CN114392259A - Application of Amonafide compound in preparation of drugs treating AIDS - Google Patents

Abstract

The Amonafide compounds are generally inhibitors of DNA topoisomerase II. The invention discovers that the Amonatide compound can increase the efficiency of-1 PRF generated when ribosome translates Gal-Pol fusion protein, so that the content of Pol protein is increased, the content of Gag protein is relatively reduced, and viruses cannot be packed into a complete particle in cells, thereby the yield of the AIDS virus is sharply reduced, and the invention can be used for treating AIDS.

Description

Application of Amonafide compound in preparation of drugs treating AIDS

Technical Field

The invention relates to an application of an Amonafide compound in preparation of a medicine for treating AIDS, belonging to the field of medicines.

Background

Many retroviruses, including human immunodeficiency virus type 1 (HIV-1) and some coronaviruses, such as severe acute respiratory syndrome virus (severe acute respiratory syndrome) and infectious bronchitis virus (infectious bronchitis virus), use programmed-1 ribosomal frameshifts (-1PRF) to control the ratio of viral structural and enzymatic protein production, which facilitates self-viral assembly.

In the HIV virus, the signal of-1 PRF is located between the Gag and pol Open Reading Frames (ORFs), and the ribosome is able to recognize this region and induce it to shift one nucleotide back in this region, which is translated into Gag-pol fusion protein, where the Gag protein is the structural protein of the virus and pol is the key enzyme protein of the virus. The specific mechanism is as follows: during translation of Gag-pol mRNA, most ribosomes terminate at a stop codon at the end of the Gag open reading frame, producing only Gag protein.

However, since HIV-1Gag-Pol mRNA has a specific sequence consisting of a seven-nucleotide slider sequence (UUUUA) and a downstream RNA stem loop, ribosomes encounter this signal during translation, which induces about 5% of the ribosomes to move backward by one nucleotide, thereby skipping the stop codon of Gag protein and converting the subsequent ORF sequence into the coding sequence of Pol protein, thereby generating Gag-Pol fusion protein, which is cleaved into structural proteins such as p17, p24, p7 and the like by the further action of viral protease, and Pol protein is cleaved into enzymatic proteins such as reverse transcriptase, integrase and the like. It is this mechanism that is utilized by HIV to strictly control the production ratio of Gag-pol protein to 20:1, which facilitates the assembly of the virus itself, as shown in FIG. 1.

Despite the great progress made in the current anti-retroviral therapy, HIV-1 induced aids remains a global health problem, which makes the development of new anti-HIV-1 drugs and the study of new therapeutic targets for this virus urgent.

Disclosure of Invention

The invention aims to provide application of an Amonafide compound in preparation of a medicine for treating AIDS, so as to solve the problems in the background technology.

Process for preparation of Amonafide compoundsThe structural formula is as follows:

the Amonafide compounds are generally inhibitors of DNA topoisomerase II. The invention discovers that the Amonatide compound can increase the efficiency of-1 PRF generated when ribosome translates Gal-Pol fusion protein, so that the content of Pol protein is increased, the content of Gag protein is relatively reduced, and viruses cannot be packed into a complete particle in cells, thereby the yield of the AIDS virus is sharply reduced, and the invention can be used for treating AIDS.

Compared with the prior art, the invention has the beneficial effects that: the Amonafide drug can enhance the efficiency of the ribosome in the process of translating Gag-Pol fusion protein in the process of procedural ribosome displacement, causes serious imbalance of the ratio of Gal protein to Pol protein, further remarkably reduces the packaging efficiency of HIV-1 virus, finally causes the yield of the virus to be sharply reduced, and has good anti-HIV effect.

