CN114377067B - Application of grape seed extract in preparation of drugs for targeted removal of tumor microenvironment senescent cells and inhibition of tumors - Google Patents

Abstract

The invention provides application of a Grape Seed Extract (GSE) in preparing a medicament for targeted removal of tumor microenvironment senescence cells and tumor inhibition. The GSE disclosed by the invention can be targeted to remove tumor microenvironment senescent cells, and can promote the inhibition of tumors by removing senescent stromal cells after being combined with chemotherapeutic drugs, so that the promotion effect is unexpected. For senescence-associated secretory phenotype (SASP), the GSE can also target senescent cells therein, thereby inhibiting the SASP.

Description

Application of grape seed extract in preparation of drugs for targeted removal of tumor microenvironment senescent cells and inhibition of tumors

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to application of a grape seed extract in preparation of a medicament for targeted removal of tumor microenvironment senescent cells and tumor inhibition.

Background

Cellular senescence refers to a relatively stable and generally irreversible state of cell cycle arrest in eukaryotic cells, in which proliferating cells are tolerant to growth-promoting stimuli, usually caused by stress signals such as DNA damage. The earliest discoverers described cellular senescence: human embryonic fibroblasts (WI 38) eventually stop dividing, but remain viable and metabolically active after prolonged culture. This phenomenon, later referred to as replicative senescence, refers to the cessation of continued division of normal cells after approximately 30-50 divisions. Replicative senescence is essentially induced by progressive shortening of telomeres.

It is now generally accepted that, in addition to cell types with stem cell-like properties, only transformed malignant cells will replicate indefinitely, whereas non-transformed cells will not. Senescent cells are distinct from both resting cells, which are able to re-enter the cell cycle, and terminally differentiated cells. Senescent cells are characterized by morphological abnormalities, changes in metabolic activity, chromatin remodeling, altered gene expression, increased lipofuscin, marked granularity, severe vacuolation, and the appearance of a proinflammatory phenotype called the senescence-associated secretory phenotype (SASP). Due to loss of nuclear fiber layer lamin B1 expression, a disruption of nuclear membrane integrity was observed. Senescent cells accumulate dysfunctional mitochondria and exhibit elevated levels of Reactive Oxygen Species (ROS). Increased lysosomal content and altered lysosomal activity were also observed, as evidenced by an increased positive rate of β -galactosidase staining at pH 6.0, making it a widely adopted marker of cellular senescence. The biological effects of aging are complex, and the protective or harmful effects of aging cells are different, depending on the pathophysiological environment. For example, although senescence may evolve as a mechanism to avoid malignant transformation of damaged cells, the development of senescence may lead to a range of clinical problems including cancer, cardiovascular and cerebrovascular diseases, osteoporosis, arthritis, metabolic diseases, neurodegenerative symptoms, and the like.

Cellular senescence is manifested by nuclear membrane invagination, chromatin pyknosis, cell volume enlargement, activation of downstream including p53, p16 ^INK4A Multiple signaling pathways including/Rb, PI3K/Akt, foxO transcription factors, and mitochondrial SIRT 1. In addition to entering permanent proliferation arrest, senescent cells are often associated with a number of pathological features, including local inflammation. Cellular senescence occurs in damaged cells and prevents them from proliferating in the organism. Cellular damage can lead to significant signs of cellular aging under the influence of various external stimuli and internal factors. When the damage accumulation reaches a certain limit, tissues present various macroscopic tissue degenerative changes and physiological aging phenotypes.

The expression level of inflammatory cytokines is significantly elevated in senescent cells, a phenomenon known as the senescence-associated secreted phenotype (SASP). Senescent cells are involved in various physiological and pathological processes of the body mainly through 3 pathways: (1) The progressive accumulation of gene expression and morphological changes in senescent cells can affect the function of the corresponding tissues; (2) Senescent cells limit the regenerative potential of stem cells and undifferentiated progenitor cells, resulting in a decrease in the regenerative capacity of the cells; (3) The aging cells not only show growth cycle arrest, but also release a large amount of cytokines, chemokines, growth factors, proteases and the like through autocrine and paracrine pathways to influence the microenvironment of adjacent cells and tissues, so as to cause and accelerate aging and related diseases. In addition, these factors secreted by senescent cells affect the surrounding normal cells, and inhibition of SASP can delay the aging of the body. Typical SASP factors include tumor necrosis factor-alpha (TNF-alpha), interleukin 6 (IL-6), interleukin 8 (CXCL 8), interleukin 1A (IL-1A), matrix Metalloproteinase (MMP), granulocyte-macrophage colony stimulating factor (GM-CSF), plasminogen activator inhibitor-1 (PAI 1), etc., which promote the activation of the immune system, and cause abnormal factors such as senescent cells in the tissue microenvironment to be eliminated by the body, thereby exerting the tumor inhibition function. Paradoxically, however, SASP can also promote tumor progression by specific factors that secrete factors (e.g., VEGF, ANGPTL 4) that promote angiogenesis, extracellular matrix remodeling, or epithelial-to-mesenchymal transition (EMT).

Stimulation such as DNA damage, telomere dysfunction, oncogene activation, oxidative stress, etc. can induce cells to develop SASP, the mechanism of which is closely related to transcription cascade, autocrine loop and sustained DNA damage response. However, overexpression or inhibition of the classical pathways of senescence p53 and p16 ^INK4A The failure of/Rb to affect the expression of SASP suggests that although cycle arrest in senescent cells and SASP often occur in concert, the regulatory pathways of the two do not completely overlap. DNA damage response is reported to increase secretion of SASP factors IL-6 and IL-8 by activating the telangiectasia ataxia mutant gene, nejyhan fragmentation syndrome protein 1, and checkpoint kinase 2. DNA Damage Response (DDR) is activated immediately after cell damage, about 1 week or more is required for mature SASP to appear in senescent cells, and transient DNA damage response does not induce cellular senescence, norCan induce SASP, and shows that other mechanisms besides DNA damage response exist to induce SASP together.

Research shows that DDR, p38MAPK and mTOR signals are used as upstream driving factors, and NF-kappa B and c/EBP beta are used as downstream transcription factors and are all involved in the regulation process of SASP of senescent cells. NF-. Kappa.B and c/EBP.beta.transcription factors increase in activity during cellular senescence and are involved in the expression of cytokines that regulate cellular stress and inflammatory signals. NF- κ B/RelA subunits phosphorylated during cellular senescence enter the nucleus, bind to the SASP promoter, and regulate SASP factor expression, and therefore NF- κ B is commonly referred to as the primary regulator of SASP. Zinc finger transcription factor 4 (GATA 4) in aged cells of mouse liver, kidney and aged brain tissue is high in level, and the expression of SASP related genes IL-6, IL-8 and CXCL1 can be influenced by the GATA4 through regulating the activity of NF-kB in aged cells. p38MAPK is one of the serine/threonine protein kinase family members and is an important signal transduction molecule, and activation or blocking of p38MAPK is sufficient to affect the formation of SASP in senescent cells. p38MAPK is activated several days after the start of the senescence program, indirectly activating NF- κ B by activating mitogen and stress-activated protein kinases, MSK1 and MSK2, resulting in nuclear accumulation of p65 and p50, consistent with the early development of SASP. The aged cells do not directly secrete proinflammatory factors IL-1 alpha, but a large amount of IL-1 alpha is distributed on the surfaces of the aged cells, and the aged cells and NF-kappa B form a positive feed-forward loop to promote the coding transcription of the inflammatory factors and establish and maintain SASP. mTOR promotes SASP factor secretion by regulating IL-1 alpha levels, while rapamycin does not affect IL-1 alpha mRNA levels, but significantly reduces the expression of IL-1 alpha protein on the surface of senescent cells. mTOR is also able to modulate p38MAPK downstream signaling MAPKAPK2 to affect SASP factor secretion, during cellular senescence, MAPKAPK2 phosphorylates RNA binding protein ZFP36L1, thereby limiting its ability to degrade SASP factor transcripts. The transcription factor c/EBP beta is related to cell senescence induced by tumor gene activation, during senescence, the c/EBP beta is recruited to an IL-6 promoter to directly promote transcription of SASP factors, and the c/EBP beta is also an important component of an IL-6 positive feed-forward autocrine loop, can activate an inflammatory network of SASP and is an important regulator for early diffusion of SASP. HMGB2 is targeted on c/EBP beta to regulate SASP, the expression of SASP genes is promoted by inhibiting the spread of heterochromatin, a large amount of HMGB2 is combined with chromatin during cell senescence, the silencing effect of senescence-associated heterochromatin Sites (SAHF) on the SASP genes is eliminated, and the expressions of IL-8, IL-6 and the like are increased.

The effects of targeted cellular senescence on senescence-associated diseases have yet to be rigorously tested to better assess their benefit and risk. Although some SASP inhibitors are known to significantly attenuate SASP, they do not essentially kill senescent cells.

Studies have shown that pro-apoptotic pathways are indeed up-regulated in senescent cells. Thus, the hypothesis that senescent cells rely on senescence-associated anti-apoptotic pathways (SCAPs) to mitigate their injury from SASP has been validated. SCAPs were identified by bioinformatics methods based on the expression profile of radiation-induced aged human preadipocytes. Research shows that the senescent cells have the dependence on the SCAPs through in vitro RNA interference experiments, and the SCAPs are identified as the fatal weakness of the senescent cells. This research finding ultimately led to the discovery of potential senolytic targets in the SCAP network and the discovery of the first senolytic drug, which includes a combination of dasatinib (an FDA-approved tyrosine kinase inhibitor) and quercetin (quercetin) (a flavanol found in many fruits and vegetables) (D + Q). In addition, there have been studies to identify a protein in the BCL-2 family that is resistant to apoptosis (BCL-XL) as a component of SASP. Following this finding, a third senolytic drug, navitoclax, was also identified, which is a BCL-2 family inhibitor.

The SCAP required for the survival of senescent cells varies between cell types. For example, the SCAPs required for the survival of senescent human primary adipocyte progenitors are different from the SCAPs in senescent human embryonic venous endothelial cells (HUVECs). This difference means that drugs targeting a single SCAP may not eliminate multiple aging cell types. Moreover, studies have shown that most senolytics are indeed only effective on a limited number of senolytics cell types. For example, navitoclax is able to target HUVECs, but is ineffective against senescent human adipocyte progenitors. There is evidence that the efficacy of senolytics may vary even within a particular cell type. For example, in human lung fibroblasts, navitoclax can target and kill senescent cells in culture-adapted IMR90 lung fibroblast-like cell lines, but with little success on senescent primary human lung fibroblasts. Therefore, to determine the broad spectrum of action of senolytics, extensive testing against a range of cell types still needs to be performed.

Disclosure of Invention

The invention aims to provide application of grape seed extract in preparing a medicament for targeted removal of tumor microenvironment senescence cells and inhibition of tumors.

In a first aspect of the invention, there is provided the use of a grape seed extract in combination with a chemotherapeutic agent for the preparation of a composition for the specific targeted clearance of senescent cells and tumor suppression in a tumor microenvironment; wherein the chemotherapeutic drug is a chemotherapeutic drug which induces the tumor microenvironment to generate a senescence-associated secretory phenotype (SASP) after administration.

In a preferred embodiment, the tumor is a tumor which generates an aging-related secretory phenotype in a tumor microenvironment after treatment with a genotoxic drug, and/or a tumor which generates drug resistance after treatment with a genotoxic drug; preferably, the tumor includes (but is not limited to): prostate cancer, breast cancer, lung cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, kidney cancer, esophageal cancer, bile duct cancer, brain cancer.

