CN114369602B - VlbZIP30 gene for promoting synthesis of anthocyanin and application thereof - Google Patents

Abstract

The invention discloses a VlbZIP30 gene for promoting the synthesis of anthocyanin and application thereof, wherein the full length of a complete open reading frame sequence of the gene is 978bp, and 325 amino acids are coded. Constructing a pCAMBIA2300-35s-3 XFlag-VlbZIP 30 overexpression vector, and stably transferring the vector into Thomson 'seedless white' grapes by an agrobacterium-mediated genetic transformation method. The result shows that the anthocyanin content in the leaves and stems of the over-expressed transgenic plant is obviously improved, the genes promote the synthesis of cyanidin-3-O-glucoside, delphinidin-3-O-glucoside, peoniflorin-3-O-glucoside, morning glory anthocyanin-3-O-glucoside, malvidin-3-O-glucoside and other anthocyanins by regulating the expression of key genes for anthocyanin biosynthesis, so that the accumulation of anthocyanin in the plant is improved, and the leaves and stems of the white grape variety are promoted to turn red from green.

Description

VlbZIP30 gene for promoting synthesis of anthocyanin and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a VlbZIP30 gene for promoting synthesis of vitis vinifera cyanin and application thereof.

Background

Anthocyanins are a class of water-soluble flavonoids that are present in almost all vascular plants and have been shown to have many important biological functions. For example, they appear orange, red, purple and blue depending on the change in pH and are widely present in fruits, seeds, petals, roots and leaves of plants, and thus play an important role in attracting pollination media (insects or animals) to facilitate the spread of pollen and seeds by plants; anthocyanin can also be used as a protective agent against ultraviolet rays and is involved in stress reaction of plants. In addition, anthocyanin has strong antioxidant capacity, and can provide various health promoting capabilities for human, such as delaying aging, treating cardiovascular diseases, resisting inflammation, resisting bacteria and resisting cancer.

Anthocyanin is the end product of flavonoid pathway, which is mainly synthesized by a series of enzymes located in endoplasmic reticulum cytoplasm, mainly including chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonoid 3 '-hydroxylase (F3' H), and flavonoid 3'5' -hydroxylase (F3 '5'H), flavanonol 4-reductase (DFR), leucoanthocyanidin Dioxygenase (LDOX), anthocyanin synthase (ANS), glutathione transferase (GST), UDP-glucose flavonoid 3-O-glucosyltransferase (UFGT), and the like; the expression of these structural genes involved in anthocyanin biosynthesis is often regulated by transcription factors, and in the anthocyanin synthesis pathway, the transcription factors are often located at the upstream position of a gene regulation network, so that the transcription factors play an important role in the synthesis pathway, and thus, the transcription factor family genes involved in regulating anthocyanin synthesis are discovered to be MYB, bHLH, NAC, WRKY, ERF, bZIP and the like so far. And studies on anthocyanin synthesis have been successively reported in many plants, such as arabidopsis, apple, grape, lychee, strawberry, pear, peach, etc.

The grapes are the second economic fruit tree in the world, have very important edible value and economic value, are mainly fresh-eaten, brewed and dried, and can be processed into fruit vinegar or converted into health care products beneficial to human health. Therefore, the grapes play an important role in agricultural production and regional economic development in China. The accumulation of flavonoids in grape pericarp and seeds not only determines the color of the wine, but also affects the final flavor and astringency of red and white wines when extracted from mature berries, making flavonoids a factor that effectively determines product quality. In the early stage of grape berry development, various components in pericarp and seed can synthesize proanthocyanin, and then from the color transfer stage to the mature stage, flavonoid pathway is opened, anthocyanin begins to be synthesized and accumulated, so that pigment in red grape skin is generated, and a transcription factor plays an important role in the process. Grape transcription factors which have been proved to regulate anthocyanin biosynthesis at present are VvMYBA1, vvMYBA7, vvMYB6.1, vvMYB7, vvMYB5a, vvMYB5b, vvMYBC2-L1, vvMYBC2-L3, vvWRKY26, vviHY5, vviHYH and MaAN2. However, most of them were only functionally verified in model plants (tobacco or petunia), with few genes verified in homologous system grapes (VvMYBA 1, vvMYBC2-L1, vvMYB6.1 and VvMYB 7).

