CN114410847A

CN114410847A - Legionella pneumophila and dengue fever nucleic acid quantitative combined detection reagent

Info

Publication number: CN114410847A
Application number: CN202210208130.9A
Authority: CN
Inventors: 顾兵; 胡雪姣; 邓倩昀; 王子霞; 李广华; 李正康; 龚彩平; 刘长鈺; 赵云虎; 张鑫强
Original assignee: Guangdong General Hospital
Current assignee: Guangdong General Hospital
Priority date: 2022-03-03
Filing date: 2022-03-03
Publication date: 2022-04-29

Abstract

The invention relates to the technical field of pathogen detection, in particular to a legionella pneumophila and dengue fever nucleic acid quantitative combined detection reagent. The invention provides ddPCR detection primers and probes for dengue fever and legionella pneumophila, and the primers and the probes have high specificity; the sensitivity is strong, the detection can be carried out as low as 20copies/mL, and false negative possibly occurring in fluorescence quantification is avoided; 4 detection channels and an internal control channel are simultaneously carried out, so that the pollution possibly caused by sample adding is reduced; simultaneously, various pathogens are detected, so that the workload is reduced, and the detection efficiency is improved; absolute quantification was achieved in the droplets without the need for a standard curve.

Description

Legionella pneumophila and dengue fever nucleic acid quantitative combined detection reagent

Technical Field

The invention relates to the technical field of pathogen detection, in particular to a legionella pneumophila and dengue fever nucleic acid quantitative combined detection reagent.

Background

The subtropical regions have humid climate, numerous water systems and breeding of mosquitoes, so the entomophilous infectious disease is high, and the dengue fever is most popular; on the other hand, due to the popularization and the perennial use of air conditioners, air conditioner condensate water also becomes one of important factors for disease transmission, and legionella pneumophila is particularly common.

(1) Dengue fever virus

Dengue is the most prevalent and most harmful arboborne infectious disease next to malaria worldwide and is one of the major causes of fever for travelers to tropical and subtropical regions. In addition to the absence of dengue epidemics in regions of africa south of sahara, there is an endemic or endemic dengue epidemic in the world's regions of the six world health organization, and global development is an important factor that contributes to the widespread worldwide spread of imported dengue. Currently, more than 50% of the world population faces the threat of invasive dengue infection, with approximately 50% residing in dengue endemic regions.

The most predominant vector for the transmission of dengue fever is the aedes aegypti (a. aegypti), followed by aedes albopictus (a. albopictus). Aedes mosquitoes infected with dengue virus can pass the virus to the next generation via eggs; and the offspring male mosquitoes of the dengue fever virus obtained by egg transfer can be continuously transferred to female mosquitoes through mating. In areas with aedes activity, dengue fever may be spread in people after biting and blood sucking of dengue fever patients, and a second generation infection epidemic is generated.

The dengue virus (DENV) types are four, type I, type II, type III and type IV, infection with any of these types produces lifelong specific immunity to the type, and any of these types of virus can cause dengue outbreaks and severe cases to develop clinical symptoms of dengue infection, which are often confused with other febrile illnesses. The typical case patient has latent stage, raised fever, lasting for 2-7 days, and muscular soreness, arthralgia, anorexia, sore throat, headache, skin macula hemorrhage, etc. Secondary infection with dengue (due to antibody-dependent potentiation) or infection with a virulent strain is two major life-threatening factors. Thrombocytopenia and increased vascular permeability in severe cases can lead to complications such as bleeding and shock.

The rapid case examination is used for confirming the diagnosis, and the clinical treatment including intravenous fluid infusion and the like can reduce the death rate of severe patients to below 1 percent. To date, dengue fever has not been prevented by vaccines and treated by specific antiviral drugs, and the actual prevention of dengue fever epidemic also lies in mosquito prevention and killing, however, practice shows that the prevention and control effect is limited. Only if the disease is diagnosed as early as possible, the early report, the early isolation and the early in-situ treatment can be carried out on the acute stage patient, and the mosquito killer can be carried out in time, so that the control of the dengue epidemic situation is facilitated.

