CN114395613A - Method for detecting activity of capping enzyme of vaccinia virus - Google Patents
Method for detecting activity of capping enzyme of vaccinia virus Download PDFInfo
- Publication number
- CN114395613A CN114395613A CN202210298041.8A CN202210298041A CN114395613A CN 114395613 A CN114395613 A CN 114395613A CN 202210298041 A CN202210298041 A CN 202210298041A CN 114395613 A CN114395613 A CN 114395613A
- Authority
- CN
- China
- Prior art keywords
- reaction
- vaccinia virus
- reaction mixture
- capping
- capping enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting the activity of the vaccinia virus capping enzyme in vitro. Specifically, the method comprises the following steps: A. transcribing the target gene RNA by using T7 RNA polymerase; B. c, performing capping reaction on the RNA in the step A by using 3' biotin-GTP and vaccinia virus capping enzyme; C. b, performing a capped RNA adsorption reaction on the RNA in the step B by using streptavidin magnetic beads; D. and (4) detecting the difference of the CT value in the step B, C by using an RT-qPCR method, thereby judging the activity of the vaccinia virus capping enzyme in the step B. The method has good repeatability, the measured mRNA yield difference between the capped mRNA and the uncapped mRNA is obvious, and the activity of the vaccinia virus capped enzyme can be successfully and quantitatively detected.
Description
Technical Field
The invention belongs to the field of bioengineering, and particularly relates to a method for detecting the capping enzyme activity of vaccinia virus.
Background
The rapid development of mRNA vaccine technology has led to the increasing demand of RNA biology, and the key step of mRNA vaccine preparation is the preparation of mRNA samples. The most basic structure of an mRNA sample includes a 5'cap, a 5' UTR, an ORF, a 3'UTR, and a 3' tail. Among these, the function of the 5' cap structure is crucial, firstly, it protects the mRNA from rapid degradation by exonucleases; second, the 5' cap structure plays an essential role in the translation process, since eukaryotic initiation factors recognize and bind to the cap structure of mRNA. In addition, the 5' cap structure also plays a further role in preventing the innate immune sensor from recognizing mRNA.
Currently, there are two different approaches to achieve capping of in vitro transcribed RNA, one is co-transcription capping: synthetic cap analogs are added during the transcription reaction, but the major limitation of this approach is the competition between the cap analog and the GTP nucleotides required for in vitro transcription, resulting in partial mRNA uncapping and translational inactivation. The method has the advantages of simple operation and capability of realizing transcription capping in one step, but has the disadvantages that other analogues similar to caps, such as 'non-functional caps', ApppN, can be introduced in the co-transcription capping process, and the mRNA can still be prevented from degrading. The structural analogs of the caps are expensive to manufacture and are not suitable for large-scale production.
The other is enzymatic reaction capping: post-transcriptional addition of vaccinia virus capping enzyme generates the same Cap (i.e., m) as the most common endogenous eukaryotic Cap structure7A G cap). The method uses enzyme method for capping, has low cost, and is suitable for large-scale production. Enzyme methodThe key to capping is the vaccinia virus capping enzyme, which caps 7-methylguanosine (m)7Gppp, Cap0) to the 5' -end of the RNA. In eukaryotes, this structure is closely related to the stabilization, transport and translation of mRNA. Capping RNA using enzymatic reactions is a simple and efficient method that can significantly improve the stability and translation ability of RNA for in vitro transcription, transfection and microinjection. Therefore, it is important to determine the activity of the vaccinia virus capping enzyme.
The existing methods for detecting the vaccinia virus capping enzyme mainly comprise a radioactive substrate incorporation method, in vitro translation, an LC-MS method and the like. Incorporation of radioactive substrates by Activity measurement32P-labeled GTP is used as a substrate, which is bound to the target RNA by vaccinia virus capping enzyme, and the activity of the vaccinia virus capping enzyme is measured by measuring the amount of radioactive isotope. The method has low safety, radioactive pollution, complicated steps and high experimental environment requirement; in vitro translation assay vaccinia virus capping enzyme activity was determined by comparing the amount of protein expression of fluorescently labeled gene mRNA in cell transfection with and without capping. The method is simple and convenient to operate, but has low sensitivity, a plurality of interference factors and large enzyme activity determination error. LC-MS assay of vaccinia virus capping enzyme activity was performed by comparing the molecular weight differences of the product pairs before and after capping. The method has high sensitivity and high precision, but has certain requirements on instruments and high cost.
Therefore, there remains a need in the art to provide a method for economically and efficiently detecting vaccinia virus capping enzyme activity.
Disclosure of Invention
The invention aims to provide a method for detecting the activity of the vaccinia virus capping enzyme.
In a first aspect of the present invention, there is provided a method for quantitatively detecting the activity of a vaccinia virus capping enzyme in vitro, comprising the steps of:
(S1) providing a single-stranded RNA molecule having a 5 '-triphosphate at its 5' end;
(S2) performing a capping reaction on the single-stranded RNA molecule using vaccinia virus capping enzyme in a detection reaction system containing 3' Biotin GTP to obtain a first reaction mixture containing a capped product, wherein the capped product is an RNA molecule containing Biotin-modified GTP;
(S3) separating the capped product from the first reaction mixture;
(S4) performing RT-PCR on the capped product, determining a CT value of C1, and comparing C1 with a reference CT value of C0 to obtain a CT difference; comparing the CT difference to a standard value or a standard curve to obtain a quantitative determination of the activity of the vaccinia virus capping enzyme.