In another preferred embodiment, the senescence-associated secretory phenotype is a senescence-associated secretory phenotype resulting from DNA damage; preferably, the DNA damage is DNA damage caused by chemotherapeutic drugs.

In another preferred embodiment, the chemotherapeutic drug is a genotoxic drug; more preferably, the method comprises the following steps: bleomycin, mitoxantrone, cisplatin, carboplatin, satraplatin, cyclophosphamide.

In another preferred example, the grape seed extract is specifically targeted to induce senescent cells in the tumor microenvironment to enter a death program, promote the growth of stromal cells (which are non-senescent cells), and increase the proliferation rate of stromal cells.

In another preferred embodiment, the chemotherapy drug is bleomycin, and when the bleomycin is combined with the grape seed extract, the final concentration of the bleomycin is 30-70 ug/mL, and the final concentration of the grape seed extract is 5-60 uM; preferably, the final concentration of the bleomycin is 40-60 ug/mL, and the final concentration of the grape seed extract is 10-50 uM; more preferably, the final concentration of bleomycin is 45-55 ug/mL, and the final concentration of grape seed extract is 10-35 uM (e.g., 15uM,20uM,25uM, 30uM).

In another preferred example, the chemotherapeutic drug is mitoxantrone, and when the mitoxantrone is combined with the grape seed extract, the weight ratio of the mitoxantrone to the grape seed extract is 1 to 20-80; preferably, the weight ratio of the mitoxantrone to the grape seed extract is 1; more preferably, the weight ratio of the mitoxantrone to the grape seed extract is 1.

In another preferred embodiment, the chemotherapeutic drug is cisplatin, and when the cisplatin is combined with the grape seed extract, the weight ratio of the cisplatin to the grape seed extract is 1; preferably, the weight ratio of the cisplatin to the grape seed extract is 1; more preferably, the weight ratio of the cisplatin to the grape seed extract is 1.

In another preferred embodiment, the chemotherapeutic drug is carboplatin, and when the carboplatin is combined with the grape seed extract, the weight ratio of the carboplatin to the grape seed extract is 1; preferably, the weight ratio of the carboplatin to the grape seed extract is 1; more preferably, the weight ratio of carboplatin to grape seed extract is 1.

In another preferred example, the chemotherapeutic drug is satraplatin, and when satraplatin is combined with the grape seed extract, the weight ratio of satraplatin to the grape seed extract is 1; preferably, the weight ratio of the satraplatin to the grape seed extract is 1; more preferably, the weight ratio of the satraplatin to the grape seed extract is 1.

In another preferred embodiment, the chemotherapeutic drug is cyclophosphamide, and when the cyclophosphamide is combined with the grape seed extract, the weight ratio of the cyclophosphamide to the grape seed extract is 1; preferably, the weight ratio of the cyclophosphamide to the grape seed extract is 1; more preferably, the weight ratio of cyclophosphamide to grape seed extract is 1.

In another aspect of the invention, there is provided a pharmaceutical composition or kit for specific targeted clearance of senescent cells and inhibition of tumors in a tumor microenvironment, comprising: grape seed extract, and chemotherapeutic agents; wherein the chemotherapeutic drug is a chemotherapeutic drug which induces the tumor microenvironment to generate an aging-related secretory phenotype after administration.

In a preferred embodiment, the grape seed extract is obtained by extracting grape seeds as a raw material by one or more methods selected from the following group: solvent extraction, membrane separation, extraction, and countercurrent extraction.

In another preferred embodiment, in the pharmaceutical composition or the kit, when the bleomycin is combined with the grape seed extract, the final concentration of the bleomycin is 30-70 ug/mL, and the final concentration of the grape seed extract is 5-60 uM; preferably, the final concentration of the bleomycin is 40-60 ug/mL, and the final concentration of the grape seed extract is 10-50 uM; more preferably, the final concentration of bleomycin is 45-55 ug/mL, and the final concentration of grape seed extract is 10-35 uM (e.g., 15uM,20uM,25uM, 30uM).

In another preferred embodiment, in the pharmaceutical composition or the kit, when the mitoxantrone is combined with the grape seed extract, the weight ratio of the mitoxantrone to the grape seed extract is 1; preferably, the weight ratio of the mitoxantrone to the grape seed extract is 1; more preferably, the weight ratio of mitoxantrone to grape seed extract is 1.

In another preferred embodiment, in the pharmaceutical composition or the kit, when the cisplatin is combined with the grape seed extract, the weight ratio of the cisplatin to the grape seed extract is 1; preferably, the weight ratio of the cisplatin to the grape seed extract is 1; more preferably, the weight ratio of the cisplatin to the grape seed extract is 1.

In another preferred embodiment, in the pharmaceutical composition or the kit, when the carboplatin is combined with the grape seed extract, the weight ratio of the carboplatin to the grape seed extract is 1; preferably, the weight ratio of the carboplatin to the grape seed extract is 1; more preferably, the weight ratio of carboplatin to grape seed extract is 1.

In another preferred embodiment, in the pharmaceutical composition or the kit, when the satraplatin is combined with the grape seed extract, the weight ratio of satraplatin to the grape seed extract is 1; preferably, the weight ratio of the satraplatin to the grape seed extract is 1; more preferably, the weight ratio of the satraplatin to the grape seed extract is 1.

In another preferred embodiment, in the pharmaceutical composition or the kit, when the cyclophosphamide is combined with the grape seed extract, the weight ratio of the cyclophosphamide to the grape seed extract is 1; preferably, the weight ratio of cyclophosphamide to grape seed extract is 1; more preferably, the weight ratio of cyclophosphamide to grape seed extract is 1.

In another aspect of the present invention, there is provided a method for preparing a pharmaceutical composition or kit for inhibiting tumor, comprising: mixing the grape seed extract with chemotherapeutic agents; or placing grape seed extract and chemotherapy medicine in the same kit.

In another preferred embodiment, the grape seed extract is mixed with a chemotherapeutic agent and divided into unit dosage forms according to the course of administration.

In another aspect of the invention, there is provided the use of a grape seed extract for the preparation of a composition for the specific targeted clearance of senescent cells in a tumour microenvironment, or for the preparation of a composition for the inhibition (reduction) of a senescence-associated secretory phenotype; preferably, the grape seed extract is specifically targeted to induce senescent cells in the tumor microenvironment to enter a death program and promote the growth of stromal cells (which are non-senescent cells) (increase the stromal cell proliferation speed).

In a preferred embodiment, the composition is further used for: alleviating body dysfunction (including but not limited to, enhancing exercise capacity and enhancing endurance).

In another preferred embodiment, the composition is further used for: prolonging the life of the later years.

In another preferred embodiment, the concentration of the grape seed extract in the composition is 0.5 to 3uM; preferably 0.8-2 uM; more preferably 1 to 1.5uM (e.g., 1.25 uM).

In another aspect of the present invention, there is provided a method for screening a potential substance for promoting tumor inhibition by a chemotherapeutic drug, the method comprising: (1) Providing a tumor microenvironment system, wherein the system comprises tumor cells and stromal cells; (2) Inducing the tumor microenvironment to generate an aging-related secretory phenotype by using the chemotherapeutic drug treatment system of (1); (3) And (3) adding the candidate substance into the system in the step (2), observing the effect of the candidate substance on a tumor microenvironment system, and if the candidate substance can specifically and targetedly eliminate (remarkably promote the elimination of the candidate substance, such as promoting 10%, 20%, 30%, 50% or more) aged cells and/or promote the growth of stromal cells (non-aged cells) (improving the proliferation speed of the stromal cells), the candidate substance is a potential substance for promoting the chemotherapeutic drugs to inhibit tumors.

In a preferred embodiment, step (2) further includes: treating with grape seed extract before, during or after induction of the senescence-associated secretory phenotype in the tumor microenvironment; in the step (3), the method further comprises the following steps: the candidate substance is a potential substance that can be used in combination with grape seed extract to inhibit tumors if the candidate substance is statistically capable of promoting clearance of senescent cells and/or promoting growth of stromal cells in the tumor microenvironment.

In another aspect of the present invention, there is provided a method of screening for potential agents that inhibit a senescence-associated secretory phenotype, the method comprising: (1) Providing a stromal cell system, inducing the system to produce a senescence-associated secretory phenotype; treating with grape seed extract before, during or after inducing the system to produce the senescence-associated secretory phenotype; (2) The candidate substance is added to the system of (1), and the effect on the stromal cell system is observed, and if the candidate substance can specifically promote the inhibitory effect of the grape seeds on the senescence-associated secretory phenotype (significantly promote the elimination thereof, such as promote 10%, 20%, 30%, 50% or more), the candidate substance is a potential substance which can be combined with the grape seed extract to inhibit the senescence-associated secretory phenotype.

In a preferred embodiment, apoptosis or senescence-associated secretory phenotype is assessed by observing caspase 3cleavage activity or SASP factor expression. Preferably, the SASP factors include, but are not limited to: IL6, CXCL8, SPINK1, WNT16B, GM-CSF, MMP3, IL 1A.

In another preferred embodiment, the aging marker p16 is obtained by observing the animal undergoing chemotherapy ^INK4A To assess the apoptotic or senescence-associated secretory phenotype.

In another preferred example, the method further comprises setting a control group so as to definitely distinguish the difference of the tumor microenvironment system in the test group from the control group, or the difference of the clearing effect of the grape seed extract on the aged cells in the tumor microenvironment from the control group.

In another preferred embodiment, the candidate substance includes (but is not limited to): aiming at small molecular compounds, mixtures (such as plant extracts), biomacromolecules, signal path regulating reagents and the like.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, results after SA-. Beta. -Gal staining 7-10 days after treatment of proliferating human stromal cell PSC27 (early passages such as p 10-20) with the chemotherapeutic drug Bleomycin (BLEO) at a concentration of 50. Mu.g/ml in vitro. Upper panel, representative picture, lower panel, statistical data. CTRL, control cells; BLEO, cells after bleomycin treatment. * P <0.01.

FIG. 2, results of PSC27 cells after treatment with the chemotherapeutic drug Bleomycin (BLEO) and after BrdU staining. Upper panel, representative picture, lower panel, statistical data. CTRL, control cells; BLEO, cells after bleomycin treatment. * P <0.001.

Fig. 3, results of PSC27 cells after treatment with the chemotherapeutic drug Bleomycin (BLEO) and after immunofluorescence staining using γ H2 AX. CTRL, control cells; BLEO, cells after bleomycin treatment. * P <0.001. Based on the number of fluorescent spots in the nucleus, they were classified into 4 classes, including individual cells of 0foci, 1-3foci, 4-10 foci and >10 foci.

FIG. 4 is a flow chart of an experiment for screening natural product drug libraries to obtain plant materials with anti-aging activity. Wherein HBF1203 is a human mammary stromal cell line; WI38 is human embryonic lung cells; BJ is human skin fibroblast.

FIG. 5, RNA-seq data after software processing and biological analysis, it was found that GSE can cause significant fallback of genes that are significantly upregulated in senescent cells compared to proliferating cells. Compared with the BLEO group, 2644 genes of the BLEO/GSE group cells are significantly down-regulated, and 1472 genes are significantly up-regulated (fold change >2, P < -0.01).

Fig. 6, heatmap, shows upregulation of massive factor expression in senescent cells due to BLEO damage, but there were many apparent reversals after GSE treatment. The red star identifies, typically, SASP exosomes.