The rapid detection of the dengue virus mainly comprises antibody detection, antigen detection, nucleic acid detection and virus separation. The case specimens collected in dengue tests are generally dominated by blood because blood is collected and handled most conveniently during specimen collection, with minimal trauma and damage to the patient, and is available for testing during almost the entire infection period. However, cross reaction exists between the dengue virus antibody and other flavivirus antibodies, and Japanese encephalitis preventive vaccination is used as part of planned immunization in China, so that non-specific reaction needs to be noticed in the detection process, and positive antibody results are distinguished by combining clinical symptoms and epidemiological history of patients. Antigen detection is to detect virus proteins, mainly aiming at the non-structural protein NS1 at present, NS1 is generated in the early stage of infection and even occurs earlier than IgM, is suitable for early diagnosis, but cannot be detected after anti-NS 1-IgG occurs. However, in secondary infection, NS1 quickly formed an antigen-antibody immune complex with the antibody due to the presence of IgG, making NS1 difficult to detect. Because of the long time for separating dengue virus and the high requirement for sample, and the development of nucleic acid detection technology, the clinical detection has been gradually replaced by nucleic acid detection. The nucleic acid detection is mainly based on the dengue virus gene sequence design specificity primer, in appropriate reaction system and conditions for amplification, finally using the instrument equipment for detection judgment. Since different serotypes of dengue viruses have different gene sequences, the serotypes of dengue viruses can be distinguished by nucleic acid detection. Compared with virus separation, the nucleic acid detection has short reaction time, strong specificity and high sensitivity. Nucleic acid detection sensitivity is high and care must be taken in handling to avoid false positives due to contamination. Monitoring in dengue outbreaks and epidemics tends to select methods that have high specificity, high throughput, enable the discovery of patients in the early stages of the epidemic and the determination of the serotype of the circulating strain.

(2) Legionella pneumophila

Legionella infection can cause legionnaires' disease, which is frequently seen in summer and autumn, the incubation period is generally 2-10 days, and the main susceptible people include smokers, HIV/AIDS-induced immunodeficiency patients, immunity such as transplantation and the like, chronic lung disease patients, centralized air-conditioning cooling tower maintainers and the like. Legionella pneumonia is the main type of legionnaires' disease, not only seen in community-acquired pneumonia, but also one of the important causes of nosocomial infections, which has been included by the WHO in the infectious disease report. Rapid laboratory diagnosis is critical as signs and symptoms are non-specific and legionellosis may be difficult to diagnose. In recent years, legionella contamination in water systems in many public places has become a major public health problem in the development of modern cities.

Legionella pneumophila is a facultative intracellular pathogen, widely exists in natural freshwater environment or artificial waters, and is an important pathogen causing legionella pneumonia. Epidemiological investigation shows that legionella pneumonia is not rare in China and accounts for about 4-5.1% of community-acquired pneumonia. Because legionella pneumophila has long growth period and strict nutrient requirement, the traditional bacteria isolation culture method has complicated operation and low positive detection rate, is not beneficial to the sanitary monitoring of public environment, and is not convenient for clinical popularization and application. Legionella pneumophila has 16 serotypes, and data are shown to be most common in countries such as europe and america as LP 1. China currently has no large sample epidemiological data on legionella serotyping. Because legionella pneumophila is difficult to culture and limited in antigen detection, clinical diagnosis is easy to miss. Reliable pathogenic evidence is beneficial to more accurate drug selection, so the pathogenic evidence has great clinical significance.

From the discovery of legionella pneumophila to the 90 s of the 20 th century, most laboratory-used detection methods were bacterial culture and serological detection. Although the bacterial culture method is a gold standard for detecting legionella pneumophila, the culture time is long, the culture medium is expensive, and experimenters are required to be skilled, so that the legionellosis diagnosis rate is low and the legionella is high in mortality. The serological detection method mainly detects IgG antibodies and has hysteresis, so that the serological diagnosis lacks early diagnosis significance. Among many laboratory tests, the test of urine antigen is a relatively ideal test method, but because the majority of the antibodies captured by the method are LP1, the method can only be used for testing the urine antigen of patients infected with LP 1. In future research, if the detection of the urine antigen can also detect other serotypes at the same time, the detection method is a great progress. The PCR detection procedure is standardized to improve the sensitivity and specificity of the detection method. Meanwhile, the research of the domestic kit is increased to reduce the experiment cost, and the detection level of the whole laboratory is greatly improved.