In another preferred embodiment, the C0 is the CT value of a negative reference system, wherein the conditions of the negative reference system are the same as the detection reaction system, but the detection reaction system does not contain vaccinia virus capping enzyme; and performing a capping reaction on the single-stranded RNA molecule in a negative reference system to obtain a negative reaction mixture, and performing RT-PCR on the negative reaction mixture, wherein the measured CT value is recorded as C0.
In another preferred embodiment, C0 is the CT value of the first reaction mixture reference, wherein the first reaction mixture is divided into one portion and recorded as the first reaction mixture reference; and separating the capped product from the remaining first reaction mixture in step (S3); the first reaction mixture reference was then subjected to RT-PCR and the CT value determined was designated C0.
In another preferred embodiment, the volume of the first reaction mixture reference is 1/50 to 1/2, preferably 1/20 to 1/5 of the volume of the first reaction mixture.
In another preferred embodiment, the CT difference (Δ CT)1)=C1-C0。
In another preferred example, in the step (S1), the single-stranded RNA molecule with 5 '-triphosphate at the 5' end is mRNA obtained by in vitro transcription of DNA.
In another preferred embodiment, in step (S1), the length of the single-stranded RNA molecule is 100-2000nt, preferably 200-1000nt, and more preferably 500-1000 nt.
In another preferred embodiment, the standard value is the CT value measured in a standard reaction system or the difference between the CT value and C0.
In another preferred embodiment, the standard reaction system contains a standard of vaccinia virus capping enzyme at a known concentration.
In another preferred embodiment, the known concentration comprises a plurality of different concentrations or a series of diluted concentrations.
In another preferred embodiment, the standard curve is an "enzyme concentration- Δ CT" standard curve plotted against vaccinia virus capping enzyme in a standard reaction system.
In another preferred embodiment, the standard reaction system is the same or substantially the same as the detection reaction system described in (S2) except that it contains a standard of vaccinia virus capping enzyme at a known concentration.
In another preferred example, the reaction conditions and the measurement conditions of the standard reaction system and the detection reaction system described in (S2) are the same or substantially the same.
In another preferred example, in the step (S3), the separation is performed by a streptavidin magnetic bead adsorption reaction.
In another preferred example, in step (S2), the final concentration of the RNA in the reaction system before the capping reaction is 1. mu.g/10. mu.l to 10. mu.g/10. mu.l, preferably 5. mu.g/10. mu.l.
In another preferred example, in the step (S2), in the reaction system before the capping reaction, the reaction system includes SAM and 10 × capping reaction buffer.
In another preferred example, in step (S2), the final concentration of the SAM in the reaction system before the capping reaction is 0.05mM-2mM, preferably 0.1 mM.
In another preferred example, in step (S2), the final concentration of the 3' Biotin GTP in the reaction system before the capping reaction is 0.1mM-1mM, preferably 0.2 mM-0.8mM, and more preferably 0.5 mM.
In another preferred example, in step (S2), the final concentration of the vaccinia virus capping enzyme in the reaction system before the capping reaction is 0.1U/. mu.l-2U/. mu.l, preferably 0.5U/. mu.l.
In another preferred example, in the step (S2), the reaction time of the capping reaction is t.
In another preferred example, in the step (S2), the reaction time t is 10min to 1 h; preferably, the reaction time t is 15min to 40min, more preferably 30 min.
In another preferred example, in the step (S2), the capping reaction is performed at 35 to 38 ℃; preferably, it is carried out at 37 ℃.
In another preferred example, in the step (S3), the separating includes:
(1) adsorbing the RNA molecules of the biotin-modified GTP in the first reaction mixture by streptavidin magnetic beads; and
(2) and (3) washing the magnetic beads in the step (1) to obtain an eluent containing the RNA molecules of the biotin-modified GTP.
In another preferred example, in the step (S3), the separating includes the steps of:
(S3.1) uniformly mixing the streptavidin magnetic beads and the first reaction mixture in (S2), and reacting at room temperature for 20-60 min, preferably for 30 min;
(S3.2) washing the magnetic beads in the previous step with a buffer solution, and finally resuspending the magnetic beads with 200. mu.l nuclease-free water to obtain an eluate containing the RNA molecules of biotin-modified GTP.
In another preferred embodiment, the volume of the detection reaction system is 1. mu.l to 100 ml, preferably 10. mu.l to 50 ml, more preferably 10. mu.l to 20. mu.l.
In another preferred embodiment, the method is performed in n separate detection reaction systems, wherein n is a positive integer from 1 to 10000, preferably from 2 to 2000, more preferably from 5 to 1000.
In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.