FIG. 7, the results of GSEA analysis, show that the expression of SASP or NF-. Kappa.B molecular marker-related factors is centrally up-regulated in senescent cells caused by BLEO, but significantly decreased after GSE treatment of senescent cells. Left, SASP molecular labeling; and on the right, NF-kB molecular marker.

Fig. 8, protein-protein interaction (PPI) belief analysis results show that senescent cell molecules with significant GSE down-regulation form a network with various interactions.

Figure 9, KEGG pathway analyses representative pathways on biological process of 100 molecules where GSE caused significant down-regulation in senescent cells. Left Y-axis, percentage. Right Y-axis, log10 (p-value).

Figure 10, KEGG pathway analysis representative pathways on cellular components of 100 molecules where GSE caused significant down-regulation in senescent cells. Left Y-axis, percentage. Right Y-axis, log10 (p-value).

Figure 11, fluorescent quantitative PCR (qRT-PCR) assay analyzes the relative expression levels of a group of representative SASP molecules in senescent cells induced by BLEO, treated with different concentrations of GSE. All data are normalized compared to the CTRL set. * P <0.05; * P <0.01.

FIG. 12, SA-. Beta. -Gal staining was used to determine whether PSC27 was senescent or not under conditions of increasing GSE concentration. B, P is greater than 0.05; * P <0.01; * P <0.0001. Among these, the P values of GSE at 5. Mu.M, 12.5. Mu.M, 25. Mu.M and 50. Mu.M concentrations are the statistical significance of the positive cell ratios of these experimental groups compared to the data at 0. Mu.M.

Figure 13, representative pictures of PSC27 after SA- β -Gal staining under various conditions. Each group had 3 replicates arranged one above the other. Scale, 20 μm.

FIG. 14, CCK8 tests the survival rate of the proliferating cells and the senescent cells under the increasing concentration of GSE. P values at each GSE concentration were significant differences compared between CTRL and BLEO groups. * P <0.01; * P <0.001; * P <0.0001.

Figure 15, population doubling test of PSC 27. Cells were BLEO-damaged at passage 10 (p 10), and then GSE was added to the medium at day 8. The effect of GSE on cell proliferation potential was determined by comparative analysis of the fold-increase (PD) of CTRL, BLEO, GSE and BLEO/GSE groups. B, P is greater than 0.05; * P <0.001.

FIG. 16, caspase 3/7 activity induced during GSE treatment of senescent cells. PSC27 cells are gradually advanced into the senescence stage after 12h treatment with BLEO in culture conditions. GSE at 5. Mu.M was started on day 7 with the addition of senescent cell culture medium, nucLight Rapid Red reagent for labeling cells, and caspase 3/7 reagent (IncuCyte) for the apoptosis assay. Caspase 3/7 activity was detected at 4 hour intervals (n = 3).

FIG. 17, pan-caspase inhibitors (20. Mu.M QVD-OPh) reverse senolytic activity of GSE (5. Mu.M GSE was used in this experiment, while 1. Mu.M ABT263 served as a positive control; the latter is a recently reported inducer of apoptosis in senescent cells). Statistical differences were obtained by two-way ANOVA (Tukey' test).

Figure 18, flow cytometry assay PSC27 for apoptosis under several conditions. Q2, the distribution region of early apoptotic cells; q3, distribution region of late apoptotic cells.

FIG. 19, comparative analysis of the number of survival and apoptosis of cells after BLEO and/or GSE treatment. * P <0.001; * P <0.0001.

FIG. 20 is a schematic diagram of the administration pattern of mice in a preclinical trial. The human stromal cells PSC27 were mixed with the cancer cells PC3 in vitro (1. After treatment of multiple treatment cycles under single-drug or combined-drug administration conditions, the mice are finally sacrificed and the tumor tissues of the mice are pathologically analyzed for related molecular expression changes.

Fig. 21, CTRL group and BLEO-injured group of PSC27 cells were mixed with PC3 in vitro, or PC3 cells alone were transplanted into subcutaneous tissues of mice to form transplanted tumors. Tumors were dissected and harvested at the end of week 8, and tumor volumes were examined and compared for each set of conditions. * P <0.01; * P <0.001; * P <0.0001.

FIG. 22, pre-clinical trial mice timing and mode of administration. Two weeks were used as one administration cycle, and MITOXANTONE (mitoxantrone) was administered to the abdominal cavity of mice on the first day of 3/5/7 weeks, respectively. Intraperitoneal GSE administration to mice was initiated once a week on day 5. After the 8-week treatment period, the mice were dissected and subjected to pathological identification and expression analysis.

Fig. 23, tumor terminal volume statistical analysis. The chemotherapeutic drug MIT alone or in combination with the anti-aging drug GSE was administered to mice and groups were analyzed for tumor size by comparison after the end of week 8.

FIG. 24, comparison of cellular senescence in foci of PC3/PSC27 tumor-bearing animals in preclinical experiments. Representative pictures after SA- β -Gal staining. Scale, 100 μm.

FIG. 25, percentage of SA- β -Gal staining positive cells in tumor tissue in mice, is analyzed in parallel. ^, P is greater than 0.05; * P <0.01; * P <0.001.

FIG. 26, quantitative fluorescence PCR (qRT-PCR) assay analysis of SASP-type factor expression in epithelial cancer cells and stromal cells in mouse lesions. Stromal cells and cancer cells were specifically isolated by LCM technique, respectively, total RNA was prepared and used for SASP expression detection. ^, P is greater than 0.05; * P <0.05; * P <0.01; * P <0.001.

FIG. 27 fluorescent quantitative PCR (qRT-PCR) assay analysis of stromal cell SASP factor expression status in mouse foci after vehicle, MIT and MIT/GSE administration. * P <0.05; * P <0.01; * P <0.001.

FIG. 28 analysis of DNA damage and apoptosis ratio in each group of mice after specific isolation of cancer cells in lesions by LCM technique. B, P is greater than 0.05; * P <0.05; * P <0.01.

Fig. 29, picture analysis after immunohistochemical staining. Caspase 3 cleared (CCL 3) signals in foci of various groups of mice are in sharp contrast. Scale, 200 μm.

FIG. 30, kaplan Meier data comparison of disease-free survival of NOD/SCID mice after various dosing treatments. Vehicle, MIT, GSE and MIT/GSE group animals had tumor volumes in vivo exceeding 2000mm ³ At that time, it is considered that severe disease has occurred, and the mice need to be sacrificed in time and tested for tumor bearing. ^ P>0.05；**，P<0.01。

Figure 31 comparative analysis of mouse body weight data at the end of treatment course for various dosing treatment conditions. And P is greater than 0.05.

FIG. 32 comparative analysis of mouse serological data at the end of treatment course under the different dosing treatment conditions described above. Creatinine, urea, ALP and ALT (liver index) data were compared in parallel. And P is greater than 0.05.

FIG. 33 comparative analysis of body weight data from immunocompromised whole mice (C57 BL/6J) at the end of treatment course for various dosing treatment conditions. And P is greater than 0.05.

FIG. 34, comparative mouse blood cell count analysis at the end of treatment course at different dosing treatment conditions in preclinical. WBC, lymphocyte and neutrophile were compared in number per unit volume in parallel. And P is greater than 0.05.

Fig. 35, bioluminescence (BLI) image in animals, shows the location and signal intensity of the reporter cells. PSC27 cells which continuously express luciferase and enter a senescence stage through BLEO induction are transplanted into a mouse body in advance through intraperitoneal injection; 2 days after the last Vehicle or GSE administration, luciferase signals were obtained in mice using a Berthold LB983 (BERTHOLD Technologies) small animal biomolecular imaging system. Scale, 15mm.

Fig. 36, bioluminescence (BLI) image in animals, shows the location and signal intensity of the reporter cells. Proliferating PSC27 cells, which persistently express luciferase, were previously transplanted into mice by intraperitoneal injection; 2 days after the last Vehicle or GSE administration, luciferase signals were acquired in the mice using a Berthold LB983 (BERTHOLD Technologies) small animal in vivo molecular imaging system. Scale, 15mm.

FIG. 37 shows the experimental procedures for the detection of the performance of experimental mice in preclinical settings. Relevant physical performance tests were performed on 20-month-old mice at the end of month 4 after biweekly dosing with Vehicle or GSE.

FIG. 38 shows a series of physical performance measurements for experimental mice, including quantitative measurements of maximum walking speed, endurance, grip strength, treadmill endurance, daily activity, body weight and food intake. ^, P is greater than 0.05; * And P <0.05.

Figure 39, a representative set of SASP factor versus mRNA expression levels for stromal cells in the solid organ microenvironment. Mice were dissected after sacrifice at 24 months of age and solid organs such as lungs, prostate and colorectal were obtained and total RNA in their stromal tissues was extracted for qRT-PCR quantitative analysis. 6-month-old (6M) mice served as controls, and two other groups of 24-month-old (24M) mice were plotted after their signals were normalized. B, P is greater than 0.05; * And P <0.05.

Figure 40. Mouse life analysis experimental design. Mice 24 to 27 months of age were dosed biweekly with either Vehicle or GSE, and their survival was continuously monitored and their maximal lifespan recorded.

Fig. 41, post-treatment survival curves for pre-clinical stage mice. Starting at 24 to 27 months of age, C57BL/6 mice were subjected to Vehicle or GSE intraperitoneal dosing once every two weeks (Vehicle group n = 80. Median survival (median survival) for each group of animals was calculated and indicated. * P <0.0001.

Figure 42, overall (lifetime, or full-length) survival curve of pre-clinical stage mice. Starting at 24 to 27 months of age, C57BL/6 mice were subjected to Vehicle or GSE intraperitoneal administration once every two weeks (Vehicle group n = 80. Median survival (median survival) over the lifetime of each group of animals was calculated and indicated. * P <0.0001.

FIG. 43, male mice with the highest interval of lifespan among animals in each group were selected and comparative analysis of the highest walking speed, endurance and overall lifespan among the groups was performed. N =5. B, P is greater than 0.05; * P <0.01.

FIG. 44, female mice with a highest interval of lifespan in each group of animals were selected and comparative analysis of highest walking speed, endurance and overall lifespan among groups was performed. N = 5/group. B, P is greater than 0.05; * P <0.001.

Figure 45 comparative analysis of disease burden suffered by each mouse at the end of life in both groups of animals. N = 60/group. The statistics are shown in box-and-while plots, each box exhibiting a median with interquartile range. And P is greater than 0.05.

Figure 46, comparative analysis of the number of tumors suffered by each mouse at the end of life in both groups of animals. N = 60/group. The statistics are shown in box-and-while plots, each box exhibiting a mean with intervening range. And P is greater than 0.05.

FIG. 47, tumor terminal volume statistical analysis; the chemotherapeutic drug doxorubicin DOX alone or in combination with the anti-aging drug GSE was administered to mice and groups were analyzed for tumor size by comparison after the end of week 8.

Fig. 48, tumor terminal volume statistical analysis; the chemotherapeutic drug, taxane DOC alone or in combination with the anti-aging drug, GSE, was administered to mice and groups were analyzed for tumor size by comparison after the end of week 8.

FIG. 49, tumor terminal volume statistical analysis; the chemotherapeutic drug vincristine VIN alone or in combination with the anti-aging drug GSE was administered to mice and groups were analyzed for tumor size by comparison after the end of week 8.