(3) Nucleic acid detection techniques

Because dengue fever and legionnaire's disease lack typical clinical manifestations and are difficult to identify with fever and pneumonia caused by other pathogens, it is very important to adopt a specific, sensitive and rapid detection method. Common methods for nucleic acid detection include nucleic acid hybridization detection (hy-hybridization), reverse transcription-polymerase chain reaction detection (RT-PCR), real-time fluorescence quantitative reverse transcription-polymerase chain reaction detection (RT-qPCR), gene chip (gene chip), and nucleic acid isothermal amplification (NASBA). The principle of nucleic acid hybridization detection is that double-stranded nucleic acid molecules are untied under the action of certain physicochemical factors, and after the conditions are recovered, a double-stranded structure can be formed according to the base pairing rule. Hybridization is usually carried out on a support membrane and is therefore also called nucleic acid blot hybridization, but since this method is cumbersome and time-consuming, it is not used for nucleic acid detection of pathogens at all. In the current clinical detection, RT-PCR and RT-qPCR are the most commonly used, and in the RT-PCR detection, the result can be observed in real time by designing specific primers for different sites of pathogen nucleic acid for fragment amplification, but the sensitivity and the flux are limited compared with the RT-PCR. NASBA is a method in which nucleic acid is amplified under isothermal conditions and the amplified product is detected by probe hybridization using an electroluminescent device, but when the content of a target gene is low, the technique is susceptible to various factors such as false negative and false positive (e.g., matrix-related inhibitors).

The principle of ddPCR is to microdroplet the sample before PCR amplification, i.e., to divide the reaction system containing nucleic acid molecules into thousands of nanoliters, each of which contains either no nucleic acid target molecules to be detected or one to several nucleic acid target molecules to be detected. After PCR amplification, each microdroplet is detected one by one, the microdroplet with a fluorescent signal is judged to be 1, the microdroplet without the fluorescent signal is judged to be 0, and the initial copy number or the concentration of the target molecule can be obtained according to the Poisson distribution principle and the number and the proportion of the positive microdroplets. Because ddPCR has very high sensitivity and only needs a small amount of templates, the method is particularly suitable for trace samples to be detected which are not easy to obtain; the defects that a fluorescent quantitative PCR system is difficult to accurately determine the gene copy number, cannot qualitatively and quantitatively determine the trace mutation, has low accuracy and the like are overcome. The requirement of more clinical examinations is satisfied, and the method is more accurate and more digital. Is very suitable for the accurate detection of nucleic acid in some rare samples. Overcomes the defects of high cost, limited flux, complex flow, low accuracy and the like of the traditional PCR system. The use is flexible, and the flux and the sensitivity can be adjusted according to the experiment requirement. However, although ddPCR is more accurate in identifying samples, the requirement for primers is higher, and the influence of the probe on the template is more concerned when performing multiplex detection.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide a reagent for the combined detection of dengue fever and legionella pneumophila based on ddPCR method.

The present invention provides a primer probe combination comprising:

dengue virus detection primers, probes:

the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1;

the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2;

the nucleic acid sequence of the probe is shown as SEQ ID NO. 3;

legionella pneumophila detection primers and probes:

the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 4;

the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 5;

the nucleic acid sequence of the probe is shown as SEQ ID NO. 6.

The invention designs a primer and a probe aiming at the sequence of the conserved region of dengue fever and legionella pneumophila, wherein,

the conserved sequences of dengue viruses are: cttgagtaaactgtgcagcctgtagctccacctgaggaggtgtaaaaaacccgggaggccacaaaccatggaagctgtacgcatggcgtagtggactagcggttagaggagacccctcccttacaaatcgcagcaacaacgggggcccaaggtgagatgaagctgtagtctcactggaaggactagaggttagaggagacccccccaaaacaaaaaacagcatattgacgctgggaaagaccagagatcctgctgtctcctcagcatcattccaggcacagaacgccagaaaatggaatggtgctgttgaatcaacaggttct are provided.

