CN114438045A

CN114438045A - Separated dioxygenase and its coding gene and application

Info

Publication number: CN114438045A
Application number: CN202210011773.4A
Authority: CN
Inventors: 高伟; 王家典; 吴晓毅; 王荣凤
Original assignee: Capital Medical University
Current assignee: Capital Medical University
Priority date: 2022-01-06
Filing date: 2022-01-06
Publication date: 2022-05-06
Anticipated expiration: 2042-01-06
Also published as: CN114438045B

Abstract

The invention relates to a separated enzyme, in particular to alpha-ketoglutarate dependent dioxygenase which can catalyze C-2 position hydroxylation of ent-kaurenoic acid to generate 2-hydroxy ent-kaurenoic acid, a gene for coding the enzyme, an expression vector containing the gene and recombinant engineering bacteria containing the expression vector, and can be used for producing 2-hydroxy ent-kaurenoic acid.

Description

Separated dioxygenase and its coding gene and application

Technical Field

The invention relates to a separated alpha-ketoglutarate dependent dioxygenase Tw2ODD5 and a coding gene thereof, which can catalyze the hydroxylation of the C-2 position of ent-kaurenoic acid and belongs to the field of medicinal plant genetic engineering.

Background

Tripterygium wilfordii hook.f. is a plant source of the traditional Chinese medicine Tripterygium wilfordii and has the effects of clearing away heat and toxic materials, dispelling wind and removing dampness, killing parasites and relieving itching, reducing swelling and dissipating stagnation and the like (Gao Wei, Liu Meng Ting, Cheng Qi Qing, and the like. the materia Medica of Tripterygium wilfordii [ J ]. world Chinese medicine 2012,7(6): 560-. Modern researches show that the tripterygium wilfordii can be used for treating rheumatic arthritis, glomerulonephritis, nephrotic syndrome and other diseases. Terpenoids are the main active ingredients of tripterygium wilfordii, and kaurane diterpenes are important components of the tripterygium wilfordii. The development of new drugs from active ingredients of traditional Chinese medicines is a promising approach, but the application of the new drugs is greatly limited due to slow growth of plants and low content of medicinal ingredients. In recent years, the design and modification of microbial strains to produce natural active products by using synthetic biology techniques has become a very potential acquisition method.

Terpenoids are synthesized in higher plants in two major ways, namely, in the cytoplasm of MVA and in plastid of MEP, through which isopentenyl pyrophosphate (IPP), a common precursor of terpenes, and its isomer, dimethylallyl pyrophosphate (DMAPP), are produced; under the catalysis of isopentenyl transferase, GGPP precursor is generated, and then Diterpene synthase (Diterpene synthase) catalyzes to form a Diterpene intermediate mother nucleus structure (Su P., Gao L.H., Liu S., et al., binding the function of protein farnesyl transferase in Tripterygium wilfordii [ J ]. Plant Cell Reports,2019,38(2): 211) 220), and then the mother nucleus generates complex and diverse Diterpene active compounds under the action of post-modification enzymes such as oxidase, methyltransferase, and the like.

Alpha-ketoglutarate-dependent dioxygenases (2-oxogluterate/Fe (II) -dependent dioxygenases,2-ODDs), a class of heme-free mononuclear proteins, require only 2 or 3 ligands for the 2-ODDs reaction compared to cytochrome P450 monooxygenases, and thus have higher flexibility and more diversity and complexity in the reactions catalyzed by them (Farrow and Facchini 2014). 2-ODDs are a large gene family, generally divided into 3 distinct subfamilies according to the BLAST P value of the amino acid sequence, namely DOXA, DOXB and DOXC (Kawai et al 2014), wherein DOXA and DOXB regulate the plant key growth and development processes, such as primary metabolism, posttranslational modification of polypeptide chains and the like, and have high conservation in number and protein sequence. The DOXC subfamily participates in the secondary metabolism of plants, comprises phenolic acids, alkaloids, terpenoids and the like, has larger quantity and function difference in different plants, and has larger species specificity (Kawai and the like 2014). These three types of 2-ODDs are widely present in the plant kingdom and can catalyze hydroxylation, demethylation, ring-opening, desaturation, ring-closing and halogenation reactions (Islam et al 2018).