In a second aspect of the present invention, there is provided a test device for detecting the activity of vaccinia virus capping enzyme, the device comprising:
(d1) the detection module comprises one or more detection units, wherein the detection units comprise:
a reaction chamber, which is a detection reaction system containing 3' Biotin GTP, and is used for carrying out capping reaction on a single-stranded RNA molecule with 5' -triphosphate at the 5' end by using to-be-detected vaccinia virus capping enzyme to obtain a first reaction mixture containing a capped product,
a separation chamber for separating the capped product from the first reaction mixture using streptavidin magnetic beads;
(d2) the data acquisition module is configured to acquire the CT values of the reaction chamber and the separation chamber in each detection unit through RT-PCR in the detection module;
(d3) an analysis module configured to analyze the CT value from the data acquisition module, compare the obtained CT difference value with a standard numerical value or a standard curve, and obtain an analysis result of the activity of the vaccinia virus capping enzyme to be detected;
(d4) and the output module outputs the analysis result of the screening analysis module.
In another preferred embodiment, the number of the detection units is 1-200, preferably 4-100, more preferably 8-50, and most preferably 10-20.
In another preferred embodiment, the capping product is an RNA molecule containing biotin-modified GTP.
In another preferred embodiment, the CT difference = CT of the capped product in the separation chamber-CT of the first reaction mixture containing the capped product in the reaction chamber.
In a third aspect of the present invention, there is provided a kit for quantitative in vitro detection of the activity of a vaccinia virus capping enzyme, said kit comprising:
(E1) a single-stranded RNA molecule having a 5 '-triphosphate at its 5' terminus;
(E2) 3' Biotin GTP；
(E3) streptavidin magnetic beads configured to isolate (E1) a capping product of the single-stranded RNA molecule enzymatically formed by the vaccinia virus capping enzyme; and
(E4) RT-PCR detection reagents configured to detect the single-stranded RNA molecule of (E1) and its capping product formed by vaccinia virus capping enzyme catalysis.
In another preferred embodiment, the kit further comprises: (E5) vaccinia virus capping enzyme standard.
In another preferred embodiment, the RT-PCR detection reagent comprises: RT-PCR probe and primer, one-step probe RT-qPCR reagent.
In another preferred embodiment, the sequences of the RT-PCR primers are shown as SEQ ID number 3 and SEQ ID number 4, and the sequence of the RT-PCR probe is shown as SEQ ID number 5.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 shows agarose gel electrophoresis of DNA template obtained by PCR amplification.
FIG. 2 shows agarose gel electrophoresis of in vitro transcribed RNA.
FIG. 3 shows a graph of the results of RT-qPCR amplification curves.
Fig. 4 shows a standard graph. Wherein, the logarithmic value of the enzyme concentration by gradient dilution is taken as an X axis, and the corresponding Delta CT is taken as a Y axis.
FIG. 5 shows a graph of the results under a fluorescence microscope after RNA transfection.
FIG. 6 shows a graph of flow cytometry results after RNA transfection.
FIG. 7 shows the mRNA 5' Cap0 Cap structure. The red dotted box is the 5' cap structure.
Detailed Description
The present inventors have extensively and intensively studied and, for the first time, have unexpectedly found that a vaccinia virus capping enzyme can cap a single-stranded RNA molecule having a triphosphate group at the 5 'terminus with 3' biotin-GTP. Based on this, a method for detecting the activity of, in particular quantitatively detecting, vaccinia virus capping enzyme has been developed. Specifically, the method comprises the following steps: A. transcribing the target gene RNA by using T7 RNA polymerase; B. c, performing capping reaction on the RNA in the step A by using 3' biotin-GTP and vaccinia virus capping enzyme; C. b, performing a capped RNA adsorption reaction on the RNA in the step B by using streptavidin magnetic beads; D. and (4) detecting the difference of the CT value in the step B, C by using an RT-qPCR method, thereby judging the activity of the vaccinia virus capping enzyme in the step B. The method has good repeatability, the mRNA yield difference between the capped mRNA and the uncapped mRNA is obvious, and the activity of the capped enzyme of the vaccinia virus can be successfully and quantitatively detected. The present invention has been completed based on this finding.
Term(s) for
Vaccinia virus capping enzyme
The most basic structure of an mRNA sample includes a 5'cap, a 5' UTR, an ORF, a 3'UTR, and a 3' tail. Wherein the function of the 5' cap structure is crucial. Capping of in vitro transcribed RNA by enzymatic reaction capping comprising: post-transcriptional addition of vaccinia virus capping enzyme generates the same Cap (i.e., m) as the most common endogenous eukaryotic Cap structure7A G cap).
As used herein, the terms "vaccinia virus capping enzyme of the invention" and "capping enzyme of the invention" are used interchangeably. Vaccinia virus capping enzyme can cap 7-methylguanosine (m)7Gppp, Cap0) to the 5' end of the RNA, producing a Cap (i.e., m) identical in structure to the most common endogenous eukaryotic Cap7A G cap). In eukaryotes, this structure is closely related to the stabilization, transport and translation of mRNA. FIG. 7 shows the mRNA 5' Cap0 Cap structure.
According to the invention, by utilizing the characteristic that the vaccinia virus capping enzyme can utilize 3'biotin-GTP to perform capping reaction on a single-stranded RNA molecule containing a triphosphate group at the 5' end, a method for determining the activity of the vaccinia virus capping enzyme based on RT-PCR and streptavidin magnetic bead adsorption reaction is developed.