The conserved sequence of legionella pneumophila is: ccagcaatgccgcgtgtgtgaagaaggcctgagggttgtaaagcactttcagtggggaggagggttgataggttaagagctgattaactggacgttacccacagaagaagcaccggctaactccgtgccagcagccgcggtaatacggagggtgcgagcgttaatcggaattactgggcgtaaagggtgcgtaggtggttgattaagttatctgtgaaattcctgggcttaacctgggacggtcagataatactggttgactcgagtatgggagagggtagtggaatttccggtgtagcggtgaaatgcgtagagatcggaaggaacaccagtggcgaaggcggctacctggcctaatactgacactgaggcacgaaagcgtggggagcaaacaggattagataccctggtagtccacgctgtaaacgatgtcaactagctgttggttatatgaaaataattagtggcgcagcaaacgcgataagttgaccgcctggggagtacggtcgcaagattaaaa are provided.

The primer probe combination provided by the invention is designed aiming at the conserved sequence. The primer probe combination can more accurately detect pathogenic bacteria, and the two probes are not interfered with each other, so that the detection is effectively prevented from generating false positive on the basis of good sensitivity, and the accuracy is good.

In the embodiment of the invention, the 5 'end of a probe of a nucleic acid sequence shown as SEQ ID NO. 3 is modified with FAM group, and the 3' end is modified with MGB group;

in the embodiment of the invention, the 5 'end of the probe of the nucleic acid sequence shown as SEQ ID NO. 6 is modified with a VIC group, and the 3' end is modified with an MGB group.

The invention also provides a combined detection reagent for dengue fever and legionella pneumophila, which comprises the primer probe combination.

The joint detection reagent also comprises a ddPCR reaction reagent. In some embodiments, the joint detection reagent further comprises a pretreatment reagent. The pretreatment reagent comprises a DNA extraction reagent. In particular cfDNA.

The joint inspection reagent also comprises an internal reference gene detection primer probe; the reference gene is SMYD 3. The nucleic acid sequences of the detection primers and the detection probes are as follows:

IC-F：cggaaaggtaacccaggtaaa；

IC-R：attactcttaacttttaagccgggag；

IC-P：A425-acacacactctctctc-MGB。

the probe was labeled with A425 for internal control.

The invention also provides a method for detecting dengue fever and legionella pneumophila, which detects a sample by using the joint detection reagent.

The detection system comprises:

0.15 mu L of each upstream and downstream primer for detecting dengue viruses, 0.0375 mu L of dengue virus detection probe, 0.15 mu L of each upstream and downstream primer for detecting legionella pneumophila, 3 mu L of reaction reagent for detecting legionella pneumophila, 3-7 mu L of sample to be detected and 15 mu L of water for complementation.

The amplification program of the detection of the invention comprises:

5min at 95 ℃ (15 s at 95 ℃ and 30s at 56-62 ℃) for 40 cycles.

In some embodiments of the invention, the detection is for non-diagnostic purposes, such as detection of environmental samples or detection of food, pharmaceuticals, and the like. For example, the sample includes a sample from an environment, including a water sample, a soil sample, or a swab on a surface of an object. In the present invention, the sample is cfDNA before detection.

The invention provides ddPCR detection primers and probes for dengue fever and legionella pneumophila, and the primers and the probes have high specificity; the sensitivity is strong, the detection can be carried out as low as 20copies/mL, and false negative possibly occurring in fluorescence quantification is avoided; 4 detection channels and an internal control channel are simultaneously carried out, so that the pollution possibly caused by sample adding is reduced; simultaneously, various pathogens are detected, so that the workload is reduced, and the detection efficiency is improved; absolute quantification was achieved in the droplets without the need for a standard curve.

Drawings

FIG. 1 shows a two-dimensional graph of the detection of dengue virus in a blood sample; wherein the abscissa is A425 (internal reference), the ordinate is FAM (dengue virus), the left droplet is negative, purple-A425 internal reference, light blue-dengue virus, upper right dark blue-internal reference and dengue positive droplet;

FIG. 2 shows a two-dimensional graph of a blood sample showing positive detection of Legionella pneumophila; wherein the abscissa is A425 (internal reference), the ordinate is VIC (legionella pneumophila), the gray scattered spots are negative droplets, the purple is A425 internal reference, the green is legionella pneumophila, and the upper right corner is droplets with positive internal reference and legionella pneumophila;

FIG. 3 shows a negative quality control one-dimensional graph VIC;

FIG. 4 shows a negative quality control one-dimensional map FAM;

FIG. 5 shows a negative quality control one-dimensional FAM of comparative example primer probe; detecting negative controls of DENV-F2, DENV-R2 and DENV-P2, and generating false positive;

FIG. 6 shows a negative quality control one-dimensional graph VIC of the comparative example primer probe; and the negative controls of the detection of the Lpneu-mip-F2, Lpneu-mip-R2 and Lpneu-mip-P2 show false positive.