Drawings

FIG. 1 is a schematic representation of the effect of the present invention on viral packaging under normal conditions and after an increase in the efficiency of-1 PRF;

FIG. 2 is a schematic representation of a dual fluorescent protein and dual luciferase reporter gene of the present invention;

FIG. 3 is a schematic diagram showing the change of green fluorescence value detected by a multifunctional microplate reader after the mCherry- (-1PRF) -GFP single red blood cells are treated by 10 mu MAmonafe for 4 hours in example 2;

FIG. 4 is a schematic diagram of Real-time PCR detection of gp120 content changes in cells and ELISA detection of virus particles in culture medium after transfection of wild-type pNL4-3 plasmid for 24h and subsequent treatment with Amonafide for 4h in example 3 of human embryonic kidney 293 cells of the present invention;

FIG. 5 is a schematic diagram showing the Real-time PCR detection of the change of gp120 content in cells and ELISA detection of the change of virus particles in culture medium after transfection of wild-type pNL4-3 plasmid for 24h and subsequent treatment with Amonafide for 4h in example 4;

FIG. 6 is a diagram showing the measurement of the content of HIV virus particles in the blood of an immunodeficient mouse by ELISA in example 5 according to the present invention.

FIG. 7 is a structural formula of an Amonatide compound.

Detailed Description

The technical solution of the present invention is further described in detail with reference to the accompanying drawings and examples.

Example 1

The structural formula of the Amonafide compound is shown in figure 7.

As shown in figure 1, the Amonatide compound can be used for preparing a medicament for treating AIDS and is applied to treating the AIDS. The principle of the Amonafide compound for treating AIDS is that the Amonafide compound can increase the efficiency of-1 PRF, so that the content of Pol protein is increased, and the relative content of Gag protein is reduced, so that viruses cannot be packaged into a complete particle in cells, thereby causing the yield of AIDS virus to be reduced sharply. The invention utilizes the mechanism of HIV to screen out compounds capable of remarkably promoting HIV-1PRF from an FDA approved drug library, thereby obtaining potential drugs capable of treating HIV.

The frameshift efficiency of HIV-1 controls Gag: the proportion of Pol, deviations from this ratio, in particular an increase in the frameshift efficiency, leads to an increase in the Pol protein content and thus to an inability of the cells to produce complete HIV virions. Therefore, -1PRF can be a new target for anti-HIV-1.

The invention firstly establishes a stable cell strain capable of indicating the efficiency of-1 PRF, further screens a compound Amonafide capable of obviously enhancing the efficiency of HIV-1PRF from a drug library approved by more than 2000 FDAs and proves that the compound can inhibit the replication of HIV and obviously reduce virus particles in cell level and mouse living experiments, and has excellent antiviral effect. The compound is an inhibitor of DNA topoisomerase II, is a synthetic anthracycline anticancer drug, and is originally used for treating acute myelogenous leukemia and some other hematologic malignancies. The applicant has now found that this drug can be used in the treatment of HIV, without relevance to the first use of the drug. Therefore, the patent inventors applied for a second medical use patent of the drug.

When the Amonafide compound is applied, firstly, a dual-fluorescent protein and a dual-luciferase reporter gene are constructed, as shown in fig. 2. As can be seen from FIG. 2, the-1 PRF sequence (shown in SEQ ID No. 2) from HIV-1 is inserted between the coding sequences of red fluorescent protein (mCherry, shown in SEQ ID No.1) and green fluorescent protein (GFP, shown in SEQ ID No.3), and finally the recombinant sequence shown in SEQ ID No.2 is obtained. In the recombinant gene, mCherry is normally transcribed and translated, while GFP is translated only when ribosome generates a-1 shift in the HIV-1 frameshift signal region.

The invention constructs pLVX-IRES-neo plasmid by a homologous recombination method after the recombinant sequence is amplified, transfects hela cells, screens stable cell strains by G418, screens out single red cell strains which only stably express red fluorescent protein but not express green fluorescent protein by a multi-time flow sorting technology, and the single red cell strains are beneficial to subsequent tests because the drug can promote the efficiency of-1 PRF as long as green fluorescent light appears in the drug treatment process, thereby being beneficial to large-scale drug screening.

The compound, namely, the Amonafide, obtained by the invention can remarkably promote the generation of green fluorescent protein in model cells, and further demonstrates that the compound has remarkable inhibitory effect on HIV replication at a cellular level and a mouse level.