Real-time fluorescent quantitative PCR technology (RT-PCR)
As used herein, the terms "RT-PCR", "RT-qPCR", "real-time fluorescent quantitative PCR" may be used interchangeably.
As used herein, the term "CT value" is a Cycle Threshold (Cycle Threshold), which refers to the number of cycles that the fluorescence signal in each reaction tube experiences when it reaches a set Threshold.
The real-time fluorescent quantitative PCR technology has the advantages of high sensitivity, strong specificity, high speed and the like, and is widely applied to the aspects of gene expression level, mutation and polymorphism research, qualitative and quantitative detection of pathogens and the like. The probe method real-time fluorescent quantitative PCR principle: during PCR amplification, a specific fluorescent probe is added on the basis of a primer contained in the system, the probe is essentially oligonucleotide, and two ends of the probe are respectively marked with a fluorescent group and a quenching group. When the PCR is not amplified, the fluorescent group and the quenching group are combined together, and the fluorescent signal of the fluorescent group is absorbed and quenched by the quenching group; when PCR is amplified, the probe is combined with an amplification product, the probe is cut by Taq enzyme 5'→ 3' exonuclease activity, and a fluorescent group is far away from a quenching group, so that a fluorescent signal is generated.
Biotinylated GTP (3' Biotin GTP)
As used herein, the molecular formula of 3' Biotin GTP is: c31H50N11O19P3S, molecular weight: 1005.78 g/mol, the structure is as follows:
detection method of the invention
The invention provides a method for detecting the activity of vaccinia virus capping enzyme, which comprises the following steps:
firstly, a pair of primers T7-F/R is designed and synthesized according to the existing target gene, and the primers are used for carrying out PCR amplification on a plasmid containing the target gene to obtain a transcribed DNA template;
then, RNA is transcribed and synthesized under the action of T7 RNA polymerase and 4 NTPs;
then, the RNA synthesized by transcription is doped with 3' Biotin GTP for capping reaction;
then, performing streptavidin magnetic bead adsorption reaction on the capped RNA;
and finally, detecting the capped RNA samples before and after the streptavidin magnetic bead treatment by an RT-qPCR method, and judging the activity of the vaccinia virus capping enzyme by observing the difference (delta CT) of CT values before and after the treatment.
If the vaccinia virus capping enzyme is inactive, 3' Biotin GTP cannot be doped on the substrate RNA through a capping reaction, and streptavidin magnetic beads cannot adsorb the capped RNA, the delta CT is consistent with the negative control, and basically has no difference;
if the vaccinia virus capping enzyme is active, 3' Biotin GTP is doped on the substrate RNA through a capping reaction, streptavidin magnetic beads and Biotin are combined to adsorb the capped RNA, and the delta CT is obviously smaller than that of a negative control.
Particularly, the activity of the to-be-detected vaccinia virus capping enzyme can be easily and quantitatively detected by an RT-qPCR method relative to the activity of the existing capping enzyme.
The main advantages of the invention include
1) No radioactive label is needed, no radioactive pollution is caused, and a severe-grade laboratory is not needed;
2) expensive instruments such as LC-MS are not needed, and the operation is simple;
3) the amount of samples required by detection is small, no special requirement is made on RNA substrates, and the detection sensitivity can be effectively improved by combining an RT-qPCR method.
4) The method has good repeatability, and can carry out quantitative analysis on enzyme activities with different activities.
The invention is further illustrated by the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specifying the detailed conditions in the following examples, generally followed by conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.
The first embodiment is as follows: establishment of RNA reaction System
1. Sample and material preparation
a. Materials, reagents and instruments: 2x Fast Pfu Master Mix (2x Fast Pfu polymerase Mix), Novoprotein (near shore protein science, Inc.), cat #: e035; t7 High Yield RNA Transcription kit (T7 High-Yield RNA Transcription kit), Novoprotein (near shore protein science, ltd.), cat # n: e131; vaccinia Capping System (Vaccinia virus Capping System), Novoprotein (near shore protein technology ltd), cat #: M062-YH 01; RNA purification magnetic beads; 0.2ml EP tube, magnetic frame, PCR instrument, Qubit nucleic acid quantitative instrument, etc.
b. Sample preparation: a plasmid containing a gene of interest.
2. Design of primers T7-F and T7-R
In the experiment, the CLDN2G gene is selected as a target gene, and a primer is designed, wherein T7-F has a T7 promoter sequence, and the specific sequence is as follows:
T7-F：
GCTAATACGACTCACTATAGGGAGACCTCTCGCCAAAGGAATGCA(SEQ ID NO:1)
T7-R：TTCAGCTCGATGCGGTTCAC(SEQ ID NO:2)
3. amplifying a DNA fragment containing a target gene from a plasmid, and adding the following components to prepare a reaction system:
2 xFast Pfu Master Mix in an amount of 25. mu.l;
T7-F (10. mu.M), 2. mu.l;
T7-F (10. mu.M), 2. mu.l;
CLDN2G plasmid in an amount of 50 ng;
nuclean Free Water (Nuclease Free Water), added to make the system volume to 50 u l.