Detailed Description

The invention provides a reagent for combined detection of dengue fever and legionella pneumophila, and a person skilled in the art can use the content for reference and appropriately modify the process parameters to realize the detection. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

examples

1. Sample (I)

1.1 nucleic acids of the mock sample: the target gene of legionella pneumophila is synthesized by biological companies, and is diluted by 100 times after DNA powder is dissolved, and is frozen by 500 times for standby.

1.2 internal control genes: a425 labels the internal control (synthetic DNA fragment).

1.3 based on the sequence of conserved regions of dengue fever and Legionella pneumophila, primers and probes are designed as shown in the following table, wherein a dengue fever virus (DENV) probe is marked by FAM, a Legionella pneumophila (Lpneu) probe is marked by VIC, and an internal reference probe is marked by A425.

TABLE 1 primers and probes for detection of dengue virus and legionella pneumophila

1.4 pathogen pure culture, namely artificially synthesized dengue fever virus oligo dT sequence, legionella pneumophilia cultured by a microorganism room of the clinical laboratory of the national hospital of Guangdong province under proper conditions, extracting total DNA by a DNA extraction kit, and freezing for later use.

1.5 clinical samples: plasma samples of suspected dengue patients and legionella pneumophila pneumonia patients were frozen for use.

2. Extraction of

(1) Extracting cfDNA by adopting a nucleic acid extraction and purification kit of a pilot gene after centrifuging to obtain blood plasma, and adding a synthesized DNA fragment (internal reference) for quality control during extraction;

(2) extracting ddH₂And O, performing quality control.

3. A detection system:

dengue virus is FAM mark, legionella pneumophila is VIC mark, and internal reference is A425 mark

TABLE 2 ddPCR detection System

4. Amplification conditions: 5min at 95 deg.C, [ 15s at 95 deg.C, 30s at 56-62 deg.C ] x 40 cycles.

5. The result of the detection

The internal reference is normally extracted and amplified, dengue fever virus and legionella pneumophila are detected in a blood sample, no dengue fever virus and legionella pneumophila are detected in control water, the specific copy number is shown in a table 3, and a scatter diagram is shown in figures 1-4:

TABLE 3 test results

Blood sample	Concentration (copies/. mu.l)	A425 concentration (copies/. mu.l)
			Dengue fever virus	291.1	325.44
Legionella pneumophila	78.4	100.22
			Water (W)	0	147.434

Comparative example

As a control, DNA extracted from human serum (negative control) of healthy humans and inactivated serum (experimental group) of humans mixed with dengue virus and legionella pneumophila strain were tested separately using another set of primer probes eliminated in the experiment. The procedure was as described in example 1, and the results are shown in Table 4:

TABLE 4 control primers and probes

Gene name-sequence name	Sequence of
		DENV-F2	cgggaaaaccgtctatcaatatgc
DENV-R2	tgagaatctcttcgccaactgtg
		DENV-P2	FAM-aacgcgtgagaaaccgtgtgtcaactg-BHQ2
Lpneu-mip-F2	gcaatgtcaacagcaa
		Lpneu-mip-R2	catagcgtcttgcatg
Lpneu-mip-P2	VIC-caacttatccttgtctgtagct-MGB

The detected scatter diagrams are shown in FIGS. 5-6, and the results show that false positives appear in the primer probe group in the test, but the primer probe sequence described in example 1 does not appear in the test, so that the primer probe group is excluded, and the primer probe sequence claimed by the invention also shows that the primer probe sequence has good specificity.

Comparative experiment (sensitivity)

1, sample: DNA extracted from the aforementioned human serum of healthy persons (control group) and inactivated human serum mixed with dengue virus and legionella pneumophila (experimental group) used for the specificity control experiment. The negative control and experimental group DNAs were diluted 2-fold, 4-fold, 8-fold, 16-fold, 32-fold, and 64-fold, respectively. The original concentration control group is used as the negative control of the experiment, and the original concentration experiment group is used as the positive control of the experiment.