Detailed Description

The inventor of the invention has conducted extensive and intensive research and has revealed that the Grape Seed Extract (GSE) can be targeted to remove senescent cells in the tumor microenvironment, and can promote the inhibition of tumors by removing senescent stromal cells after being combined with chemotherapeutic drugs, and the promoting effect is unexpected. For senescence-associated secretory phenotypes (SASPs), the GSEs can also target senescent cells therein, thereby inhibiting the SASPs.

After the early-stage intensive screening research, the inventor combines the GSE and the chemotherapeutic drugs for application. The inventor finds that although GSE can specifically target and eliminate senescent cells in a tumor microenvironment, the GSE has no effect of specifically inhibiting tumor cells; while the chemotherapy drugs can inhibit tumor cells, the influence of the chemotherapy drugs on the tumor microenvironment is great, so that the SASP is formed and developed, and the drug resistance of cancer cells is easily caused after the chemotherapy drugs are continuously used. The combined application of GSE and some specific chemotherapeutic drugs can effectively play a role in benign complementation of targeted diseases, and achieve a surprising synergistic effect.

Grape seed extract

Grape Seed Extract (GSE) is an effective active nutrient extracted from the seeds of grapes, which are known to be naturally derived antioxidants.

GSE can be extracted using a variety of methods, such as, but not limited to: water extraction, organic solvent extraction, microwave method, and supercritical CO extraction ₂ Extraction methods, etc. Organic solvent extraction is preferred, and organic solvents used include, but are not limited to: ethanol, methanol, acetone, and the like. The crude GSE product can be further purified due to more impurities. Purification of the crude GSE product may employ (but is not limited to): solvent extraction, precipitation, enzymolysis, ultrafiltration, macroporous resin, etc.

As a preferred mode of the invention, the GSE is prepared by the following method: is obtained by adopting one or more methods comprising the following steps: solvent extraction, membrane separation, extraction, and countercurrent extraction.

The embodiment of the inventor verifies that the GSE obtained by the method has high content of active ingredients, controllable quality, extremely obvious effect of targeting on eliminating senescent cells, ideal synergistic effect with chemotherapeutic drugs and suitability for industrial large-scale production.

Further, GSE, a known product, is also available commercially.

Grape seed extract and its combined application with chemotherapeutic medicine

As mentioned above, the present inventors have found that the combined use of Grape Seed Extract (GSE) and some specific chemotherapeutic drugs can effectively achieve a benign complementary effect targeting diseases, and achieve a surprising synergistic effect.

In the studies of the present inventors, in the screening of drugs inhibiting the expression of SASP, the present inventors found that, although SASP factor is generally significantly upregulated in senescent cells, the expression of SASP factor is generally decreased in senescent cells after GSE treatment.

In the studies of the present inventors, it was also found that the effect of GSE on killing senescent cells at an appropriate concentration is very desirable. For example, in some embodiments, the inventors found that when GSE reached a threshold at 25 μ M, aged cells now remained 20% or less. Therefore, at a certain concentration, GSE is a novel senolytics and exhibits excellent effects.

The research of the inventor also discovers that the group of the matrix cells is multiplied after the matrix cells are treated by the gene poison medicament (bleomycin in the embodiment); the combination treatment group of the genotoxic drug and GSE showed significantly increased Population Doubling (PD) capacity compared to cells that rapidly entered growth arrest after traumatic treatment. The population multiplication of stromal cells after genotoxic treatment showed significantly increased PD capacity in the combination treatment group of genotoxic drugs and GSE compared to cells that rapidly entered growth arrest after invasive treatment. It is surprising that the combination of GSE with a genotoxic drug allows rapid recovery of the proliferative potential of stromal cells in a short period of time, in contrast to the single use of a genotoxic drug. Of further interest are: GSE promotes senescent cells to enter a death program by means of apoptosis induction, but proliferative cells are basically not targeted by the natural drug, which shows good targeting specificity and safety of GSE.

In the studies of the present inventors, it was also found that following transplantation of tumors into animals, the volume of xenografts (xenograft) consisting of PC3 cells and senescent PSC27 cells was significantly increased compared to transplanted tumors consisting of PC3 cancer cells and primary PSC27 stromal cells. GSE in combination with MIT significantly reduced tumors compared to treatment groups after MIT alone; tumor volume decreased 55.2% compared to MIT, P <0.001; tumor volume was reduced by 74.9% compared to placebo treatment, P <0.0001. This inhibitory effect is highly unexpected.

The inventors also found that the MIT administration process induced the appearance of a large number of senescent cells in the tumor tissue. However, GSE administration essentially depletes most of the senescent cells within the lesions of these chemotherapy animals. Following MIT administration, the expression of SASP factor is significantly increased (mainly in stromal cells); however, this change was largely reversed when GSE was used for administration. When MIT treated animals were used with GSE, the index of DNA damage or apoptosis was significantly enhanced, which means enhanced tumor site cytotoxicity in animals treated with these aging drugs; caspase 3cleavage activity, a typical marker of apoptosis, is significantly elevated when GSE is therapeutically applied. At the same time, mice receiving MIT/GSE combination treatment showed the longest median survival; survival is extended by at least 48.1%. Thus, it can be seen that therapeutic targeting of senescent cells by GSE can promote tumor regression and reduce chemotherapy resistance.

The inventors' studies also found that GSE can selectively kill senescent cells in the tissue microenvironment. GSE alleviates the physical dysfunction of mice, mainly manifested by significantly improved maximum walking speed, suspension endurance, grip strength, treadmill endurance, and daily activity. There was a general decrease in the expression of several important SASP components of stromal cells in the gut tissue microenvironment of aged mice in the GSE-treated group. GSE-mediated clearance of senescent cells can reduce the risk of death and effectively prolong survival in older mice. Therefore, the GSE, a bioactive anti-aging drug, is intermittently provided, so that the disease burden of an aging body can be remarkably reduced by removing aging cells in a microenvironment, and the life span of the body in a post-treatment stage can be prolonged.

Based on the new discovery of the inventor, the invention provides the application of the GSE, which is used for preparing the composition for specifically and targetedly eliminating the senescent cells in the tumor microenvironment and inhibiting the tumor; or preparing a composition that inhibits a senescence-associated secretory phenotype.

As used herein, unless otherwise specified, a "tumor" is a tumor that develops a senescence-associated secretory phenotype in the tumor microenvironment following treatment with a genotoxic drug, and/or is a tumor that develops resistance following a genotoxic drug. Preferably comprising: prostate cancer, breast cancer, lung cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, kidney cancer, esophageal cancer, bile duct cancer, brain cancer.

As used herein, unless otherwise specified, a "chemotherapeutic agent" is one that induces a senescence-associated secretory phenotype (SASP) in the tumor microenvironment upon administration.

In some embodiments of the invention, the "senescence-associated secretory phenotype" is a senescence-associated secretory phenotype that occurs in the event of DNA damage; preferably, the DNA damage is caused by chemotherapy drugs; more preferably, the chemotherapeutic agent comprises a genotoxic agent.

Drug screening

Knowing the close association of GSE with the tumor microenvironment or SASP and its mechanism of operation, drugs can be screened to further optimize inhibitory effects based on this feature. The substances can be used for finding the drugs which target the senescent cells in the tumor microenvironment and are really useful for inhibiting tumors, reversing tumor drug resistance or inhibiting/delaying the senescence-associated secretory phenotype. Or one or more substances may be found from said substances which combine with GSE and exert a synergistic effect.

Accordingly, the present invention provides a method of screening for potential substances that promote tumor inhibition by chemotherapeutic drugs, the method comprising: (1) Providing a tumor microenvironment system, wherein the system comprises tumor cells and stromal cells; (2) Inducing the tumor microenvironment to generate an aging-related secretory phenotype by using the chemotherapeutic drug treatment system of (1); (3) And (3) adding the candidate substance into the system in the step (2), observing the effect of the candidate substance on a tumor microenvironment system, and if the candidate substance can specifically target and eliminate senescent cells and/or promote the growth of stromal cells (non-senescent cells) in the tumor microenvironment (increase the proliferation speed of the stromal cells), the candidate substance is a potential substance for promoting the chemotherapeutic drugs to inhibit tumors. In a more preferred aspect, the step (2) further includes: treatment with GSE before, during or after induction of the senescence-associated secretory phenotype of the tumor microenvironment; in the step (3), the method further comprises the following steps: a candidate substance is a potential substance for use in combination with GSE to inhibit a tumor if the candidate substance is statistically capable of promoting GSE clearance of senescent cells and/or promoting stromal cell growth in the tumor microenvironment.

The present invention also provides a method of screening for potential agents that inhibit a senescence-associated secretory phenotype, the method comprising: (1) Providing a stromal cell system, inducing the system to produce a senescence-associated secretory phenotype; (2) Adding a candidate substance to the system of (1), observing the effect on the stromal cell system, and if the candidate substance can specifically promote the inhibitory effect of grape seeds on the senescence-associated secretory phenotype, the candidate substance is a potential substance for inhibiting the senescence-associated secretory phenotype in combination with GSE.

In a preferred embodiment of the present invention, a control group may be provided in order to make it easier to observe a change in the corresponding index in the test group during screening, and the control group may be a system to which the candidate substance is not added but which is otherwise identical to the test group.

As a preferred mode of the present invention, the method further comprises: the potential substances obtained are subjected to further cellular and/or animal tests to further select and identify substances that are truly useful for inhibiting tumors, reversing tumor resistance, or inhibiting/delaying the senescence-associated secretory phenotype.

In another aspect, the invention also provides potential substances for inhibiting tumors, reversing tumor resistance or inhibiting/delaying aging-related secretory phenotypes, which are obtained by using the screening method. These initially screened materials can be used to construct a screening library from which one can ultimately screen truly useful drugs.

Pharmaceutical combination

The invention provides a pharmaceutical composition comprising an effective amount (e.g., 0.00001-50wt%, preferably 0.0001-20wt%, more preferably 0.001-10 wt%) of the GSE, a chemotherapeutic agent (e.g., 0.000001-20wt%, preferably 0.00001-10wt%, more preferably 0.0001-2 wt%), and a pharmaceutically acceptable carrier. Furthermore, it will be appreciated that the combination of GSE and chemotherapeutic agent is not essential for ease of clinical administration or as required by the clinical treatment regimen, and that they may be separately divided into separate containers, placed in kits or kits, and used in combination as desired.

The invention also provides a pharmaceutical composition comprising an effective amount (e.g., 0.00001-10wt%, preferably 0.0001-5wt%, more preferably 0.001-2 wt%) of the GSE, and a pharmaceutically acceptable carrier.

As used herein, the "effective amount" refers to an amount that produces a function or activity in and is acceptable to humans and/or animals.

As used herein, the "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents. The term refers to such pharmaceutical carriers: they are not necessary active ingredients per se and are not excessively toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in the composition may comprise liquids such as water, saline, buffers. In addition, auxiliary substances, such as fillers, lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like may also be present in these carriers. The vector may also contain a cell transfection reagent. Pharmaceutical forms suitable for injection include: sterile aqueous solutions or dispersions and sterile powders (for the extemporaneous preparation of sterile injectable solutions or dispersions). In all cases, these forms must be sterile and must be fluid to facilitate the syringe to expel the fluid. Must be stable under the conditions of manufacture and storage and must be resistant to the contaminating effects of microorganisms such as bacteria and fungi.

As used herein, the terms "comprising" or "including" include "comprising," "consisting essentially of, ... … (8230); (constituting) and" consisting of ...(constituting). The term "consisting essentially of" ...means that minor ingredients and/or impurities which do not affect the active ingredients may be present in the composition in minor amounts in addition to the primary active ingredients (e.g., GSE and chemotherapeutic agents). For example, sweeteners may be included to improve taste, antioxidants to prevent oxidation, and other additives commonly used in the art.