And (4) lightly beating the mixture by using a pipettor, fully and uniformly mixing the mixture, and centrifuging the reaction solution to the bottom of the tube for a short time. The samples were placed in a PCR instrument and the reaction program set up as follows (table 1):
TABLE 1 amplification reaction procedure for DNA fragments of interest
After the reaction is finished, the product is recovered through isopropanol precipitation, as shown in figure 1, the band is clear, single and free of impurity band, and the concentration is detected by a Qubit nucleic acid detector.
4. In vitro RNA transcription reaction, adding the following components to prepare a reaction system:
10x Transcription Buffer (10x Transcription Buffer), 2. mu.l;
enzyme Mix (Enzyme Mix) added in an amount of 1. mu.l;
25mM NTPs, added in an amount of 6. mu.l;
the amount of the recovered DNA added was 1. mu.g;
nuclean Free Water (Nuclease Free Water), after the addition of the system volume to 20L.
Reacting at 37 ℃ for 3h, adding 2U DNase I after the reaction is finished, carrying out purification by magnetic beads at 37 ℃ for 30min, and obtaining in-vitro transcribed RNA.
Example two: method for detecting activity of capping enzyme of vaccinia virus
1. Sample and material preparation
a. Sample preparation: the starting sample was 50. mu.g of in vitro transcribed RNA dissolved in nucleic Free Water; vaccinia virus capping enzyme is tested.
b. Materials, reagents and instruments: NovoScript Probe One-Step qRT-PCR kit (Novoprotein, E094-LPAA), streptavidin magnetic beads, 3' Biotin GTP (both of which are common commercial reagents), 0.2ml of EP tube, a Qubit nucleic acid quantifier, a LightCycler 480 quantifier and the like.
2. RNA capping reaction. The in vitro transcribed RNA was placed in a PCR instrument at 65 ℃ for 5min, immediately after the reaction was completed, on ice for 5min, and the following reaction system (Table 2) was added (wherein the vaccinia virus capping enzyme used in the positive control was the control enzyme produced by the applicant that had been qualified by the LC-MS method):
TABLE 2 reaction System for RNA capping reaction
The reaction was carried out at 37 ℃ for 30 min. Mu.l of the product was taken and placed in a 0.2ml EP tube, diluted to 10. mu.l with Nuclear Free Water, named C1, C2, C3, C4, respectively, and stored at-20 ℃ until use. The remaining 9.5. mu.l was used for the streptavidin reaction.
3. Streptavidin magnetic bead adsorption reaction
And uniformly mixing the streptavidin magnetic beads with the reacted product, and reacting at room temperature for 30 min. The magnetic beads were washed with SA Buffer I Buffer and finally resuspended with 200. mu.l of Nuclear Free Water. The samples were designated S1, S2, S3, S4.
4. RT-qPCR detection
Designing RT-qPCR probes and primers, wherein the specific sequences are as follows:
CL18-2-F1:GGACGTGGTTTTCCTTTGAA(SEQ ID NO:3)
CL18-2-R1:GAACTTCAGGGTCAGCTTGC(SEQ ID NO:4)
CL18-2-P1:ACGTAAACGGCCACAAGTTC(SEQ ID NO:5)
taking 1 microliter of C1, C2, C3, C4, S1, S2, S3 and S4, diluting 100 times of each sample by using clean Free Water as a template, and carrying out RT-qPCR detection by using a Novo E094-LPAA one-step method probe RT-qPCR reagent, wherein each sample is repeated for 3 times. Adding the following components to prepare a reaction system:
5 multiplied by NovoScript Probe One-Step qRT-PCR SuperMix, wherein the addition amount is 4 mu l;
adding 1 mu l of NovoScript RT Enzyme Mix;
CL18-2-F1(10 mu M), the addition amount is 1 mu l;
CL18-2-R1(10 mu M), the addition amount is 1 mu l;
CL18-2-P1 (10 mu M), the addition amount is 0.5 mu l;
ROX (selected according to machine model);
adding 1 mul of RNA template;
nuclean Free Water (Nuclease Free Water), after the addition of the system volume to 20L.
The reaction procedure was as follows:
(1) reacting at 42 ℃ for 5 min;
(2) reacting at 95 ℃ for 10 s;
(3) reacting at 95 ℃ for 5 s;
(4) reaction at 60 ℃ for 40s (fluorescence collected), wherein the procedures (3) to (4) were set for 40 cycles.
5. Analysis of results
The amplification curve of RT-qPCR is shown in FIG. 3, the CT values of the experimental group, the positive control and the negative control before streptavidin magnetic bead treatment are basically consistent, the CT value of the negative control after streptavidin treatment is obviously greater than that of the experimental group and the positive control, and the CT values of the positive control and the experimental group are basically consistent, which indicates that the vaccinia virus capping enzyme in the experimental group is active.
The results of the RT-qPCR calculation are shown in Table 3.Δ CT = CT value of streptavidin-adsorbed RNA-CT value of capped RNA. The Δ CT before and after streptavidin treatment was calculated as the average of three replicates per sample.
In the negative control group, 3' Biotin GTP cannot be doped on the substrate RNA through a capping reaction due to no enzyme, streptavidin magnetic beads cannot adsorb the capped RNA, and the negative control delta CT =9.52 shows the difference value when the capping enzyme is inactive.