Zhang-Yi Feng et al successfully identified the first alpha-ketoglutarate dependent dioxygenase TwGA13ox in Tripterygium wilfordii, and in vitro enzymatic studies confirmed that it can catalyze C13 site of gibberellin A9 to be oxidized to generate gibberellin A20. The invention clones an alpha-ketoglutarate dependent dioxygenase gene Tw2ODD5 from tripterygium wilfordii suspension cells. The in vitro enzymatic reaction proves that the alpha-beta-kaurenoic acid has the function of catalyzing the oxidation of the C2 position of ent-kauranoic acid (abbreviated as KA) to generate a corresponding hydroxylation product. The gene is obtained by cloning Tripterygium wilfordii for the first time, and before the invention is published, the Tripterygium wilfordii 2ODD enzyme gene and the amino acid sequence thereof mentioned in the patent application are not disclosed or reported.

Disclosure of Invention

In a first aspect of the invention, there is provided an isolated enzyme involved in the biosynthesis of diterpenoids, particularly kaurane-type diterpenoids such as 2-hydroxy-enantiomeric kaurenoic acid.

In the present invention, the isolated enzyme is a bis-magnesium oxide, in particular an α -ketoglutarate-dependent dioxygenase enzyme (hereinafter referred to as Tw2ODD 5), which is a key enzyme involved in the biosynthesis of kaurane-type diterpenoids, in particular the synthesis of 2-hydroxy-ent-kaurenoic acid, and has the amino acid sequence shown in SEQ ID NO: 2, or SEQ ID NO: 2 by substituting, deleting or adding one or more amino acids, and the functional identical peptides.

Amino acid sequence changes can be made in the Tw2ODD5 enzyme in order to minimize disruption of higher order structures necessary for biological activity. For example, when the Tw2ODD5 enzyme comprises one or more helices, the amino acid residues will be altered so as not to disrupt the geometry of the helix and other molecular components in which the conformational change will attenuate some critical function (e.g., binding of the molecule to its binding partner). The effect of amino acid sequence alterations can be predicted, for example, by computer modeling as disclosed above, or determined by crystal structure analysis (see, e.g., Lapthorn et al, nat. struct. biol.2:266-268, 1995). Other techniques well known in the art compare the folding of altered proteins to standard molecules (e.g., native proteins), e.g., the cysteine distribution in variants and standard molecules can be compared. Mass spectrometry and chemical modification using reduction and alkylation provide methods for determining cysteine residues associated with disulfide bonds or not forming such bonds (Bean et al, anal. biochem.201:216-266, 1992; Gray, Protein Sci.2:1732-1748, 1993; and Patterson et al, anal. chem.66:3727-3732, 1994). It is generally believed that folding is affected if the modified molecule has a different cysteine distribution than the standard molecule. Another accepted well-known method for measuring this is Circular Dichroism (CD). The measurement and comparison of the CD profiles generated by the modified and standard molecules is conventional (Johnson, Proteins 7: 205-. Crystallography is another well-known method for analyzing folding and structure, and Nuclear Magnetic Resonance (NMR), mapping of digestive peptides, and epitope mapping are also known methods for analyzing folding and structural similarity between proteins and polypeptides (Schaanan et al, Science 257: 961-.

In the present invention, the variant forms of the Tw2ODD5 enzyme include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes under high or low stringency conditions to a gene encoding the Tw2ODD5 enzyme.

In a second aspect of the invention, there is provided a polynucleotide encoding an enzyme according to the invention (or an α -ketoglutarate-dependent dioxygenase-encoding gene, hereinafter referred to as Tw2ODD 5), preferably having the sequence as set forth in SEQ ID NO: 1 and degenerate sequences thereof. The degenerate sequence refers to a nucleotide sequence located in SEQ ID NO: 1, a sequence wherein one or more codons have been replaced by degenerate codons encoding the same amino acid. Due to codon degeneracy, compared to SEQ ID NO: 1 nucleotide sequence degenerated sequences with as little as about 70% homology also encode the amino acid sequence shown in SEQ ID NO: 2 to a protease of the invention. Also included are nucleic acid sequences that hybridize to SEQ ID NO: 1, or a nucleotide sequence that hybridizes to the nucleotide sequence of 1. Also included are the sequences substantially identical to SEQ ID NO: 1, preferably at least 70%, more preferably at least 80%, still more preferably at least 90%, and most preferably at least 95%. Also included are SEQ ID NOs: 1 open variations of the reading frame sequence. These variants include, but are not limited to, deletions, insertions and/or substitutions of several (usually 1 to 90, preferably 1 to 60, more preferably 1 to 20, most preferably 1 to 10) nucleotides, and additions of several (usually up to 60, preferably up to 30, more preferably up to 10, most preferably up to 5) nucleotides at the 5 'and/or 3' end.

In the present invention, "Tw2ODD5" refers to α -ketoglutarate-dependent dioxygenase enzyme, and "Tw2ODD5" refers to α -ketoglutarate-dependent dioxygenase encoding gene.