The present inventors have found that at relatively low concentrations, the GSE can inhibit the development of SASP with relatively high efficiency. Therefore, as a preferred embodiment of the present invention, when applied to the inhibition of SASP, the concentration of the GSE may be 0.5 to 3uM; preferably 0.8-2 uM; more preferably 1 to 1.5uM (e.g., 1.25 uM).

The present inventors have found that at relatively high concentrations, the GSE can clear senescent cells in the tumor microenvironment with relatively high efficiency. Therefore, as a preferred mode of the invention, when the chemotherapeutic drug is bleomycin and the bleomycin is combined with the GSE, the final concentration of the bleomycin is 30-70 ug/mL, and the final concentration of the GSE is 5-60 uM; preferably, the final concentration of the bleomycin is 40-60 ug/mL, and the final concentration of the GSE is 10-50 uM; more preferably, the final concentration of bleomycin is 45-55 ug/mL, and the final concentration of GSE is 10-35 uM (e.g., 15uM,20uM,25uM, 30uM). As a preferable mode of the invention, the chemotherapeutic drug is mitoxantrone, and when the mitoxantrone is combined with the GSE, the weight ratio of the mitoxantrone to the GSE is 1; preferably, the weight ratio of the mitoxantrone to the GSE is 1; more preferably, the weight ratio of mitoxantrone to GSE is 1. In other embodiments of the invention, the chemotherapeutic agent cisplatin, carboplatin, satraplatin, or cyclophosphamide is administered in a similar manner to mitoxantrone.

It will be appreciated that, knowing the use of the GSE and its mechanism of operation in the tumor microenvironment or SASP environment, various methods well known in the art may be employed to administer GSE and/or chemotherapeutic agents to mammals or humans. These methods are all encompassed by the present invention.

The dosage form of the composition of the present invention may be various, and any dosage form may be used as long as it can allow the active ingredient to efficiently reach the body of a mammal. Such as may be selected from: injection, tablet, capsule, powder, granule, syrup, solution, suspension, tincture, oral liquid, or aerosol.

The effective amount of GSE of the invention may vary with the mode of administration and the severity of the disease to be treated, among other things. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of said GSE such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like.

In the specific examples of the present invention, some dosing regimens for animals such as mice are given. The conversion from the administered dose in animals such as mice to the administered dose suitable for humans is easily done by the person skilled in the art, and can be calculated, for example, according to the Meeh-Rubner formula: meeh-Rubner formula: a = kx (W) ^2/3 )/10,000. Wherein A is the body surface area in m ² Calculating; w is body weight, calculated as g; k is constant and varies with species of animal, in general, mouse and rat 9.1, guinea pig 9.8, rabbit 10.1, cat 9.9, dog 11.2, monkey 11.8, human 10.6. It will be appreciated that the conversion of the dosage administered may vary according to the drug and clinical situation, as assessed by the skilled pharmacist.

The pharmaceutical compositions of the present invention may also be formulated in unit dosage form for on-demand, metered dose administration.

As used herein, the term "unit dosage form" or "unit dosage form" refers to a composition of the present invention that is prepared for ease of administration into a desired dosage form for a single administration, including, but not limited to, various solid (e.g., tablets), liquid forms. The unit dosage form contains a composition of the invention in an amount suitable for single, single day or unit time administration.

In some preferred forms of the invention, the composition is in unit dosage form. When the composition is prepared as a unit dosage form, 1 dose of the composition of the unit dosage form is taken every few days or weeks.

The invention also provides a kit containing the pharmaceutical composition or directly containing the GSE and/or the chemotherapeutic drug. In addition, the kit can also comprise instructions for the use of the drugs in the kit.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBrook et al, molecular cloning, A laboratory Manual, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

1. Cell culture

(1) Cell line maintenance

Normal human prostate primary stromal cell line PSC27 (obtained from Fred Hutchinson Cancer Research Center, USA) at 37 ℃ and 5% ₂ Cultured in a conditioned incubator, propagated and passaged in PSCC complete medium.

(2) Cell cryopreservation and recovery

Freezing and storing cells: cells in the logarithmic growth phase were collected with 0.25% trypsin, centrifuged at 1000rpm for 2min, the supernatant discarded, and the cells resuspended in freshly prepared frozen stock. Subpackaging the cells in the marked sterile freezing tube. Then the temperature is reduced in a gradient way, and finally the mixture is transferred into liquid nitrogen for long-term storage.

Cell recovery: the cells frozen in the liquid nitrogen were taken out and immediately placed in a 37 ℃ water bath to be rapidly thawed. 2ml of cell culture medium was added directly to suspend the cells evenly. After the cells adhere to the wall, the culture solution is replaced by new one.

In vitro experimental treatment: to cause cell damage, bleomycin (BLEOmycin, BLEO) was added to the culture medium at 50. Mu.g/ml when PSC27 cells were grown to 80% (PSC 27-CTRL). After 12 hours of drug treatment, cells were washed briefly 3 times with PBS, left in the culture for 7-10 days, and then subjected to subsequent experiments.

2. Screening of natural product libraries

Pharmacodynamic analysis is carried out on a natural product library (BY-HEALTH) which contains 41 components, is mostly medicinal plant extracts and has anti-aging potential. Each product was diluted to 96-well plates at a density of 5000 cells per well according to a concentration gradient. The culture medium is DMEM, and the working concentration of the natural product (or compound) is controlled to 1. Mu.M-l mM. 3-7 days after drug treatment, cell proliferation was measured using CCK-8 Cell Counting Kit (WST-8 principle, vazyme) and apoptosis activity was determined using Caspase 3/7 activity Kit (Promega).

The preliminarily identified drug candidates were further screened for 30 days. The drug entering the second candidate range was diluted into 6-well plates, 20,000 cells per well. The medium and drug candidates were changed every other day. To determine the effect of each drug on cell phenotype and survival etc., items were validated for different concentrations of drug.

3. Immunoblotting and immunofluorescence detection

Cell lysis-derived proteins were isolated using NuPAGE 4-12% bis-Tris gel and transferred to nitrocellulose membranes. Blots were blocked with 5% skim milk at room temperature for 1h, incubated with the desired primary antibody at 4 ℃ overnight at the concentration agreed by the manufacturer, then incubated with horseradish peroxidase-conjugated secondary antibody (Santa Cruz) for 1h at room temperature, membrane blot signal detection was performed with Enhanced Chemiluminescence (ECL) detection reagent (Millipore) according to the manufacturer's protocol, and ImageQuant LAS 400 Phospho-Imager (GE Healthcare) was used. As a standard Protein marker, the present inventors used PageRuler Plus Prestained Protein Ladder (No. 26619) supplied by Thermo Fisher Scientific, inc.

For immunofluorescent staining, target cells were pre-plated on coverslip for at least 24h after culture in a culture dish. After a brief wash, fixation in PBS was performed for 8min with 4% paraformaldehyde and blocked with 5% normal goat serum (NGS, thermo Fisher) for 30min. Mouse monoclonal antibody anti-phospho-Histone H2A. X (Ser 139) (clone JBW301, millipore) and mouse monoclonal antibody anti-BrdU (Cat #347580, BD Biosciences), and secondary antibody Alexa

488 (or 594) -conjugated F (ab') 2 was sequentially added to the slide glass coated with the fixed cells. Nuclei were counterstained with 2. Mu.g/ml of 4', 6-diaminodino-2-phenylindole (DAPI). And selecting the most representative image from the 3 observation fields for data analysis and result display. FV1000 laser scanning confocal microscope (Olympus) for obtainingTaking a cell confocal fluorescence image.

4. Whole transcriptome sequencing analysis (RNA-sequencing)

Whole transcriptome sequencing was performed on human prostate primary stromal cell line PSC27 under different treatment conditions. Total RNA samples were obtained from stromal cells. The integrity was verified by Bioanalyzer 2100 (Agilent), RNA was sequenced with Illumina HiSeq X10 and the gene expression level was quantified by the software package rsem (https:// deweyab. Github. Io/rsem /). Briefly, rRNA in RNA samples was eliminated with a RiboMinus Eukaryote kit (Qiagen, valencia, CA, USA); and a strand-specific RNA-seq library was constructed with TruSeq Stranded Total RNA preparation kits (Illumina, san Diego, calif., USA) prior to deep sequencing according to the manufacturer's instructions.

Paired-end transcriptional reads were mapped to the reference genome (GRCh 38/hg 38) and annotated for reference from Gencode v27 using the Bowtie tool. Duplicate reads were identified using the picard tools (1.98) script tag duplicate (https:// githu. Com/broadinstruction/picard), leaving only non-duplicate reads. Reference splice junctions are provided by the Reference transcriptome (Ensembl build 73). The FPKM value is calculated by Cufflinks, and the differential gene expression is called by Cufflinks and a maximum likelihood estimation function. Genes whose expression changes significantly are defined by False Discovery Rate (FDR) -corrected P value <0.05, and downstream analysis was performed only with the ensembles genes 73 of state "Known" and biotype "coding".

Trim Reads using Trim Galore (v0.3.0) (http:// www. Bioinformatics. Babraham. Ac. Uk/projects/Trim _ Galore /), while quality assessment uses FastQC (v0.10.0) (http:// www. Bioinformatics. Bbsrc. Ac. Uk/projects/FastQC /). Subsequently, DAVIDBIOINT formats (https:// david. Ncifcrf. Gov /), ingenity Pathway Analysis (IPA) program (http:// www. Ingenity. Com/index. Html) were used. The raw data was initially analyzed on a Majorbio I-Sanger Cloud Platform (www.i-singer.com) freeline Platform and stored in the NCBI Gene Expression Omnibus (GEO) database with the accession code GSE156301.

5. Protein-protein interaction network analysis

Protein-protein interaction (PPI) analysis was performed using STRING 3.0. The specific protein meeting the standard was imported into online analysis software (http:// www. Networkkanalyt. Ca) and a minimal interaction network was selected for further hub and module analysis.

6. Gene Set Enrichment Analysis (GSEA)

Based on the data from the RNA-seq preliminary analysis, genes were ranked using "wald statistics" obtained from DESeq2 and GSEA was performed on these ranked lists of all the sets of programming genes available in MSigDB (http:// software. Broadinstructions. Org/GSEA/MSigDB) for each differential expression significant gene analysis comparison. DESeq2 exponential filtering is based on the average of normalized read counts to screen for genes with very low expression levels. SASP and GSEA signature are described in the inventors literature (Zhang et al, nature Communications,9 (1): 1723.2018).