The 3' Biotin GTP in the positive control group is doped on the substrate RNA through a capping reaction, the streptavidin magnetic bead can adsorb the capped RNA, so that the CT value after streptavidin adsorption is obviously smaller than that of a negative control, the delta CT is also obviously smaller than that of the negative control, and the positive control delta CT mean =3.19 shows the difference value when the capping enzyme has activity.
The delta CT =3.07 of the experimental group is close to the delta CT of the positive control group, and no significant difference exists, which indicates that the capping enzyme of the vaccinia virus of the experimental group has activity.
TABLE 3 RT-qPCR results
Example three: method for quantitatively detecting activity of capping enzyme of vaccinia virus
The positive control in example 2 was diluted with a 5-fold concentration gradient and the enzyme activity was measured by the method in example 2, as follows (Table 4):
TABLE 4 quantitative determination of enzyme Activity
The results of the RT-qPCR calculations are shown in Table 4.Δ CT = CT value of streptavidin-adsorbed RNA-CT value of capped RNA. The Δ CT before and after streptavidin treatment was calculated as the average of three replicates per sample.
The method can distinguish capping enzymes with different activities, and has good repeatability. The logarithm of the enzyme concentration of the gradient dilution is taken as the X axis, and the corresponding Delta CT is taken as the Y axis, so that a standard curve (figure 4) can be drawn, and the standard curve can be further used for the quantitative analysis of the activity of the capping enzyme.
Example four: detection of vaccinia virus capping enzyme activity using traditional transfection methods
1. Sample and material preparation
a. Sample preparation: the initial sample is 1-5 mug, dissolved in the cap-added tail-added eGFP marker gene RNA of the nucleic Free Water; the initial sample is 1-5 mug, dissolved in tailing eGFP marker gene RNA of nucleic Free Water; the same vaccinia virus capping enzyme was tested as in example two.
b. Materials, reagents and instruments: Lipofectamine-MessengerMAX transfection reagents, Opti-MEM-Medium (all common commercial reagents), human HEK293 cells, 1.5ml EP tubes, flow cytometers, fluorescence imagers, and the like.
2. RNA transfection cell reaction. Prepare 24-well cell plates, 0.5-2X 10 per well5The reaction system was prepared by adding the following components to a number of HEK293 cells:
Opti-MEM Medium with 25 μ l x 2 added;
lipofectamine MessengerMAX Reagent was added in an amount of 1.5. mu.l.
Lipofectamine MessengerMAX Reagent was diluted with Opti-MEM Medium and left at room temperature for 10 min. The following formulation was then added in order to prepare the RNA-liposome complex:
the adding amount of the Opti-MEM Medium is 25 mu l;
RNA, the addition amount is 1 mug;
diluted Lipofectamine MessengerMAX Reagent was added in an amount of 25. mu.l.
The system was incubated at room temperature for 5min to form RNA-liposome complexes. Finally, 50. mu.l of the RNA-liposome complex was inoculated into the cells and incubated at 37 ℃ for 1-2 days.
3. RNA transfection efficiency assay
Firstly, a fluorescence imager is used for observing whether cells emit green fluorescence or not, and if the green fluorescence is generated, RNA transfection is proved to be successful; the expression level can be determined by flow cytometry.
FIG. 5 shows the results of the fluorescence imager that negative controls do not produce fluorescence, eliminating interference of background fluorescence, and capped and tailed RNA exhibits significantly improved fluorescence expression intensity compared to weak fluorescence produced by tailed RNA alone, indicating successful capping;
FIG. 6 flow cytometry analysis shows that the expression level of capped tailing RNA is 56.8%, which is significantly higher than 32.9% of tailing RNA, indicating that the capping is successful and the vaccinia virus capping enzyme has capping activity.
Although the conventional method in example 4 can identify the activity of the capping enzyme, it cannot be quantitatively analyzed; in addition, the transfection method is influenced by multiple factors such as cell state, operation level and the like, and has poor repeatability.
The method has good repeatability, and can carry out quantitative analysis on the enzyme activities with different activities in a plurality of reaction tubes in one experiment.
Comparative example detection of vaccinia Virus capping enzyme Activity Using traditional LC-MS method
In contrast to the LCMS method in application No. 202010841184.X, the method of the invention can be used for the quantitative detection of vaccinia virus capping enzyme activity.
1. Sample and material preparation
a. Sample preparation: starting samples were 1. mu.g-5. mu.g, short (< 30nt) capped and uncapped RNA in nucleic Free Water; the same vaccinia virus capping enzyme was tested as in example two.
b. Materials, reagents and instruments: hexafluoroisopropanol, triethylamine, MeOH (all common LC-MS grade commercial reagents), HPLC-MS analyzer, and the like.
2. LC-MS chromatographic conditions
Mobile phase A: 200 mM hexafluoroisopropanol +8.15 mM triethylamine, pH 7.9
Mobile phase B: 100% MeOH
The method comprises the following operation steps: a C18, 2.1X 50mm column was used, heated to 75 ℃ and the flow rate was 300. mu.L/min. The gradient profile of elution started at 5% B for 1min and then increased linearly to 25% over 12 min. At 12min, the rinse was started at 90% B for 1 minute and then returned to 5% B at 13 min. The scanning range is 600-3000m/z, and the resolution is 70000 or 1400000. The source temperature and capillary temperature were set at 400 ℃.