2 detection method

The first method is a method for designing a double-primer probe matched ddPCR detection method in the embodiment 1, and the second method is a fluorescent quantitative PCR detection method for respectively detecting dengue fever virus and legionella pneumophila.

3 detection System

ddPCR detection System: dengue virus is FAM marker, legionella pneumophila is VIC marker, internal reference is A425 marker:

TABLE 5 ddPCR detection System

Amplification conditions: 5min at 95 deg.C, [ 15s at 95 deg.C, 30s at 56-62 deg.C ] x 40 cycles.

Table 6 fluorescent quantitative PCR assay system for dengue virus:

amplification conditions: 30s at 95 deg.C [ 10s at 95 deg.C, 30s at 56-62 deg.C ] x 42 cycles.

Table 7 legionella pneumophila fluorescent quantitative PCR reaction system:

composition of	Content/. mu.l
		2×mix	10
Lpneu-F(10μM)	0.4
		Lpneu-R(10μM)	0.4
DNA	5
		Water (W)	Complement 20

4 results of detection

TABLE 8 test results

The experimental results show that the detection method can detect lower copy number under the condition of the same trace virus and thallus DNA concentration, and compared with the conventional fluorescent quantitative PCR, the method can detect the positive of 20 copies/mu L, which indicates that the method has better detection sensitivity.

5 conclusion

The primer probe of the invention has high specificity; the sensitivity is strong, the detection can be carried out as low as 20copies/mL, and false negative possibly occurring in fluorescence quantification is avoided; 4 detection channels and an internal control channel are simultaneously carried out, so that the pollution possibly caused by sample adding is reduced; simultaneously, various pathogens are detected, so that the workload is reduced, and the detection efficiency is improved; absolute quantification was achieved in the droplets without the need for a standard curve.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Guangdong province people hospital

<120> reagent for quantitative combined detection of legionella pneumophila and dengue fever nucleic acid

<130> MP21034401

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

garagaccag agatcctgct gtct 24

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

accattccat tttctggcgt t 21

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agcatcattc caggcac 17

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccactaccct ctcccatact cg 22

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtgcgtagg tggttgatta agt 23

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctgaccgtcc caggtt 16

Claims

1. A primer probe combination, comprising:

dengue virus detection primers, probes:

the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 1;

the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 2;

the nucleic acid sequence of the probe is shown as SEQ ID NO. 3;

legionella pneumophila detection primers and probes:

the nucleic acid sequence of the upstream primer is shown as SEQ ID NO. 4;

the nucleic acid sequence of the downstream primer is shown as SEQ ID NO. 5;

the nucleic acid sequence of the probe is shown as SEQ ID NO. 6.

2. The primer-probe combination according to claim 1,

3, modifying FAM group at the 5 'end of the probe of the nucleic acid sequence shown as SEQ ID NO. 3, and modifying MGB group at the 3' end;

the 5 'end of the probe of the nucleic acid sequence shown as SEQ ID NO. 6 is modified with a VIC group, and the 3' end is modified with an MGB group.

3. A reagent for the combined detection of dengue fever and legionella pneumophila, comprising the primer probe combination of claim 1 or 2.

4. The joint detection reagent of claim 3, further comprising a ddPCR reaction reagent.

5. The joint detection reagent of claim 3, further comprising an internal reference gene detection primer probe; the reference gene is SMYD3, and the probe of the reference gene is marked with A425.

6. A method for the detection of dengue fever and Legionella pneumophila for non-diagnostic purposes, characterized in that a sample is tested with a combined test reagent according to any one of claims 3 to 5.

7. The method of claim 6, wherein the system of detection comprises: 0.15 mu L of each upstream and downstream primer for detecting dengue viruses, 0.0375 mu L of dengue virus detection probe, 0.15 mu L of each upstream and downstream primer for detecting legionella pneumophila, 3 mu L of reaction reagent for detecting legionella pneumophila, 3-7 mu L of sample to be detected and 15 mu L of water for complementation.

8. The method of claim 6, wherein the detected amplification procedure comprises: 5min at 95 ℃ (15 s at 95 ℃ and 30s at 56-62 ℃) for 40 cycles.

9. The method of any one of claims 6 to 8, wherein the sample comprises a sample from the environment, including a water sample, a soil sample, or a swab on the surface of an object.

10. The method of claim 9, wherein the sample extracts cf DNA prior to detection.