In a third aspect of the invention, there is provided an expression vector comprising a polynucleotide according to the second aspect of the invention, such as an expression vector selected from the group consisting of the pEASY series, and the pET series.

In the present invention, various vectors known in the art, such as commercially available vectors, including plasmids, cosmids, and the like, can be used. In producing the Tw2ODD5 enzyme of the present invention, the nucleotide sequence of the gene encoding the Tw2ODD5 enzyme may be operably linked to an expression regulatory sequence, thereby forming an α -ketoglutarate-dependent dioxygenase expression vector. The term "operably linked" when referring to a segment of DNA means that the segments are arranged in a manner such that they act in concert for their intended purposes, e.g., to initiate transcription in a promoter and proceed through the coding segment to a terminator. Also refers to a condition: i.e., certain portions of a linear DNA sequence can affect the activity of other portions of the same linear DNA sequence, e.g., if a signal peptide DNA is expressed as a prerequisite and involved in the secretion of a polypeptide, then the signal peptide (secretory leader) DNA is operably linked to the polypeptide DNA; a promoter is operably linked to a coding sequence if it controls the transcription of that sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to allow translation. Generally, "operably linked" means adjacent, and for secretory leaders means adjacent in reading frame.

In a fourth aspect of the present invention, there is provided a recombinant host bacterium comprising the polynucleotide of the second aspect of the present invention or the expression vector of the third aspect of the present invention, wherein the host bacterium is Escherichia coli, such as DH5 α strain, BL21(DE3) strain, BL21(DE3) pLysS strain, JM109 strain, HB101 strain, or the like.

The host bacterium comprises the polynucleotide molecule which encodes the Tw2ODD5 enzyme or the variant thereof, or the nucleotide molecule which can be hybridized with the polynucleotide molecule under strict conditions, or the expression vector described in the invention. The host cell is selected from: bacteria, prokaryotic cells (e.g., E.coli), fungal cells, yeast cells, insect cells, mammalian cells, or plant cells, preferably E.coli.

Transformed or transfected host cells are cultured according to conventional methods in a medium containing nutrients and other components necessary for the growth of the selected host cell. A variety of suitable media, including media of known composition and complex media, are known in the art and generally include carbon sources, nitrogen sources, essential amino acids, vitamins and minerals. The medium may also contain components such as growth factors or serum, if desired. The growth medium typically selects for cells containing exogenously added DNA, for example, by drug screening or the absence of essential nutrients that can be supplemented by selectable markers carried by the expression vector or co-transfected into the host cell. The liquid culture is provided with sufficient air by conventional means, such as shaking a flask or fermenter and sparging.

The full-length sequence of the polynucleotide encoding the Tw2ODD5 enzyme or its fragment of the present invention can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods. Furthermore, mutants can also be introduced into the protein sequences of the invention by chemical synthesis. In addition to being produced recombinantly, fragments of the proteins of the invention can be produced by direct peptide Synthesis using Solid Phase techniques (Stewart et al, Solid-Phase peptide Synthesis, J.Am.chem.Soc.85: 2149-. In vitro synthesis of proteins can be performed manually or automatically. For example, peptides can be synthesized automatically using a model 431A peptide synthesizer from Applied Biosystems (Foster City, Calif.). Fragments of the proteins of the invention can be chemically synthesized separately and then chemically linked to produce full-length molecules.

The Tw2ODD5 gene obtained by cloning is used for constructing an expression vector, and a catalytic experiment proves that the expression vector has the biological function of catalyzing the further oxidation of the ent-kaurenoic acid to generate the 2-hydroxy ent-kaurenoic acid.

Therefore, in the fifth aspect of the present invention, there is provided a Tw2ODD5, or a Tw2ODD5 encoding gene Tw2ODD5, or an expression vector comprising the encoding gene Tw2ODD5, and a host bacterium comprising the expression vector, for use in regulating and/or synthesizing diterpenoids.

In the invention, the diterpenoid compound is preferably a kaurane diterpenoid compound, such as 2-hydroxy antipodal kaurenoic acid and the like.

In a sixth aspect of the invention, there is provided a composition comprising an enzyme according to the first aspect of the invention, together with other enzymes required for the synthesis of ent-kaurenoic acid.

In the present invention, the Tw2ODD5 or the Tw2ODD5 gene thereof may be used in combination with other enzymes or genes thereof, and the use may be performed sequentially or simultaneously.