3. Results analysis (Table 5)
TABLE 5 analysis of the results of the LC-MS assay
According to the mass spectrum analysis, the peak discharge and the mass-to-charge ratio of uncap RNA and cap0 RNA are detected, the result shows that the capping rate of the capping enzyme to be detected is 99.6%, the activity of the capping enzyme of the vaccinia virus to be detected is consistent with the result obtained by the method.
Compared with the method, LC-MS is more suitable for the capping efficiency analysis, but when the method is applied to the enzyme biopsy, the operation steps are long, and only a single sample can be tested each time. And the LC-MS has high requirements on samples, needs pretreatment, easily causes partial loss, and has larger error when performing gradient test.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Suzhou near shore protein science and technology GmbH
<120> a method for detecting the activity of vaccinia virus capping enzyme
<130> P2021-0486
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gctaatacga ctcactatag ggagacctct cgccaaagga atgca 45
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tcagctcgat gcggttcac 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acgtaaacgg ccacaagttc 20
Claims (10)
1. A method for quantitatively detecting the activity of vaccinia virus capping enzyme in vitro, comprising the steps of:
(S1) providing a single-stranded RNA molecule having a 5 '-triphosphate at its 5' end;
(S2) performing a capping reaction on the single-stranded RNA molecule using vaccinia virus capping enzyme in a detection reaction system containing 3' Biotin GTP to obtain a first reaction mixture containing a capped product, wherein the capped product is an RNA molecule containing Biotin-modified GTP;
(S3) separating the capped product from the first reaction mixture;
(S4) performing RT-PCR on the capped product, determining a CT value of C1, and comparing C1 with a reference CT value of C0 to obtain a CT difference; comparing the CT difference to a standard value or a standard curve to obtain a quantitative determination of the activity of the vaccinia virus capping enzyme; wherein the content of the first and second substances,
the C0 is the CT value of a negative reference system, wherein the conditions of the negative reference system are the same as those of the detection reaction system, but the negative reference system does not contain vaccinia virus capping enzyme; performing a capping reaction on the single-stranded RNA molecule in a negative reference system to obtain a negative reaction mixture, performing RT-PCR on the negative reaction mixture, and recording the measured CT value as C0; or
C0 is the CT value of the first reaction mixture reference, wherein the first reaction mixture is divided into one portion and recorded as the first reaction mixture reference; and separating the capped product from the remaining first reaction mixture in step (S3); the first reaction mixture reference was then subjected to RT-PCR and the CT value determined was designated C0.
2. The method of claim 1, wherein the volume of the first reaction mixture reference is 1/50 to 1/2 of the volume of the first reaction mixture.
3. The method of claim 1, wherein the volume of the first reaction mixture reference is 1/20 to 1/5 of the volume of the first reaction mixture.
4. The method according to claim 1, wherein in step (S1), the length of the single-stranded RNA molecule is 100-2000 nt.
5. The method of claim 1, wherein in step (S3), the separating is performed by streptavidin magnetic bead adsorption reaction.
6. The method of claim 1, wherein in step (S3), the separating comprises:
(1) adsorbing the RNA molecules of the biotin-modified GTP in the first reaction mixture by streptavidin magnetic beads; and
(2) and (3) washing the magnetic beads in the step (1) to obtain an eluent containing the RNA molecules of the biotin-modified GTP.
7. The method of claim 1, wherein in the step (S2), the final concentration of the 3' Biotin GTP in the reaction system before the capping reaction is 0.1mM-1 mM.
8. The method of claim 1, wherein in the step (S2), the capping reaction has a reaction time t, and the reaction time t is 10min to 1 h.
9. An assay device for detecting vaccinia virus capping enzyme activity, the device comprising:
(d1) the detection module comprises one or more detection units, wherein the detection units comprise:
the reaction chamber is a detection reaction system containing 3'Biotin GTP, and a single-stranded RNA molecule with a 5' -triphosphate end is subjected to capping reaction by using a to-be-detected vaccinia virus capping enzyme to obtain a first reaction mixture containing a capped product;
a separation chamber for separating the capped product from the first reaction mixture using streptavidin magnetic beads;
(d2) the data acquisition module is configured to acquire the CT values of the reaction chamber and the separation chamber in each detection unit through RT-PCR in the detection module;
(d3) an analysis module configured to analyze the CT value from the data acquisition module, compare the obtained CT difference value with a standard numerical value or a standard curve, and obtain an analysis result of the activity of the vaccinia virus capping enzyme to be detected;
(d4) and the output module outputs the analysis result of the screening analysis module.