7. Quantitative PCR (RT-PCR) assay for gene expression

The extraction of total RNA from cells, reverse transcription reaction, real-time quantitative PCR reaction are carried out according to conventional techniques. Wherein, the sequence of the detection primer is (F represents a forward primer, and R represents a reverse primer):

IL6:TTCTGCGCAGCTTTAAGGAG(F；SEQ ID NO:1)，AGGTGCCCATGCTACATTTG(R；SEQ ID NO:2)；

CXCL8:ATGACTTCCAAGCTGGCCGTG(F；SEQ ID NO:3)，TGTGTTGGCGCAGTGTGGTC(R；SEQ ID NO:4)；

IL-1α:AATGACGCCCTCAATCAAAG(F；SEQ ID NO:5)，TGGGTATCTCAGGCATCTCC(R；SEQ ID NO:6)；

IL-1β:TGGGTATCTCAGGCATCTCC(F；SEQ ID NO:7)，TTCTGCTTGAGAGGTGCTGA(R；SEQ ID NO:8)；

GM-CSF:ATGTGAATGCCATCCAGGAG(F；SEQ ID NO:9)，AGGGCAGTGCTGCTTGTAGT(R；SEQ ID NO:10)；

AREG:AGCTGCCTTTATGTCTGCTG(F；SEQ ID NO:11)，TTTCGTTCCTCAGCTTCTCC(R；SEQ ID NO:12)；

CXCL1:CACCCCAAGAACATCCAAAG(F；SEQ ID NO:13)，TAACTATGGGGGATGCAGGA(R；SEQ ID NO:14)；

CXCL3:GGAGCACCAACTGACAGGAG(F；SEQ ID NO:15)，CCTTTCCAGCTGTCCCTAGA(R；SEQ ID NO:16)；

SPINK1:CCTTGGCCCTGTTGAGTCTA(F；SEQ ID NO:17)，GCCCAGATTTTTGAATGAGG(R；SEQ ID NO:18)；

WNT16B:GCTCCTGTGCTGTGAAAACA(F；SEQ ID NO:19)，TGCATTCTCTGCCTTGTGTC(R；SEQ ID NO:20)；

MMP3:AGGGAACTTGAGCGTGAATC(F；SEQ ID NO:21)，TCACTTGTCTGTTGCACACG(R；SEQ ID NO:22)；

p16 ^INK4a :CTTCCTGGACACGCTGGT(F；SEQ ID NO:23)，ATCTATGCGGGCATGGTTAC(R；SEQ ID NO:24)；

p21 ^CIP1 :ATGAAATTCACCCCCTTTCC(F；SEQ ID NO:25)，CCCTAGGCTGTGCTCACTTC(R；SEQ ID NO:26)。

SA-beta-Gal staining

Senescence-associated β -galactosidase (SA- β -Gal) staining can include: the cell culture dishes were washed with PBS and fixed at room temperature. The cells were fixed by exposure to 2% formaldehyde and 0.2 glutaraldehyde for 3 min. SA- β -Gal was then stained with a freshly prepared staining solution overnight at 37 ℃. Images were taken the next day and the percentage of positive cells per unit area was calculated.

9. Cloning and amplification experiment

The single cell clonal amplification experiment comprises: cells were plated onto gelatin-coated 12-well plates at a density of 2000 cells/well. Cell clone numbers were counted after crystal violet staining.

10. Drug-induced apoptosis of senescent cells

PSC27 cells were plated in 96-well dishes and cell senescence was induced under BLEO treatment at 50. Mu.g/ml. Grape Seed Extract (GSE) and ABT263 were added at concentrations of 5.0 μm and 1.0 μm, respectively. The cell culture medium was supplemented with Incucyte Nuclear fast Red reagent (Essen Bioscience) and IncucyteC-3/7 apoptosis reagent (Essen Bioscience). A representative field of view was selected for photographing.

GSE (GSE): obtained from Tangchen Beijian company, and the batch number is C01201911260006.

ABT263: from seleckchem corporation.

11. Inoculation of mouse transplantable tumors and preclinical therapy trials

All experimental mouse experiments were performed strictly following the regulations of the institutional animal care and use committee for Shanghai Life sciences research, chinese academy of sciences (IACUC). Immunodeficient mice (NOD-SCIDMce, ICR) aged 6-8 weeks (approximately 25g in body weight) were used in the animal experiments related to the present invention. Stromal PSC27 and epithelial PC3 (human prostate cancer cells) were mixed in a predetermined ratio of 1 ⁶ Cells for tissue reconstruction. The transplanted tumor was implanted into the mouse by subcutaneous transplantation and the animal was euthanized 8 weeks after the end of the transplantation operation. Tumor volume was calculated according to the following formula: v = (π/6) x ((l + w)/2) ³ (V, volume; l, length; w, width).

In a preclinical treatment trial (local administration, causing damage to the tumor microenvironment and stromal cell senescence), subcutaneously transplanted mice were given a standard experimental diet and 2 weeks later were administered intraperitoneally with the chemotherapeutic drugs mitoxantrone (MIT, 0.2mg/kg dose) and/or Grape Seed Extract (GSE) (500. Mu.l, 10mg/kg dose). The time points are as follows: the former is on the first day of week 3,5,7 and the latter is on the first day of week 5,7. The entire treatment course was given 3 MIT cycles of 2 weeks each. After the course of treatment, mouse tumors were collected for volumetric measurement and histological analysis. Each mouse cumulatively received 0.6mg/kg body weight of MIT and 30mg/kg body weight of GSE.

In order to cause systemic SASP factor to be expressed under chemotherapy induction, MIT was administered to mice by intravenous infusion according to the above procedure and sequence (examining the overall effect of systemic SASP factor expression under chemotherapy induction and GSE controlling the broad-spectrum expression of SASP by eliminating senescent cells from the body's whole body), but the dose was reduced to 0.1mg/kg body weight per dose (cumulative MIT dose of 0.3mg/kg body weight received over the whole course of treatment) to reduce drug-related toxicity. Similarly, the Grape Seed Extract (GSE) dose was reduced to 5mg/kg, administered either in combination with MIT or alone, all by intravenous infusion. Chemotherapy trials were conducted to the end of week 8, and mice were dissected immediately after sacrifice, and their transplantable tumors were collected and used for pathological system analysis.

Meanwhile, in order to determine the effects of other chemotherapeutic drugs in combination with Grape Seed Extract (GSE), the present inventors administered Doxorubicin (DOX), taxane (DOC) and Vincristine (VINCRISTINE) separately or in combination with Grape Seed Extract (GSE) to mice (0.2 mg/kg at a dose on the first day of 3,5,7 weeks; 3 chemotherapy cycles of 2 weeks were administered for the entire treatment period), and the terminal volume of the mice was measured for statistical comparison analysis.

12. Study of mouse Life

In cell transplantation studies, 16 month old male C57BL/6 mice were obtained by continuous feeding on SPF animal platforms, with 4 to 5 animals per cage. Mice were first classified by weight from low to high and then mice of similar weight were selected. Next, a Senium (SEN) or Control (CTRL) transplant treatment regime is assigned to mice once every other interval using a random number generator, while the middle mice are assigned to another treatment regime, thereby matching the body weights of senium and control transplant mice. The body function test was performed 1 month after the cell transplantation, when the mouse was 18 months old. After that, no further testing was performed on these mice except for examining their cages. The earliest deaths occurred approximately 2 months after the last physical function test. 19 to 21 months old C57BL/6 mice, each cage contains 3-5. As with the transplanted mice, the mice were classified by body weight and randomly assigned to each group, and the control group (vehicle) or the drug Group (GSE) treatment was performed by a person who did not know the design of the preclinical test. Mice were treated with vehicle or GSE once every 2 weeks, starting at 24-27 months of age, and were gavaged orally for 3 consecutive days. During the study, some rats were removed from their original cages to avoid as much as possible the dwelling stress of animals kept in a single cage for a long period of time. The RotaRod and hanging tests are performed monthly because these tests are sensitive and non-invasive. At the end of the experiment, mice were euthanized; they are considered dead if they exhibit one of several symptoms: firstly, water cannot be drunk or meals cannot be eaten; (II) unwilling to move even with stimulation; (III) rapidly losing weight; (IV) severe balance impairment; or (V) bleeding or ulceration of the body. During the test, no mice were excluded due to shelving, accidental death or dermatitis. In the biometric analysis, a Cox general wizard model was used for survival analysis.

13. Preclinical animal postmortem pathology examination

The cages were examined daily and the dead rats were removed from the cages. Within 24 hours of death of the animals, the carcasses were opened (abdominal cavity, thorax and skull) and stored in 10% formalin alone for at least 7 days. Decomposed or destroyed bodies are excluded. The preserved cadavers were transported to an Autopsy dedicated site for pathological examination. Tumor burden (sum of different types of tumors per mouse), disease burden (sum of different histopathological changes per mouse major organ), severity of each lesion and inflammation (lymphocyte infiltration) were assessed.

14. Bioluminescent imaging

Mice were injected intraperitoneally with 3mg fluorescein (BioVision, milpitas, calif.) and delivered in PBS at a volume of 200. Mu.l. Mice were anesthetized with isoflurane and bioluminescent images were acquired using the Xenogen IVIS 200 System (Caliper Life Sciences, hopkinton, MA).

15. Physical fitness detection

All tests started on day 5 after the last placebo or drug treatment. The maximum walking speed is evaluated using the accelerated Rotarod System (TSE System, chesterfiltered, MO). Mice were trained on RotaRod for 3 days at rates of 4,6 and 8r.p.m.for 200 seconds on days 1, 2 and 3. On the test day, mice were placed on RotaRod, starting at a speed of 4 r.p.m. At 5 minute intervals, the speed was accelerated from 4 to 40r.p.m. When the mouse falls off the RotaRod, the speed is recorded. The final results were averaged from 3 or 4 trials and normalized to baseline speed. Mice trained within the first two months were not trained.

Forelimb Grip Strength (N) was measured using a Grip Strength Meter (Columbus Instruments, columbus, OH) and results were derived from the average of over 10 trials. To pairIn the suspension endurance test, mice were placed on a 2 mm thick wire, which was positioned 35 cm above the pad. The mice were allowed to grasp the wire with the forelimbs only, and the suspension time was normalized by body weight, expressed as suspension duration (sec) × body weight (g). Results the average of 2 to 3 experiments per mouse was taken. Daily activities and food intake were monitored for 24 hours (12 hours light and 12 hours dark) by a Comprehensive Laboratory Animal Monitoring System (CLAMS). The CLAMS System is equipped with the Oxymax Open Circuit Calorimeter System (Columbus Instruments). For treadmill performance, mice were adapted to run on a motorized treadmill (Columbus Instruments) at a 5 ° incline for 3 days of training lasting 5 minutes each day, starting 2 minutes at 5 meters/minute, then accelerating to 7 meters/minute for 2 minutes, then 9 meters/minute for 1 minute. On the day of the experiment, the mice were run on a treadmill for 2 minutes at an initial speed of 5 meters/minute, and then increased in speed by 2 meters/minute every 2 minutes until the mice were exhausted. Fatigue is defined as the inability of a mouse to return to a treadmill even with slight electrical and mechanical stimulation. The distance was recorded after the end of the test and the total work (KJ) was calculated using the following formula: mass (kg). Times.g (9.8 m/s) ² ) X distance (m) × sin (5 °).

16. Biometric method

All in vitro experiments related to cell proliferation rate, survival rate, SA-beta-Gal staining and the like, and in vivo experiments related to mouse transplantable tumors and preclinical drug treatment are repeated for more than 3 times, and data are presented in a mean value +/-standard error mode. Statistical analysis was based on the raw data, calculated by one-way analysis of variance (ANOVA) or a two-dimensional Student's t-test, and results with P <0.05 were considered to be significantly different.

The correlation between factors was examined by Pearson's correlation coefficients. Survival analysis was performed using a Cox reporting hazard model when mice were obtained in several cohorts and grouped in cages. The model uses the sex and age of treatment as a fixed effect, cohorts and initial cage assignment as random effects. Since some mice were moved from the original cages in the study to minimize pressure from a single cage shell, the inventors also performed an analysis without a cage effect. The results of the two analyses have no great difference in directional or statistical sense, and the confidence level of the results is enhanced. Survival analysis statistical software R (version 3.4.1; library 'coxme') was used. In most experiments and evaluation of results, researchers have taken blind selections for assignment. The present invention uses baseline body weight to assign mice to experimental groups (to achieve similar body weights between groups) and therefore randomization was performed only in groups matched to body weight. The present invention determines the sample size according to the past experiment, and thus, the statistical power analysis is not used. All replicates in the present invention were from different samples, each from a different experimental animal.

Example 1 screening of drugs inhibiting SASP expression

To identify novel compounds that effectively modulate the phenotype of senescent cells, the present inventors developed an unbiased screen using a natural stock drug library consisting of 41 plant derivatives. To test the potency and potential biological value of these drugs, the inventors chose to use primary normal human prostate stromal cell line, PSC27, as an in vitro cell model. PSC27 is composed primarily of fibroblasts, but not fibroblast lines (including endothelial cells and smooth muscle cells) are present, but in a small proportion, PSC27 is a primary stromal cell line of human origin in nature, forming a typical SASP upon exposure to stress factors such as genotoxic chemotherapy or ionizing radiation.

The inventors treated these cells with Bleomycin (BLEO) at a specific dose (50 μ g/ml) in a manner optimized in preliminary experiments and observed a significant increase in the positivity of senescence-associated β -galactosidase (SA- β -GAL) staining, a significant decrease in BrdU incorporation, and a significant increase in DNA damage repair foci (DDR foci) within days following drug damage (fig. 1-3). The effect of drug products on the expression profile of senescent cells was compared in parallel by means of a systematic screen (figure 4).

The present inventors performed RNA-seq sequencing on these cells. And subsequently obtained high throughput data indicates that a plant material, grape Seed Extract (GSE), significantly altered the expression profile of senescent cells. Of these, 2644 genes appeared to be significantly down-regulated while 1472 genes were up-regulated, where the fold change for each gene in heatmap was 2.0 (P < 0.01) (fig. 5). Importantly, the expression of SASP factors is generally reduced in senescent cells following GSE treatment (50. Mu.g/ml), and these SASP factors are generally significantly upregulated in senescent cells (FIG. 6). Data from GSEA analysis further revealed significant inhibition of molecular features characterizing either SASP expression or NF- κ B activation, the latter being the major transcriptional event mediating the development of pro-inflammatory SASPs (fig. 7). The results of the credit analysis based on protein-protein interactions showed a highly active network involving a number of factors that were significantly upregulated during cellular senescence and that were instead downregulated once the cells were under GSE (figure 8). Further GO bioinformatic data suggest that these molecules are functionally involved in a group of important biological processes including signal transduction, cell-cell communication, energy regulation, cell metabolism and inflammatory responses (fig. 9). Most of these down-regulated genes, biochemical in nature, are proteins that are released into the extracellular space upon expression, or are located on the endoplasmic reticulum or golgi apparatus, and are generally consistent in character with the secretory nature of these molecules (fig. 10).

To further demonstrate the effect of GSE on SASP expression under in vitro conditions, the inventors treated PSC27 cells at a series of in vitro gradient concentrations. The data show that GSE at working concentration of 1.25 μ M inhibits the development of SASP with maximal efficiency (figure 11). However, the efficacy of lower or higher concentrations of this drug is less than ideal, although the latter may be associated with cellular stress caused by increased cytotoxicity of this drug (FIG. 11). Thus, GSE, a plant-derived natural product, may be used to control the pro-inflammatory phenotype of senescent cells, namely SASP, and demonstrates optimal efficacy, especially when used at relatively low concentrations.

Therefore, GSE can effectively inhibit the expression of SASP when used at low concentrations (e.g., 1.25 μ M).

Example 2 GSE is a novel Senolytics

In view of the significant efficacy of GSE in controlling BLEO-induced (50 μ g/ml) expression of SASP, it was necessary to next explore the potential of this natural product to kill senescent cells at higher concentrations. To this end, the inventors measured the percent survival of senescent cells treated under in vitro conditions as the concentration of GSE increases. The SA- β -GAL staining data indicated that senescent cells were not eliminated until the GSE concentration reached 5 μ M (FIG. 12). The killing effect of GSE on senescent cells (80% staining positive) was further enhanced with increasing concentration, while the threshold was reached when GSE was at 25 μ M (20% remaining at senescent cells); the killing effect of GSE was not further significantly enhanced when its concentration was increased to 50 μ M (fig. 12; fig. 13).

To further dissect these problems, the inventors conducted confirmatory experiments. Cell viability assays indicated that GSE induced significant death of senescent cells starting from 5 μ M concentration compared to its proliferative state control cells (figure 14). When the GSE concentration was increased to 50 μ M, the percentage of surviving senescent cells dropped to about 10%. However, even at a GSE of 50. Mu.M, the number of proliferating cells was not significantly reduced. These results demonstrate the high selectivity and outstanding specificity of GSE for senolytics, a feature that is actually essential for senolytics as a unique class of anti-aging drugs.

The inventors next investigated the potential of stromal cells for Population Doubling (PD) after genotoxic treatment. The combined treatment group of BLEO and GSE showed significantly increased PD capacity compared to BLEO group cells that entered the growth arrest state rapidly after the invasive treatment (fig. 15). Interestingly, however, GSE itself did not appear to affect PD of proliferating cells, and this data further suggests a selectivity of GSE between senescent cells and normal cells.

To investigate whether GSE caused senescent cells to lose viability by inducing apoptosis, the present inventors treated proliferating cells and senescent cells, respectively, with GSE under culture conditions. PSC27 cells were gradually advanced to the senescence stage after 12h treatment with BLEO (50. Mu.g/ml) under culture conditions; addition of media for senescent cells started on day 7 with 5 μ M of GSE. The change result of caspase-3/7 activity is observed subsequently, which indicates that GSE causes the apoptosis of senescent cells; statistical differences occurred between the senescent group and the control group starting from the 16 th hour after GSE addition (fig. 16). In addition, the actual effect of the pan-caspase inhibitor QVD on preventing the killing of senescent cells by GSE was very similar to that of ABT263 (positive control, a known inducer of apoptosis in senescent cells) (fig. 17). The above series of results demonstrate that GSE promotes the apoptotic entry of senescent cells into the death program by inducing apoptosis, but that proliferating cells are not substantially targeted by this natural drug.

Given the apparent effect of GSE on the generation of senescent cells, the inventors subsequently analyzed the potential of GSE to induce apoptosis. Flow cytometry data showed that senescent PSC27 cells had significantly decreased viability while their proportion of apoptosis was significantly increased, but the changes in proliferating cells were not apparent (fig. 18; fig. 19). Thus, the data consistency of the present inventors supports that GSE causes the elimination of senescent cells by means of inducing apoptosis, and this natural product has outstanding potential in targeting senescent cells.

Example 3 therapeutic targeting of senescent cells by GSE can promote tumor regression and reduce chemotherapy resistance

Given the outstanding selectivity of GSE in clearing senescent cells at higher concentrations in vitro, the present inventors next considered whether this drug could be utilized to intervene in vivo in age-related diseases. Cancer is one of the major chronic diseases that severely threatens human life and endangers health. In addition, cancer cell resistance limits the efficacy of most anticancer therapies in the clinic, while senescent cells often promote the development of therapeutic resistance by developing SASP in damaged tumor foci. Even so, the feasibility and safety of eliminating senescent cells from primary tumors to promote a cancer therapeutic index has not been explored to date by scientists.

First, the present inventors constructed tissue recombinants, which are typical of highly malignant prostate cancer cell lines, by mixing PSC27 stromal cells (primary cells (CTRL group) or senescent cells (SEN group, i.e., BLEO lesion group)) with PC3 epithelial cells. Before subcutaneous implantation of recombinants on the posterior thigh of non-obese diabetic and severe combined immunodeficiency (NOD/SCID) experimental mice, the ratio of the number of stromal cells to epithelial cells was 1:4. the size (volume) of the tumor was measured at the end of 8 weeks after the recombinant was implanted in the animal (fig. 20). The size of xenografts (xenograft) consisting of PC3 cells and senescent PSC27 cells was significantly increased (P < 0.001) compared to tumors consisting of PC3 cancer cells and primary PSC27 stromal cells, this difference again confirming the key promoting role of senescent cells in tumor progression (fig. 21).

To more closely approximate the clinical situation, the inventors specifically designed a preclinical regimen involving genotoxic chemotherapeutic drug treatment and/or aging drug intervention (fig. 22). Two weeks after subcutaneous implantation, when stable uptake of the tumor in vivo was observed, experimental animals were provided with a single dose of MIT (MITOXANTRONE) or placebo on the first days of weeks 3,5 and 7, respectively, until the 8-week protocol was completely terminated. MIT administration significantly delayed tumor growth compared to placebo treatment group, confirming the efficacy of MIT as a chemotherapeutic agent (44.0% reduction in tumor size, P < 0.0001) (fig. 23). It is noteworthy that although GSE itself did not induce tumor shrinkage, GSE administration significantly reduced tumors in mice post-MIT treatment (55.2% tumor volume compared to MIT, P <0.001; 74.9% tumor volume compared to placebo, P < 0.0001) (fig. 23).

Next, the inventors concluded whether cellular senescence occurred in the foci of tumors in these animals. The results of the tests demonstrated that the administration of MIT induced the appearance of a large number of senescent cells in tumor tissues. However, GSE administration substantially depleted most of the senescent cells in the lesions of these chemotherapy animals (FIG. 24; FIG. 25). Laser Capture Microdissection (LCM) and subsequent quantitative PCR results indicated that after MIT administration, the expression of SASP factors was significantly elevated, including IL6, CXCL8, SPINK1, WNT16B, GM-CSF, MMP3, IL 1A, a trend that was accompanied by the aging marker p16 for the chemotherapeutics animals ^INK4A Up-regulation (fig. 26). Interestingly, these changes occur primarily in stromal cells, not their neighboring cancer cells, suggesting the possibility of re-proliferation of residual cancer cells that have developed acquired resistance in the treatment of damaged TME. However, this change was largely reversed upon administration of GSE, as was the caseAs shown by the results of horizontal data analysis (fig. 27).

To investigate the mechanisms that directly support the expression of SASP and the reversal of this senescence-associated pattern in MIT-dosed mice, the present inventors dissected the tumor load in these two drug-treated animals 7 days after the first GSE administration, a time point of 7 days after administration was chosen mainly because cancer cell-resistant clones in the lesions had not yet formed. MIT administration resulted in a significant increase in both DNA damage and apoptosis compared to placebo. Although GSE alone did not induce DNA damage or cause apoptosis, the chemotherapeutic drug MIT highly upregulated both indicators (fig. 28). However, when MIT treated animals were used with GSE, the index of DNA damage or apoptosis in tumor foci was significantly enhanced, which means that tumor site cytotoxicity was enhanced in animals under these aging drug-treated conditions. As supportive evidence, caspase 3cleavage activity was elevated when GSE was therapeutically applied, a typical marker of apoptosis (fig. 29).

The inventors next compared the survival of animals from different drug-treated groups, primarily in a time-extended manner to assess the consequences of tumor progression. In this preclinical cohort, animals were monitored for tumor growth as soon as the tumor burden in the mice was prominent (> 2000mm size) ³ ) It is judged that a serious disease has occurred, which is a method for the progress of a disease such as a tumor in some cases. Mice receiving MIT/GSE combination treatment showed the longest median survival, which was extended by at least 48.1% compared to the group receiving MIT treatment alone (figure 30, green compared to blue). However, treatment of tumor-bearing mice with GSE alone did not result in significant benefit, with only marginal survival extension.