The kaurane diterpenoid compounds of the present invention can also be prepared by a biosynthetic method comprising: the coding gene Tw2ODD5 of the Tw2ODD5 is introduced into escherichia coli to obtain recombinant escherichia coli engineering bacteria, and the recombinant escherichia coli is fermented to obtain abietane diterpenoid compounds, wherein the escherichia coli is escherichia coli DE3 strain.

The biosynthesis method of the kaurane diterpenoid compounds provided by the invention integrates a Tw2ODD5 gene expression cassette into escherichia coli, generates alpha-ketoglutarate dependent dioxygenase through fermentation, and catalytically produces 2-hydroxy ent-kaurenoic acid by taking ent-kaurenoic acid as a substrate. The invention has important theoretical and practical significance for cultivating high-quality medicinal plant varieties, particularly for cultivating tripterygium wilfordii varieties with high 2-hydroxy antipodal kaurenoic acid content.

Alpha-ketoglutarate-dependent dioxygenase

Drawings

FIG. 1 shows the result of Tw2ODD5 catalytic product UPLC/Q-TOF, which is sequentially from top to bottom, empty carrier product, positive carrier product, 2-hydroxy ent-kaurenoic acid standard and ent-kaurenoic acid standard.

FIG. 2 shows the Tw2ODD5 protein purification diagram, the left band is Marker, and the right band is purified protein.

FIG. 3.TwODD5 enzymatic kinetic constants determination, A is 2-hydroxy ent-kaurenoic acid product quantitative standard curve; b is Tw2ODD5 enzyme kinetic curve: the speed of the enzymatic reaction tends to stabilize within a certain range as the substrate concentration increases to 200 mM.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Tripterygium wilfordii hook.f. in the following examples the effect of Tripterygium wilfordii hook.f. over-expression on the biosynthesis of triptolide and tripterine was disclosed in the literature "Wang Jia Dian, Zhao Jun, Zhang Yi Feng, et al. TwHMGR [ J ]. pharmaceutical proceedings, 2018, v.53(08): 37-44", publicly available from molecular crude drug and Chinese medicine resource laboratories, headquarter medical university.

Ent-kauranoic acid (ent-kauranoic acid) in the following examples is a product of Douglas corporation with CAS number 6730-83-2.

Gene JET Gel Extraction Kit, E.Z.N.ATM plasmid mini Kit I Kit was purchased from omega, pEASY-Uni Senfree Cloning and Assembly Kit, 2 × EasyTaq PCR Supermix Kit, pEASY-Blunt Cloning vector Kit, 6 × DNAloading buffer, Transetta (DE3) competent cell, Transns 1-T1 competent cell, Blue

Protein Marker, 6 × Protein Loading Buffer is a product of Beijing Quanjin Biotechnology Limited; phusion High-Fidelity PCR Master Mix with HF Buffer and various endonucleases were purchased from NEB, USA; the plant total RNA extraction kit is purchased from Shanghai Promega biological products, Inc.; the Fast Quant cDNA first strand synthesis kit was purchased from Beijing Tiangen Biotechnology Ltd.

The plasmid pET24a is purchased from Beijing Xinjunji, the vector is connected with the Tw2ODD5 gene of Tripterygium wilfordii after double digestion by BamHI and NotI endonucleases, and is named as pET24a:: Tw2ODD5, which is stored in the laboratories of Chinese medicine resource science and molecular biology and pharmacy of capital medical university, and the specific construction method is described in the reference (Tu L, Su P, Zhang Z, et al genome of Tripterygium wilfordii and identification of cytochrome P450 involved in triptolide biosynthesis [ J ] Nature 2020,11 (1))

Example 1 cloning of the full-Length cDNA sequence of Tripterygium Wilfordii Tw2ODD5

1. Extraction of total RNA of tripterygium wilfordii suspension cell and obtaining of cDNA first chain

And (3) extracting the total RNA of the tripterygium wilfordii suspension cells by using a plant total RNA extraction kit according to the instruction. Total RNA was inverted to cDNA using the Fast QuantcDNA first Strand Synthesis kit as described.

2. Primer design

Obtaining gene ORF sequence fragments through annotation and screening according to tripterygium wilfordii transcriptome data, and designing Tw2ODD5-F and Tw2ODD5-R primers, wherein the primer sequences are as follows:

Tw2ODD5-F：ATGGACCCACCATTACAAGAG

Tw2ODD5-R：TTACACAACAAACCTTTTGAG

PCR amplification

The DNA polymerase used was High Fidelity DNA polymerase (Phusion High-Fidelity PCR Master Mix).

And (3) carrying out PCR amplification by using the cDNA obtained in the step (1) as a template and Tw2ODD5-F and Tw2ODD5-R as primers and adopting PhusionDNA high-fidelity enzyme to obtain a PCR amplification product.

PCR reaction procedure: pre-denaturation at 98 ℃ for 30 s; 10s at 98 ℃,15 s at 60 ℃ and 2min at 72 ℃ for 35 cycles; extension at 72 ℃ for 5 min.

The PCR product was premixed with 6 XDNAloading buffer and applied to a 1.5% agarose gel at low voltage (about 5 Vcm)^-1) Performing electrophoresis for 30-60 min; the gel containing the DNA fragments was cut with a scalpel or razor blade as close as possible to the DNA fragments to reduce the gel content, and the film was placed in a previously weighed 1.5mL centrifuge tube and weighed. The Gel was recovered according to the Gene JET Gel Extraction Kit agarose Gel recovery Kit according to the instructions.

4. Cloning vector chaining

The gel recovery product from the full length cloning was ligated to the cloning vector using the pEASY-Bluntzero cloning vector kit according to the instructions, transformed into Trans1-T1 competent cells, cultured, positive clones identified and sequenced.

The sequencing result shows that: the sequence of the PCR amplification product is shown as sequence 1, the gene shown as sequence 1 is named as Tw2ODD5, the gene encodes a protein consisting of 331 amino acid residues, the protein is named as Tw2ODD5, and the amino acid sequence of the protein is sequence 2. The cloning vector was designated as pEASY-Blunt-Tw2ODD5 plasmid and was stored in a freezer at-20 ℃.

Example 2 biological function study of Tripterygium wilfordii Tw2ODD5

1. Prokaryotic expression vector construction

(1) Preparation of a linearized empty vector:

carrying out double enzyme digestion on pET24a empty vectors reserved in a laboratory by using restriction enzymes BamHI and NotI of NEB company, and cutting gel to recover enzyme digestion products;

(2) preparation of PCR product (Gene of interest):

a vector pEASY-Blunt-Tw2ODD5 plasmid containing the full-length cDNA of the thunder god vine Tw2ODD5 gene is taken as a template, 15-25bp of vector homologous arm sequence (underlined part) is added at the 5' end of a primer, and the gene coding region is amplified by PCR by adopting PhusionDNA high-fidelity enzyme. PCR procedure: 30s at 98 ℃,1 cycle; 10s at 98 ℃,10 s at 60 ℃, 2min at 72 ℃ for 30s, and 35 cycles; 5min at 72 ℃; maintaining the temperature at 4 ℃.

Tw2ODD5-24aBamHI-F:AGCATGACTGGTGGACAGCAAATGGGTCGCATGGACCCACCATTAC

Tw2ODD5-24aNotI-R:TGGTGGTGGTGGTGCTCGAGTGCGGCCACAACAAACCTTTTG

(3) Gel recovery linear vectors and fragments:

the PCR product was premixed with 6 XDNAloading buffer and applied to a 1.5% agarose gel at low voltage (about 5 Vcm)^-1) Performing electrophoresis for 30-60 min; the gel containing the DNA fragment was cut with a scalpel or razor blade as close as possible to the DNA fragment to reduce the gel content, and the film was placed in a previously weighed 1.5mL centrifuge tube and weighed. The Gel was recovered according to the Gene JET Gel Extraction Kit agarose Gel recovery Kit according to the instructions.

(4) Connecting an expression vector:

the linearized vector was gently mixed with the PCR product using the pEASY-Uni Seamless Cloning and Assembly Kit as described in the instructions and reacted at 50 ℃ for 20min in the following system:

the molar ratio of the linearized empty vector to the target gene fragment is 1:2, wherein the linearized empty vector is 0.01-0.02pmols, pmols ═ ng/(fragment length bp × 0.65 kDa);

the ligation product is transformed, preliminarily screened for positive clone, and sent to a sample for sequencing and identification to obtain a recombinant plasmid pET24a with a sequencing nucleotide sequence free of mutation, Tw2ODD 5.

2. Induction of expression of protein of interest

(1) Tw2ODD5 positive monoclonal colony (Escherichia coli DE3 strain) which is transformed into an expression vector is cultured in a shaker at 37 ℃ and 250r/min overnight, then is subjected to scale-up culture according to a percentage to 200mL of liquid culture medium containing 50mg/mL Kana, is shaken at 37 ℃ until the OD600 is about 0.6-0.8, isopropyl thiogalactoside (IPTG) is added until the final concentration is 0.6mM, and is subjected to induced expression for 16 hours at the low temperature of 16 ℃;

(2) the low-temperature induced bacterial solution was centrifuged at 8000g at 4 ℃ for 3min to collect the cells, 5mL of Resuspension buffer (50mM Tris-HCl pH8.0,500mM NaCl) was added to resuspend the cells, sonicated for 5min (5 s sonication, 5s pause), centrifuged at 12000g at 4 ℃ for 10min, and the supernatant was taken as the crude enzyme reaction.

3. Enzymatic reaction

According to the literature reports (Zhang Y, Su P, Wu X, et al. the gibberella 13-oxidase specific convertants gibberella A9 to A20 in Tripterygium wilfordii isa 2-oxogluterate-dependent dioxygenase [ J ] Planta,2019.), the following in vitro enzymatic systems were used:

the system is shaken and mixed evenly, and induced and cultured for 3h at 30 ℃ and 100 rpm.

4. Enzymatic product UPLC/Q-TOF MS detection

The enzymatic reaction system is extracted for 3 times by using equal volume of ethyl acetate, the extract liquor is combined, after being dried by nitrogen, 100 mu L of methanol is added and mixed evenly, and then UPLC/Q-TOFMS is used for detection. UPLC/Q-TOFMS liquid phase conditions: the column was analyzed using a Waters ACQUITY UPLC HSS T3 mobile phase of 0.1% formic acid (A), acetonitrile (B) at a flow rate of 0.4 mL/min. 0 min-5% B, 2 min-15% B, 3 min-15% B, 30 min-90% B. UPLC/Q-TOFMS mass spectrum conditions: and in the negative ion mode, during high-energy scanning, the slope collision energy is set to be 20-40 eV. The MS range of data acquisition is 50-1500 Da.

The enzymatic results are shown in FIG. 1 below, which shows that the blank vector does not have the product 2-hydroxy ent-kaurenoic acid product, while the positive vector contains the product, indicating that Tw2ODD5 has the effect of oxidizing the substrate ent-kaurenoic acid to 2-hydroxy ent-kaurenoic acid.

Example 3 preparation of Tw2ODD5 product and Nuclear magnetic Structure identification

1. Product preparation reaction

(1) Inoculating the positive strains into 100mL LB liquid culture medium (containing 50mg/mL Kana), culturing overnight at 37 ℃ at 250 r/min;

(2) performing amplification culture to 8L according to 1%, performing culture at 37 deg.C 250r/min to OD600 of about 0.6-0.8, adding IPTG to final concentration of 0.6mM, and performing induced expression at 16 deg.C for 16 h;

(3) centrifuging the low-temperature induced bacteria liquid in a high-speed centrifuge for 3min (4 ℃, 10000g) to collect thalli, and removing the culture medium. After washing with distilled water, it was resuspended in 200mL of Resuspension buffer (20mM Tris. HCl, 500mM NaCl, pH 8.0);

(4) crushing at 1200psi for 7min by using an ATS high-pressure homogenizer, centrifuging at low temperature for 15min at 12000g, and collecting supernatant;

(5)200mL of supernatant is added with sodium ascorbate, alpha-ketoglutarate sodium and FeSO4 & 7H in moderate proportion₂O and a substrate enantiomer-kaurenoic acid react at 30 ℃ and 100rpm/min for 12 h.

(6) The reaction solution was extracted 3 times with an equal volume of ethyl acetate, the supernatants were combined and spun dry, and the product was dissolved in 10mL of methanol. After passing through a filter membrane of 0.22 mu m, the reaction product is obtained by preparing a liquid phase by sample injection.

(7) Preparative liquid chromatography conditions

The separation was carried out using Agilent 1260, column chromatography using YMC-Triart C18 (250X 10mm, 5 μm) semi-preparative column with water (A), acetonitrile (B) as mobile phase at a flow rate of 5 mL/min. 0 min-5% of B, 2 min-30% of B and 35 min-100% of B, collecting target fractions and concentrating to obtain the prepared product.

(8) Dissolving the obtained reaction product in deuterated acetone to final concentration of 6mg/mL, and performing nuclear magnetic detection with 800M¹H NMR、¹³C NMR spectrum.

¹H-NMR Spectrum (C)₃D₆O-d₄800MHz) the results were as follows: δ 0.72(1H, t, J ═ 11.9Hz),0.95(1H, t, J ═ 11.9Hz),1.00(3H, s),1.09(1H, m),1.14(1H, d, J ═ 3.7Hz),1.14(1H, m),1.26(3H, s),1.50(1H, m),1.54(1H, m),1.66(2H, m),1.87(2H, m),2.02(1H, m),2.09(1H, m),2.20(1H, m),2.41(1H, m),2.63(1H, m),4.08(1H, m),4.74(1H, s),4.81(1H, s).