10. A kit for quantitatively detecting the activity of vaccinia virus capping enzyme in vitro, comprising:
(E1) a single-stranded RNA molecule having a 5 '-triphosphate at its 5' terminus;
(E2) 3' Biotin GTP；
(E3) streptavidin magnetic beads configured to isolate (E1) a capping product of the single-stranded RNA molecule enzymatically formed by the vaccinia virus capping enzyme; and
(E4) RT-PCR detection reagents configured to detect the single-stranded RNA molecule of (E1) and its capping product formed by vaccinia virus capping enzyme catalysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210298041.8A CN114395613B (en) | 2022-03-25 | 2022-03-25 | Method for detecting activity of capping enzyme of vaccinia virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210298041.8A CN114395613B (en) | 2022-03-25 | 2022-03-25 | Method for detecting activity of capping enzyme of vaccinia virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114395613A true CN114395613A (en) | 2022-04-26 |
| CN114395613B CN114395613B (en) | 2022-06-28 |
Family
ID=81233954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210298041.8A Active CN114395613B (en) | 2022-03-25 | 2022-03-25 | Method for detecting activity of capping enzyme of vaccinia virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114395613B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115927246A (en) * | 2022-08-01 | 2023-04-07 | 恺佧生物科技(上海)有限公司 | Vaccinia capping enzyme mutant with high capping efficiency |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070281336A1 (en) * | 2006-04-14 | 2007-12-06 | Epicentre Technologies | Kits and methods for generating 5' capped RNA |
| CN112111558A (en) * | 2020-08-19 | 2020-12-22 | 翌圣生物科技（上海）有限公司 | Method for determining activity of capping enzyme of vaccinia virus |
| CN112626177A (en) * | 2019-10-09 | 2021-04-09 | 华中科技大学 | Method for rapidly and quantitatively detecting RNA capping efficiency |
-
2022
- 2022-03-25 CN CN202210298041.8A patent/CN114395613B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070281336A1 (en) * | 2006-04-14 | 2007-12-06 | Epicentre Technologies | Kits and methods for generating 5' capped RNA |
| CN112626177A (en) * | 2019-10-09 | 2021-04-09 | 华中科技大学 | Method for rapidly and quantitatively detecting RNA capping efficiency |
| CN112111558A (en) * | 2020-08-19 | 2020-12-22 | 翌圣生物科技（上海）有限公司 | Method for determining activity of capping enzyme of vaccinia virus |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115927246A (en) * | 2022-08-01 | 2023-04-07 | 恺佧生物科技(上海)有限公司 | Vaccinia capping enzyme mutant with high capping efficiency |
| CN115927246B (en) * | 2022-08-01 | 2023-08-22 | 恺佧生物科技(上海)有限公司 | Vaccinia capping enzyme mutant with high capping efficiency |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114395613B (en) | 2022-06-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113817868B (en) | Primer, probe composition and kit for detecting novel coronavirus and variant strain thereof | |
| CN110846438A (en) | Quadruple real-time fluorescent quantitative PCR (polymerase chain reaction) detection of canine adenovirus type II, canine distemper virus, canine parvovirus and canine parainfluenza virus | |
| CN109536577B (en) | Determination method and application of activity of terminal deoxynuclease | |
| CN112176112A (en) | Triple fluorescent quantitative RT-PCR detection kit for avian influenza virus H5, H7 and H9 subtypes and application thereof | |
| CN114395613B (en) | Method for detecting activity of capping enzyme of vaccinia virus | |
| CN114480570B (en) | Method for detecting mRNA 2' -O-methyltransferase activity | |
| CN111926114A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting parainfluenza virus, method and application | |
| CN112538537A (en) | High-flux microfluidic LAMP chip for detecting livestock respiratory pathogens and detection method | |
| CN113430249B (en) | Method and kit for determining DNA adenylyl acylase activity | |
| CN114250268A (en) | Product for detecting capping efficiency of mRNA sample and application | |
| CN111363842B (en) | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus | |
| KR20210113083A (en) | Composition For Detecting SARS-CoV-2, Kit For Detecting the Same and Method of Detecting SARS-CoV-2 Using the Same | |
| CN112941211A (en) | Multiplex fluorescence quantitative PCR detection kit for streptococcus suis type 2 virulence genes and detection method thereof | |
| CN116640833A (en) | Method for automatically detecting mRNA capping rate in batches by utilizing capillary electrophoresis technology | |
| CN116497019A (en) | Transcription buffer solution capable of improving in-vitro synthesized RNA yield and transcription reaction system | |
| CN110747261A (en) | Specific primer, detection method and application of tetracycline antibiotic resistance gene tetX | |
| CN116735729A (en) | mRNA and capping enzyme activity detection kit, detection system, detection method and application | |
| CN114438263A (en) | Fluorescent quantitative PCR (polymerase chain reaction) primer group and kit for detecting European eel circovirus | |
| CN114480726A (en) | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection | |
| CN113249446B (en) | Nucleic acid isothermal amplification-based whole genome 5hmC level quantification method and application thereof | |
| CN111363840A (en) | Kit for detecting double-stranded RNA of transgenic plant based on RNAi and application thereof | |
| CN117467803B (en) | Primer and probe combination for detecting corn noctuid HzNV-1 virus and application thereof | |
| CN109504807B (en) | Nucleic acid sequence combination for detecting herpes virus type 4 and application thereof | |
| CN117778523B (en) | Poly (A) polymerase activity determination method | |
| CN112553378B (en) | Reagent and kit for detecting 2019-nCoV and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |