1920

gggaaggatg gagaccggtg gattcagtgc agcaaacatg atgtgttctg tggattctta 1980

ctctgtacca atcttactcg agctccacgt attggtcaac ttcagggtga gatcattcca 2040

acttccttct accatcaagg ccgggtgatt gactgcagtg gtgcccatgt agttttagat 2100

gatgatacgg atgtgggcta tgtagaagat ggaacgccat gtggcccgtc tatgatgtgt 2160

ttagatcgga agtgcctaca aattcaagcc ctaaatatga gcagctgtcc actcgattcc 2220

aagggtaaag tctgttcggg ccatggggtg tgtagtaatg aagccacctg catttgtgat 2280

ttcacctggg cagggacaga ttgcagtatc cgggatccag ttaggaacct tcaccccccc 2340

aaggatgaag gacccaaggg tcctagtgcc accaatctca taataggctc catcgctggt 2400

gccatcctgg tagcagctat tgtccttggg ggcacaggct ggggatttaa aaatgtcaag 2460

aagagaaggt tcgatcctac tcagcaaggc cccatctga 2499

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atccgctagc cgccaccatg gaatcagaaa gaagcaa 37

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tttatagcgg ccgctgcgct taagtcaact atgaca 36

<210> 9

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atccgctagc cgccaccatg caggcggcag tggctgtgt 39

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tttatagcgg ccgcttaaat ggatgtctcc catagc 36

<210> 11

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atccgctagc cgccaccatg aagccgcccg gcagcagct 39

<210> 12

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tttatagcgg ccgctcagat ggggccttgc tgagta 36

<210> 13

<211> 117

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttatagcgg ccgctcacag caagctccag aaggtagcta ggagtgctgg gaccagggcc 60

aaggtcaccg gggtagcaaa gccagcaccg ttgcatgcgc ttaagtcaac tatgaca 117

<210> 14

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaatatgcgg ccgcatgaag ccgcccggca gcagct 36

<210> 15

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tttatagcgg ccgctcagat ggggccttgc tgagtag 37

Claims

1. A method for immunofluorescence detection of LGI1 for non-diagnostic purposes comprising the steps of:

inserting the DNA fragment for coding LGI1 into an expression vector, and extracting plasmids to obtain LGI1 recombinant expression plasmids;

inserting a DNA fragment for coding ADAM23 into an expression vector, and extracting a plasmid to obtain an ADAM23 recombinant expression plasmid;

transfecting the LGI1 recombinant expression plasmid and the ADAM23 recombinant expression plasmid into cells simultaneously, and performing immunofluorescence staining after the cells are cultured;

the mass ratio of the ADAM23 recombinant expression plasmid to the LGI1 recombinant expression plasmid is 1 to 5-59;

the transfection is PEI transfection;

the amino acid sequence of LGI1 is shown in SEQ ID NO. 1; the amino acid sequence of ADAM23 is shown in SEQ ID NO. 5.

2. The immunofluorescence detection method according to claim 1, wherein the expression vector comprises a eukaryotic vector.

3. The immunofluorescence detection method according to claim 1, wherein the temperature of the cell culture is 37 ℃ for 48 hours.

4. The immunofluorescence detection method according to claim 1, wherein the LGI 1-encoding DNA fragment and the ADAM 23-encoding DNA fragment are each obtained by a PCR amplification method.

5. The immunofluorescence detection method according to claim 1, wherein the volume to mass ratio of the PEI and the LGI1 recombinant expression plasmid is 1 to 2 to 4.