As a preferable scheme, the length and sequence of-1 PRF of the-1 PRF in the production of the Amonatide compound are 212bp long-1 PRF sequence, as shown in SEQ ID No.2, comprising a sliding sequence and a stem-loop structure.

Among them, TTTTTTA and CTGGCCTTCCCACAAGGGAAGGCCAG are the sliding sequence and stem loop, and TAA is the position of stop codon which appears when-1 ribosome frameshift does not occur, i.e., only red fluorescent protein can be produced in the cell.

Example 2, referring to fig. 3, based on example 1, when Amonafide was used to significantly enhance the efficiency of HIV-1-1PRF in stably transfected cells, the change in the content of green fluorescent protein was measured by a multifunctional microplate reader after 2h by drug addition to the red-only single positive stably transfected cell line.

The results show that: FIG. 3 shows changes in green fluorescence values detected by a multifunctional microplate reader after mCherry- (-1PRF) -GFP single red blood cells are treated with 10 μ MAmonacide for 4 hours. It can be seen that green fluorescence of cells increases significantly after Amonafide treatment.

Example 3, please refer to fig. 4, based on example 1, when using Amonafide compound to inhibit HIV-1 wild-type virus replication in human cells, total RNA in cells was extracted by transfecting NL4-3 wild-type plasmid for 20h followed by Amonafide for 4h, real-time PCR to detect p24 content.

FIG. 4 shows that human embryonic kidney 293 cells were transfected with wild-type pNL4-3 plasmid for 24h, and then treated with Amonafide for 4h, and then the change of gp120 content in the cells was detected by Real-time PCR and the change of virus particles in the culture medium was detected by ELISA.

Example 4, referring to fig. 5, based on example 1, when using Amonafide compound to inhibit HIV-1 wild-type virus replication in peripheral blood mononuclear cells, human peripheral blood mononuclear cells were isolated, total RNA in cells was extracted by transfecting NL4-3 wild-type plasmid in cells for 24h and then Amonafide was added for 4h, real-time PCR was used to detect p24, pol, and gp120 content.

Meanwhile, the content of virus particles and p24 protein in a cell culture solution is also detected, and the result shows that the replication of viruses in cells treated by the Amonafide is obviously inhibited, the virus particles secreted into a culture medium are also obviously reduced, and the Amonafide can also obviously inhibit the replication and packaging of the viruses in peripheral blood mononuclear cells.

FIG. 5 shows the change of gp120 content in peripheral blood mononuclear cells after transfection of wild-type pNL4-3 plasmid for 24h and treatment with Amonafide for 4h by Real-time PCR and the change of virus particles in ELISA.

Example 5, referring to fig. 6, based on example 1, when using Amonafide compounds to inhibit HIV replication in immunodeficient mouse animal models, human hematopoietic stem cells were isolated and transplanted into mice, and after two weeks of culture, differentiation of hematopoietic stem cells in mice was examined, and finally hematopoietic cell-humanized mice were obtained. Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) -type mice were selected, so the present inventors could use this model to evaluate the effect of the drug in vivo.

HIV virus is purified and then injected into the blood system of a mouse through the tail vein, after 48 hours of infection, the Amonafide is also injected into the mouse through the tail vein, and after 48 hours, the content of HIV virus particles in the blood of the mouse is detected.

The results show that the blood virus particle of HIV in mice injected with the Amonafide is also significantly lower than that of the control group, and the results show that the Amonafide can also significantly inhibit the replication of HIV in animal experiments.

Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) in immunodeficient mice, and two weeks after the isolation of human hematopoietic stem cells and transplantation into mice, a blood cell humanized mouse animal model was established. HIV virus was purified and injected into the blood system of mice via tail vein, and after 48 hours we injected Amonafide into mice via tail vein as well. After another 48 hours, the present inventors examined the content of HIV virus particles in the blood of mice by ELISA. As can be seen from the figure, Amonafide was also able to significantly inhibit HIV replication in the blood of humanized mice.