¹³C-NMR Spectrum (C)₃D₆O-d₄800MHz) the results were as follows: δ 16.4,18.3,21.6,28.4,32.9,39.5,40.7,41.1,43.7,44,44.2,47.1,48.7,49.9,54.9,56.1,62.9,102.8,155.3,178.

Example 4 Tw2ODD5 protein purification and enzyme kinetic parameter determination

Tw2ODD5 protein purification

(1) 2L of positive strains are fermented, the specific operation is the same as that of the embodiments 2 and 3, after protein is induced, the obtained crude enzyme supernatant passes through a Ni column (the front end of the Ni column is connected with a flow pump, and the rear end of the Ni column is connected with an ultraviolet detector), the sample loading is repeated for 3 times, and the full combination of the protein and the Ni is ensured;

(2) preparing Tris-HCl buffer solution (pH8.0) containing imidazole with different concentrations and 500mM NaCl, respectively eluting Ni columns according to the sequence of the imidazole concentration from low to high, running SDS-PAGE protein gel on the eluates with imidazole with different concentrations, and purifying to obtain the target protein, wherein the purified protein is a band with the molecular weight of about 40kDa, namely the target protein Tw2ODD5, as shown in figure 2.

TwODD5 enzymatic kinetic constant determination

(1) Concentrating the purified protein by using a Resuspension buffer, and determining the protein concentration by using NanodropOne to be 8 mg/mL;

(2) different concentrations of substrate were used for the reactions in the following systems:

after reacting for 2h at 25 ℃, adding equal volume of glacial methanol to terminate the reaction, detecting the product by using UPLC/QQQ MS, preparing a standard curve and quantifying. UPLC/QQQ MS liquid phase conditions: the column was analyzed using a Waters ACQUITY UPLC HSS T3 mobile phase of 0.1% formic acid (A), acetonitrile (B) at a flow rate of 0.4 mL/min. 0 min-50% of B, 2 min-50% of B and 5 min-90% of B. UPLC/Q-TOFMS mass spectrum conditions: in the negative ion mode, the parent ion was set at 317.00 and the daughter ion was set at 255.10, 271.10. The results of the quantitative post-treatment are shown in FIG. 3. the results in FIG. 3 show that the linear relationship is good within a certain range, the enzymatic reaction speed increases with the substrate concentration, and the enzymatic reaction speed tends to be stable when the substrate concentration reaches 200 nM.

Sequence listing

<110> university of capital medical science

<120> isolated dioxygenase, and coding gene and application thereof

<130> TQZX2022-ZL005

<141> 2022-01-06

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 993

<212> DNA

<213> Tripterygium wilfordii (Tripterygium wilfordii)

<400> 1

atggacccac cattacaaga gaggtacaag actctcttcg ctaactccac caaagaatta 60

aaatccaaga cagctgataa taacaacaac aacaaagaca tcatcgacga atgcgagctt 120

ccattgattg atcttggccg tctaattagc cttgatgaga aggagaaaga tggttgcaag 180

gaagagatag ctagggcttc aaaggactgg ggattctttc aagtcataaa tcatgcgatt 240

tcaagagaga ttttggagaa attgagatgt gaacaagtga aagtctttaa gcaaccgttc 300

aataagaagc accagagttt ctccgctggg agctaccgtt gggggacacc tacagccact 360

tgtctcaggc agctgtcttg gtctgaagct tttcacattc ctttgactga tatttctaac 420

ccagctggac tcactaatct cagttcaaca atggtgcaat ttgccacaac agttgctgct 480

ctagctcaaa acctagcaga aattttggca gagaaattgg gttgcaagtc gagttttttc 540

gaggaaaatt gtttgcctag cagttgctat ctgcgaatga accgataccc aacatgccca 600

atttcatcag atgcatttgg gctgacacca catactgata gtgattttct cacaattttg 660

caccaagacc aagtcggtgg attgcaacta gttaaagatg gtaaatggtt cgcagtaaaa 720

cctaatcccg atgctctcat agtcaacatt ggtgacttat tccaggcttg gagcaatgat 780

gtttataaga gtgttgaaca tcgtgttgtc accaatccaa aagtggagag attttctacc 840

gcatatttcc tctgtccttc atacgacacc gttgtagaga gtttttgtga gccttccctt 900

tataagaaat ttagctttag agaatataga cggcaggtcc aagaagatgt tcaaactatg 960

ggttataaag taggtctcaa aaggtttgtt gtg 993

<210> 2

<211> 331

<212> PRT

<213> Tripterygium wilfordii (Tripterygium wilfordii)

<400> 2

Met Asp Pro Pro Leu Gln Glu Arg Tyr Lys Thr Leu Phe Ala Asn Ser

1 5 10 15

Thr Lys Glu Leu Lys Ser Lys Thr Ala Asp Asn Asn Asn Asn Asn Lys

20 25 30

Asp Ile Ile Asp Glu Cys Glu Leu Pro Leu Ile Asp Leu Gly Arg Leu

35 40 45

Ile Ser Leu Asp Glu Lys Glu Lys Asp Gly Cys Lys Glu Glu Ile Ala

50 55 60

Arg Ala Ser Lys Asp Trp Gly Phe Phe Gln Val Ile Asn His Ala Ile

65 70 75 80

Ser Arg Glu Ile Leu Glu Lys Leu Arg Cys Glu Gln Val Lys Val Phe

85 90 95

Lys Gln Pro Phe Asn Lys Lys His Gln Ser Phe Ser Ala Gly Ser Tyr

100 105 110

Arg Trp Gly Thr Pro Thr Ala Thr Cys Leu Arg Gln Leu Ser Trp Ser

115 120 125

Glu Ala Phe His Ile Pro Leu Thr Asp Ile Ser Asn Pro Ala Gly Leu

130 135 140

Thr Asn Leu Ser Ser Thr Met Val Gln Phe Ala Thr Thr Val Ala Ala

145 150 155 160

Leu Ala Gln Asn Leu Ala Glu Ile Leu Ala Glu Lys Leu Gly Cys Lys

165 170 175

Ser Ser Phe Phe Glu Glu Asn Cys Leu Pro Ser Ser Cys Tyr Leu Arg

180 185 190

Met Asn Arg Tyr Pro Thr Cys Pro Ile Ser Ser Asp Ala Phe Gly Leu

195 200 205

Thr Pro His Thr Asp Ser Asp Phe Leu Thr Ile Leu His Gln Asp Gln

210 215 220

Val Gly Gly Leu Gln Leu Val Lys Asp Gly Lys Trp Phe Ala Val Lys

225 230 235 240

Pro Asn Pro Asp Ala Leu Ile Val Asn Ile Gly Asp Leu Phe Gln Ala

245 250 255

Trp Ser Asn Asp Val Tyr Lys Ser Val Glu His Arg Val Val Thr Asn

260 265 270

Pro Lys Val Glu Arg Phe Ser Thr Ala Tyr Phe Leu Cys Pro Ser Tyr

275 280 285

Asp Thr Val Val Glu Ser Phe Cys Glu Pro Ser Leu Tyr Lys Lys Phe

290 295 300

Ser Phe Arg Glu Tyr Arg Arg Gln Val Gln Glu Asp Val Gln Thr Met

305 310 315 320

Gly Tyr Lys Val Gly Leu Lys Arg Phe Val Val

325 330

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 3

atggacccac cattacaaga g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 4

ttacacaaca aaccttttga g 21

<210> 5

<211> 46

<212> DNA

<213> Artificial Sequence

<400> 5

agcatgactg gtggacagca aatgggtcgc atggacccac cattac 46

<210> 6

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 6

tggtggtggt ggtgctcgag tgcggccaca acaaaccttt tg 42

Claims

1. An isolated enzyme having the amino acid sequence set forth in SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

2. A polynucleotide encoding the enzyme of claim 1.

3. The polynucleotide of claim 2, wherein the polynucleotide has the sequence set forth in SEQ ID NO: 1.

4. An expression vector comprising the polynucleotide of claim 2 or 3.

5. A recombinant host bacterium comprising the polynucleotide of claim 2 or 3, or the expression vector of claim 4.

6. The recombinant host bacterium of claim 5, wherein the host bacterium is Escherichia coli.

7. Use of the enzyme of claim 1, or the polynucleotide of claim 2 or 3, or the expression vector of claim 4, or the recombinant host bacterium of claim 5 or 6 for modulating and/or synthesizing kaurane-type diterpenoids.

8. The use as claimed in claim 7, wherein the kaurane-type diterpenoid is 2-hydroxy-enantiokaurenic acid.

9. A composition comprising the enzyme of claim 1.

10. A method of preparing 2-hydroxy ent-kaurenoic acid comprising:

(1) inserting a gene expression cassette for the enzyme of claim 1 into an expression vector, and inserting the expression vector into DE3 strain to prepare a recombinant Escherichia coli expressing the enzyme;

(2) feeding the recombinant coliform expressing the enzyme obtained in the step (1) by taking the ent-kaurenoic acid as a substrate to prepare the 2-hydroxy ent-kaurenoic acid.