Notably, the treatments performed in these studies appear to be well tolerated by the experimental mice. The inventors did not observe significant fluctuations in urea, creatinine, liver enzymes or body weight (fig. 31; fig. 32). More importantly, the chemotherapeutic and anti-aging drugs used at the various doses contemplated by the present invention did not significantly interfere with the integrity of the immune system and tissue homeostasis of critical organs, even in immunocompromised wild-type mice (fig. 33; fig. 34). These results consistently demonstrate that anti-aging agents in combination with conventional chemotherapeutic drugs have the potential to enhance tumor response in a general sense without causing severe systemic toxicity.

The inventors also compared the effects of MIT, BLEO and some other chemotherapeutic drugs with GSE and showed that doxorubicin + grape seeds were significantly less potent than MIT + grape seeds, BLEO + grape seeds (fig. 47). In addition, to determine the effects of other chemotherapeutic drugs in combination with Grape Seed Extract (GSE), the present inventors also administered taxane (DOC) and Vincristine (VIN) separately or in combination with Grape Seed Extract (GSE) to mice and measured the terminal volume of the mice. The results show that these chemotherapeutic agents, taken alone, significantly reduced tumor size, but did not achieve the effects of mitoxantrone in combination with GSE (fig. 48-49). That is, the addition of Grape Seed Extract (GSE) did not show significant synergy based on the inhibition of tumor growth by taxanes (DOC) or Vincristine (VIN). These data indicate that the characteristics of Grape Seed Extract (GSE) to enhance the effect of chemotherapy treatment are not universal, but rather drug dependent, a specific phenomenon under the conditions of use in combination with specific genotoxic drugs.

Therefore, it is preferred that genotoxic drugs such as mitoxantrone and bleomycin be used in combination with GSE.

Example 4 depletion of senescent cells by GSE treatment can alleviate body dysfunction and prolong the late life of aging mice without increasing their incidence in later stages of life

Since GSE has the effect of eliminating senescent cells, reducing tumor resistance and enhancing overall therapeutic efficacy in the tumor microenvironment of mice, there is also some significant benefit to naturally aging animals in promoting health or delaying disease? To answer this question, the inventors first tested the potential of GSE to eliminate senescent or control cells expressing luciferase (luciferase, LUC) injected intraperitoneally into Wild Type (WT) mice. The bioluminescence intensity at the relevant sites in vivo was significantly reduced in the mice transplanted with GSE-treated LUC-senescent cells compared to that of Vehicle-treated mice (FIG. 35). However, no significant difference was observed between the Vehicle group and the GSE group after treatment of mice transplanted with LUC control cells (proliferative, non-senescent) in vivo (fig. 36). These data further support that GSE can selectively kill senescent cells in the tissue microenvironment.

To determine the role played by senescent cells in physiological dysfunction in aged mice, the inventors treated non-transplanted WT mice at 20 months of age with GSE, with placebo (Vehicle) as a parallel control. Treatment was given intermittently for 4 months (fig. 37). The results indicate that GSE reduced the physical dysfunction of mice, mainly manifested in significantly improved maximum walking speed, suspension endurance, grip strength, treadmill endurance, and daily activity (fig. 38). The food intake of the GSE-administered group also tended to be increased compared to the group treated with Vehicle, although not to a statistically significant degree (P =0.1682, fig. 38). In addition, there was a general decrease in the expression of several important SASP components of stromal cells in the visceral tissue microenvironment of aged mice in the GSE-treated group (fig. 39), further indicating that both the number of senescent cells at the tissue level and their resulting effects have been effectively controlled.

The inventors further considered whether a method with potential transformation value could be used to eliminate senescent cells, namely: can an intermittent treatment be started from a certain time point of very old age to extend the remaining life of WT mice (fig. 40)? For this, a series of in vivo tests were performed accordingly. It is noteworthy, and quite surprising, that the GSE group, administered starting from 24-27 months of age (corresponding to 75-90 years of age in humans), had a 64.2% increase in median survival after treatment over the Vehicle group with a lower risk of death (HR =0.35, GSE/Vehicle group; or HR =2.857, vehicle/GSE group, P < 0.0001) under a biweekly drug regimen (fig. 41, fig. 42). This finding suggests that GSE-mediated clearance of senescent cells may reduce the risk of death and effectively prolong survival in older mice.

To further examine whether this therapeutic regimen, which reduces mortality in older mice, is at the expense of increased body late morbidity, the inventors evaluated the body function of these mice. Although the residual life of the GSE group mice was longer, the GSE-dosed once every two weeks did not significantly decrease in physical function during the last 2 months of life as compared to the Vehicle-treated mice in male and female sexes, respectively ((fig. 43, fig. 44). Furthermore, there was no statistical difference between the mice and the disease prevalence and tumor burden of several age-related diseases at necropsy of mice (fig. 45, fig. 46).

Example 5 drug screening

1. Screening for potential Agents inhibiting the senescence-associated secretory phenotype

And (3) screening system: experimental system as described in example 2: PSC27 cells were gradually advanced to the senescence stage after 12h treatment with BLEO (50. Mu.g/ml) under culture conditions; 5 μ M GSE was added to the senescent cell culture starting on day 7. The treatment with grape seed extract is carried out before, during or after inducing the system to develop the senescence-associated secretory phenotype.

Test group: administering a candidate substance to the screening system;

control group: the candidate substance is not administered to the screening system.

Respectively detecting SASP in the test group and the control group, determining the expression condition of SASP factors, and if the expression of the SASP factors in the test group is significantly lower than that of the control group, the candidate substance is a potential substance which can be combined with the grape seed extract to inhibit the aging-related secretion phenotype.

2. Screening potential substances for inhibiting tumor

Screening system: the experimental system as described in example 3: the PSC27 stromal cells were mixed with PC3 epithelial cells to construct a tissue recombinant.

Test group: administering a candidate substance to the screening system;

control group: the candidate substance is not administered to the screening system.

Respectively detecting the conditions of the observed tumor microenvironment systems in the test group and the control group; if the test group has a significantly increased senescent cell death and a significantly decreased population doubling time of stromal cells compared to the control group after the candidate substance is added, the candidate substance is a potential substance for inhibiting tumors.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai Nutrition and health institute of Chinese academy of sciences

Application of grape seed extract in preparation of drugs for targeted removal of tumor microenvironment senescence cells and inhibition of tumors

<130> 208299

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> primers (Primer)

<400> 1

ttctgcgcag ctttaaggag 20

<210> 2

<211> 20

<212> DNA

<213> primers (Primer)

<400> 2

aggtgcccat gctacatttg 20

<210> 3

<211> 21

<212> DNA

<213> primers (Primer)

<400> 3

atgacttcca agctggccgt g 21

<210> 4

<211> 20

<212> DNA

<213> primers (Primer)

<400> 4

tgtgttggcg cagtgtggtc 20

<210> 5

<211> 20

<212> DNA

<213> primers (Primer)

<400> 5

aatgacgccc tcaatcaaag 20

<210> 6

<211> 20

<212> DNA

<213> primers (Primer)

<400> 6

tgggtatctc aggcatctcc 20

<210> 7

<211> 20

<212> DNA

<213> primers (Primer)

<400> 7

tgggtatctc aggcatctcc 20

<210> 8

<211> 20

<212> DNA

<213> primers (Primer)

<400> 8

ttctgcttga gaggtgctga 20

<210> 9

<211> 20

<212> DNA

<213> primers (Primer)

<400> 9

atgtgaatgc catccaggag 20

<210> 10

<211> 20

<212> DNA

<213> primers (Primer)

<400> 10

agggcagtgc tgcttgtagt 20

<210> 11

<211> 20

<212> DNA

<213> primers (Primer)

<400> 11

agctgccttt atgtctgctg 20

<210> 12

<211> 20

<212> DNA

<213> primers (Primer)

<400> 12

tttcgttcct cagcttctcc 20

<210> 13

<211> 20

<212> DNA

<213> primers (Primer)

<400> 13

caccccaaga acatccaaag 20

<210> 14

<211> 20

<212> DNA

<213> primers (Primer)

<400> 14

taactatggg ggatgcagga 20

<210> 15

<211> 20

<212> DNA

<213> primers (Primer)

<400> 15

ggagcaccaa ctgacaggag 20

<210> 16

<211> 20

<212> DNA

<213> primers (Primer)

<400> 16

cctttccagc tgtccctaga 20

<210> 17

<211> 20

<212> DNA

<213> primers (Primer)

<400> 17

ccttggccct gttgagtcta 20

<210> 18

<211> 20

<212> DNA

<213> primers (Primer)

<400> 18

gcccagattt ttgaatgagg 20

<210> 19

<211> 20

<212> DNA

<213> primers (Primer)

<400> 19

gctcctgtgc tgtgaaaaca 20

<210> 20

<211> 20

<212> DNA

<213> primers (Primer)

<400> 20

tgcattctct gccttgtgtc 20

<210> 21

<211> 20

<212> DNA

<213> primers (Primer)

<400> 21

agggaacttg agcgtgaatc 20

<210> 22

<211> 20

<212> DNA

<213> primers (Primer)

<400> 22

tcacttgtct gttgcacacg 20

<210> 23

<211> 18

<212> DNA

<213> primers (Primer)

<400> 23

cttcctggac acgctggt 18

<210> 24

<211> 20

<212> DNA

<213> primers (Primer)

<400> 24

atctatgcgg gcatggttac 20

<210> 25

<211> 20

<212> DNA

<213> primers (Primer)

<400> 25

atgaaattca ccccctttcc 20

<210> 26

<211> 20

<212> DNA

<213> primers (Primer)

<400> 26

ccctaggctg tgctcacttc 20

Claims (7)

1. The grape seed extract is used in combination with chemotherapeutic drugs to prepare a composition for specifically targeting and eliminating senescent cells in a tumor microenvironment and inhibiting tumors; wherein the chemotherapeutic drug is mitoxantrone which induces the aging-related secretory phenotype of the tumor microenvironment after administration; the composition takes mitoxantrone and grape seed extract as main active ingredients, and the weight ratio of the mitoxantrone to the grape seed extract is 1 to 40-60;

the tumor is prostate cancer which produces a senescence-associated secretory phenotype in the tumor microenvironment after mitoxantrone treatment and/or resistance to mitoxantrone treatment.

2. The use of claim 1, wherein the senescence-associated secretory phenotype is a senescence-associated secretory phenotype caused by DNA damage.

3. The use of claim 2, wherein the DNA damage is DNA damage caused by a chemotherapeutic agent.

4. The use of claim 1, wherein the grape seed extract is specifically targeted to induce apoptotic processes in the tumor microenvironment and promote stromal cell growth.

5. The use of claim 1, wherein the weight ratio of mitoxantrone to grape seed extract is 1.

6. A method of preparing a pharmaceutical composition or kit for inhibiting a tumor, comprising: mixing the grape seed extract with chemotherapeutic agents; or, the grape seed extract and the chemotherapeutic drug are placed in the same medicine box, wherein the chemotherapeutic drug is mitoxantrone, and the weight ratio of the mitoxantrone to the grape seed extract is 1-60;

the tumor is prostate cancer which produces a senescence-associated secretory phenotype in the tumor microenvironment after mitoxantrone treatment and/or resistance to mitoxantrone treatment.

7. The method of claim 6, wherein the weight ratio of mitoxantrone to grape seed extract is 1.

Images