In conclusion, the beneficial effects of the invention are mainly reflected in that: (1) the screened Amonatide can effectively promote the generation of HIV-1PRF, can obviously inhibit the replication of HIV-1 wild viruses in tumor cells, peripheral blood mononuclear cells and mouse animal models, and can inhibit the assembly of HIV-1 virus particles; (2) the invention discloses a new application of an anticancer drug, namely, the anticancer drug has an HIV-1 virus resistance effect.

The Amonafide drug can change the efficiency of programmed ribosome displacement of an HIV-1 gene during translation of Gag-Pol fusion protein, so that severe imbalance of the ratio of Gal protein to Pol protein is caused, the packaging efficiency of HIV-1 virus is further remarkably reduced, the yield of the virus is finally reduced sharply, and the Amonafide drug has a good anti-HIV effect.

The above-mentioned embodiments, objects, technical solutions and advantages of the present invention are further described in detail, it should be understood that the above-mentioned embodiments are only specific embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.

SEQUENCE LISTING

<110> Ji Biotech Co., Ltd

Application of <120> Amonatide compound in preparation of drugs treating AIDS

<130> 2021-10-12

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 708

<212> DNA

<213> Red fluorescent protein

<400> 1

atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60

gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120

cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180

ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240

cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300

gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360

ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420

atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480

gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540

gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600

aacatcaagt tggacatcac ctcccacaac gagggctaca ccatcgtgga acagtacgaa 660

cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaag 708

<210> 2

<211> 212

<212> DNA

<213> HIV-1PRF sequence

<400> 2

aattttttag ggaagatctg gccttcccac aagggaaggc cagggaattt tcttcagagc 60

agaccagagc caacagcccc accagaagag agcttcaggt ttggggaaga gacaacaact 120

ccctctcaga agcaggagcc gatagacaag gaactgtatc ctttagcttc cctcagatca 180

ctctttggca gcgacccctc gtcacaataa ag 212

<210> 3

<211> 696

<212> DNA

<213> Green fluorescent protein

<400> 3

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 4

<211> 1616

<212> DNA

<213> recombinant sequence

<400> 4

atggtgagca agggcgagga ggataacatg gccatcatca aggagttcat gcgcttcaag 60

gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120

cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggtgg ccccctgccc 180

ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240

cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300

gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360

ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420

atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480

gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgct 540

gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600

aacatcaagt tggacatcac ctcccacaac gagggctaca ccatcgtgga acagtacgaa 660

cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagaa ttttttaggg 720

aagatctggc cttcccacaa gggaaggcca gggaattttc ttcagagcag accagagcca 780

acagccccac cagaagagag cttcaggttt ggggaagaga caacaactcc ctctcagaag 840

caggagccga tagacaagga actgtatcct ttagcttccc tcagatcact ctttggcagc 900

gacccctcgt cacaataaag atggcccagt ccaagcacgg cctgaccaag gagatgacca 960

tgaagtaccg catggagggc tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca 1020

tcggctaccc cttcaagggc aagcaggcca tcaacctgtg cgtggtggag ggcggcccct 1080

tgcccttcgc cgaggacatc ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg 1140

agtaccccca ggacatcgtc gactacttca agaactcctg ccccgccggc tacacctggg 1200

accgctcctt cctgttcgag gacggcgccg tgtgcatctg caacgccgac atcaccgtga 1260

gcgtggagga gaactgcatg taccacgagt ccaagttcta cggcgtgaac ttccccgccg 1320

acggccccgt gatgaagaag atgaccgaca actgggagcc ctcctgcgag aagatcatcc 1380

ccgtgcccaa gcagggcatc ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg 1440

gtggccgctt gcgctgccag ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga 1500

tgcccgactg gcacttcatc cagcacaagc tgacccgcga ggaccgcagc gacgccaaga 1560

accagaagtg gcacctgacc gagcacgcca tcgcctccgg ctccgccttg ccctga 1616

Claims (1)

1. Application of the Amonafide compound in preparing a medicament for treating AIDS.

Images