The bZIP family of transcription factors is the most widely distributed, most conserved class of proteins in eukaryotes. Studies have shown that bZIP transcription factor family genes have many important biological functions, such as expression of seed storage genes, plant growth and development, light signal transduction, disease defense, abiotic stress response, etc., however, there have been few studies on the function of the grape bZIP gene. The invention clones the gene VlbZIP30 of the bZIP family from a hybrid grape variety (vitas labrusca: V.labrusca. V.vinifera) 'Kyoho', successfully transforms the gene into 'Seedless white' (Thompson Seedless) grapes by an agrobacterium-mediated stable genetic transformation method, discovers that stems and leaves of transgenic Seedless white grapes over expressing the VlbZIP30 are obviously red by phenotype observation, speculates that the gene plays a very important role in participating in an anthocyanin biosynthesis pathway, further explores the gene function of regulating anthocyanin synthesis by the VlbZIP30 and a possible action mechanism thereof, provides a molecular theory basis and available gene resources for improving grape fruit quality, and has important theoretical significance and application value for accelerating breeding of new high-quality grapes.

Disclosure of Invention

The invention aims to provide a VlbZIP30 gene for promoting the synthesis of the anthocyanin, and proves the function of the gene in the aspect of improving the content of the anthocyanin.

The technical scheme adopted by the invention is that the VlbZIP30 gene for promoting the synthesis of the anthocyanin of the grape is characterized in that the coding region sequence of the gene is as follows:

the VlbZIP30 gene coded protein has the amino acid sequence as follows:

the invention adopts another technical scheme that the VlbZIP30 gene for promoting the synthesis of the anthocyanin of the grapes is applied to the improvement of the anthocyanin content of the grapes.

The invention has the beneficial effects that:

the 'Kyoho' VlbZIP30 gene of the European and American hybrid grape variety can obviously improve the synthesis of the anthocyanin. The VlbZIP30 gene disclosed by the invention is used for promoting the synthesis of anthocyanin by regulating the expression of anthocyanin biosynthesis key genes such as VvCHI1, vvCHS3, vvF3H, vvF3'H, vvFLS and the like so as to promote the synthesis of anthocyanin biosynthesis key genes such as pelargonidin-3-O-glucoside, peoniflorin-3-O-arabinoside, cyanidin-3-O-glucoside, cyanidin-3-O-galactoside, peoniflorin-3-O-glucoside, delphinidin-3-O-glucoside, morning glory-3-O-glucoside, cyanidin-3-O- (6' -acetyl glucoside), peoniflorin-3- (6 '-acetyl glucoside), malvidin-3-O-malonyl glucoside, cyanidin-3-O- (6' -p-coumaroyl glucoside) and peoniflorin-3763 zft 3763-O-diglucoside and the like, so as to improve the biosynthesis function of anthocyanin.

Drawings

FIG. 1 is the anthocyanin content of VlbZIP30 transgenic grape lines (# 24, #25, and # 27) compared to wild control (WT); panel A is a phenotypic observation of wild control (WT) and VlbZIP30 overexpressing transgenic grape lines (# 24, #25, and # 27) at 4-month seedling age; panel B is a graph of anthocyanin content in 5-month-old leaves of wild control (WT) and VlbZIP 30-overexpressing transgenic grape lines (# 24, #25, and # 27); panel C is a graph of anthocyanin content in 4-month-old shoots of wild control (WT) and VlbZIP 30-overexpressing transgenic grape lines (# 24, #25, and # 27); * Indicates a very significant difference compared to wild controls (. About.p <0.01, student's t-test);

FIG. 2 is a broad target metabolome assay performed on 4 month old wild control (WT) and VlbZIP30 transgenic grape line (# 25); panel a is the number of different differentially enriched metabolite components; panel B is the number of different differentially enriched flavonoid components;

FIG. 3 is a diagram of the mechanism of VlbZIP30 involved in regulating the biosynthesis of vitis vinifera anthocyanins; the heatmap in panel A represents transcriptional regulation of a Differentially Expressed Gene (DEG) associated with flavonoid metabolism in leaves of transgenic (# 25) and wild-type (WT) plants; the heat maps in panel B represent the relative accumulation levels of differentially enriched metabolites associated with flavonoid metabolism in #25 and WT plants;

FIG. 4 is a graph showing the analysis of expression levels of flavonoid biosynthetic genes induced to VlbZIP30 expression in leaves of transgenic lines (# 24, #25 and # 27) and Wild Type (WT) plants by quantitative real-time (qRT) -PCR; asterisks indicate statistical significance between transgenic and WT plants (. About.p <0.01,. About.0.01 straw P-straw 0.05, student t-test).

Detailed Description

The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

The invention constructs a pCAMBIA2300-35s-3 XFlag-VlbZIP 30 over-expression vector, and introduces the vector into the seedless white grapes by an agrobacterium-mediated genetic transformation method. The situation of anthocyanin accumulation of a transgenic strain with excessive expression of 'Kyoho' VlbZIP30 of the European and American hybrid grape variety and a wild control under normal growth conditions is researched.

The inventor designs a specific primer according to the CDS sequence of the VvbZIP30 of European grape black bino (vitas vinifera) by utilizing a homologous cloning technology, takes the first strand of cDNA synthesized by reverse transcription of the total RNA of the leaf of European and American hybrid grape variety 'Kyoho' (Kyoho) as a template, amplifies the open reading frame sequence of the VlbZIP30, and the whole open reading frame sequence of the gene has the full length of 978bp and codes 325 amino acids.

In order to research the biological function of the 'Kyoho' VlbZIP30 gene of European and American hybrid grape varieties in homologous system grapes, the inventor constructs a pCAMBIA2300-35s-3 XFlag-VlbZIP 30 (the enzyme cutting sites are XbaI and KpnI) overexpression vector, overexpresses the vector in Thompson 'Seedless' (Thompson Seedless) grapes, and analyzes the biological function of the gene. Phenotypic observations found that under normal growth conditions, leaves and stems of 4-month-old transgenic plants were significantly reddened compared to wild controls. After content extraction, the anthocyanin content in the leaves and stems of the transgenic plants is obviously higher than that of the wild control.

To further understand which anthocyanin metabolites are specifically involved in the accumulation of the VlbZIP30, a broad-target metabolome assay was performed on 4-month-old wild-type controls and transgenic plants, and as a result, it was found that under normal growth conditions, there were 435 metabolites different from the wild-type controls in transgenic plants, 227 metabolites were significantly increased and 208 metabolites were decreased. The inventors have counted the remarkably accumulated metabolites and found that the metabolites are mainly flavonols, flavanols, flavanones, flavanols, proanthocyanins, anthocyanins, and the like. Wherein the anthocyanin which is obviously accumulated mainly comprises cyanidin-3-O- (6 ' -O-acetyl) glucoside, delphinidin-3-O- (6 ' -O-feruloyl) glucoside, cyanidin-3-O- (6 ' -O-caffeoyl) glucoside, paeoniflorin-3,5-O-diglucoside, cyanidin-3-O- (6 ' -O-p-coumaroyl) glucoside, peoniflorin-3-O- (6 ' -O-caffeoyl) glucoside, morning glory-3-O- (6 ' -O-caffeoyl) glucoside, malvidin-3-O- (6 ' -O-caffeoyl) glucoside, etc. The results show that under normal growth conditions, the anthocyanin content in the transgenic plants is significantly higher than that of the wild control. The over-expression of the VlbZIP30 gene of European and American hybrid grape variety 'Kyoho' obviously promotes the synthesis of anthocyanin in grapes.

To further understand the mechanism of action of VlbZIP30 in anthocyanin biosynthesis, transcriptome sequencing was performed on wild type and transgenic plants of 4-month age, and it was found that under normal growth conditions, 1796 differentially expressed genes were up-regulated and 1398 differentially expressed genes were down-regulated in transgenic plants compared to wild type. After analysis by transcriptome correlation with metabolome data, it was found that the expression of genes in the anthocyanin biosynthesis pathway (1 CHS, VIT _05s0136g00260, 1 CHI, VIT _13s0067g03820, 1F 3'5' H, VIT \/08s0007g05160, one F3' H VIT _17s0000g07200, one F3H, VIT _04s0023g03370, one DFR gene VIT _16s0039g 02350) was generally higher than WT in #25, and metabolites corresponding thereto, such as chalcone, naringenin, eriodictyol, dihydroquercetin, dihydrokaempferol, dihydromyricetin, anthocyanins, etc., were also increased to varying degrees. Then, the inventor carries out quantitative expression analysis on the differentially expressed genes which are up-regulated by induction of VlbZIP30, and finds that the expression level of key genes positioned at key node positions in a anthocyanin synthesis pathway, including genes such as VvCHI1, vvCHS3 and VvF3H, is obviously increased in over-expressed plants. The genes are shown to be directly involved in synthesis of anthocyanin in previous research reports, so that the VlbZIP30 gene is supposed to be capable of regulating expression of key genes for anthocyanin biosynthesis such as VvCHI1, vvCHS3 and VvF3H and the like, thereby improving synthesis of anthocyanin in seedless white grapes.

The following specific steps are the coding region sequence of 'Kyoho' VlbZIP30 of European and American hybrid grape variety and the experimental verification of the function of improving anthocyanin biosynthesis.

A. In the early research and analysis, on the basis of identifying 47 bZIP family genes of grapes, a homologous cloning technology is utilized, a first cDNA chain synthesized by reverse transcription of 'Kyoho' leaf total RNA of a European and American grape hybrid variety is taken as a template, and a VlbZIP30 sequence is obtained by amplification, wherein the coding region sequence of the 'Kyoho' VlbZIP30 of the European and American grape hybrid variety is as follows:

the amino acid sequence of the gene code is as follows:

B. referring to FIG. 1, vlbZIP30 transgenic lines (# 24, #25, and # 27) were identified as significantly increasing anthocyanin levels in seedless white grapes. Under normal growth conditions, the leaves and stems of 4-month-old transgenic plants were significantly reddened compared to the wild control. After content extraction, the anthocyanin content in the leaves and stems of the transgenic plants is obviously higher than that of the wild control.

C. Referring to FIG. 2, a broad-target metabolome analysis was performed on transgenic lines (# 25) and wild-type seedless grape leaves. As a result, it was found that 435 metabolites were different among the transgenic plants compared to the wild control, 227 metabolites were significantly increased, and 208 metabolites were decreased. The inventors have counted the remarkably accumulated metabolites and found that they were mainly flavonols, flavanols, flavanones, flavanols, proanthocyanins, anthocyanins, and the like. Wherein the anthocyanin which is obviously accumulated mainly comprises cyanidin-3-O- (6 ' -O-acetyl) glucoside, delphinidin-3-O- (6 ' -O-feruloyl) glucoside, cyanidin-3-O- (6 ' -O-caffeoyl) glucoside, paeoniflorin-3,5-O-diglucoside, cyanidin-3-O- (6 ' -O-p-coumaroyl) glucoside, peoniflorin-3-O- (6 ' -O-caffeoyl) glucoside, morning glory-3-O- (6 ' -O-caffeoyl) glucoside, malvidin-3-O- (6 ' -O-caffeoyl) glucoside, etc. The results show that under normal growth conditions, the anthocyanin content in the transgenic plants is significantly higher than that of the wild control. The over-expression of the VlbZIP30 gene of European and American hybrid grape variety 'Kyoho' obviously promotes the synthesis of anthocyanin in grapes.

D. Referring to fig. 3, it was found that the expression of genes in anthocyanin biosynthesis pathway is generally higher than that of WT in #25 through metabolome and transcriptome combined analysis, and metabolites corresponding thereto, such as chalcone, naringenin, eriodictyol, dihydroquercetin, dihydrokaempferol, dihydromyricetin, anthocyanidin, etc., are increased in various degrees.

E. Referring to fig. 4, quantitative expression analysis of those differentially expressed genes up-regulated by induction of VlbZIP30 revealed that the expression levels of key genes located at key node positions in the anthocyanin synthesis pathway, including genes VvCHI1, vvCHS3 and VvF3H, were indeed significantly increased in over-expressed plants. These genes have been shown to be directly involved in anthocyanin synthesis in previous research reports, so the inventors speculate that the VlbZIP30 gene can improve anthocyanin synthesis in seedless grapes by regulating the expression of key genes for anthocyanin biosynthesis, such as VvCHI1, vvCHS3 and VvF 3H. The combination of the results shows that VlbZIP30 has the biological function of improving the synthesis of anthocyanin in seedless white grapes.

The following are specific examples to further illustrate the technical aspects of the present invention.

Example 1: over-expression of VlbZIP30 can significantly improve the anthocyanin content in seedless white grapes

Through phenotypic observation, the leaves and stems of the transgenic plants are remarkably reddened compared with the wild control. After content extraction, anthocyanin content in leaves and stems of transgenic plants is found to be significantly higher than that of wild control (figure 1).

To further understand what anthocyanin metabolites are specifically involved in the accumulation of VlbZIP30, a broad-target metabolome assay was performed on 4-month-old wild-type controls and transgenic plants, and as a result, it was found that under normal growth conditions, 435 metabolites were different in transgenic plants compared to the wild-type controls, 227 metabolites were significantly increased and 208 metabolites were decreased. The inventors counted the remarkably accumulated metabolites and found that they were mainly flavonols, flavanols, flavanones, flavanols, proanthocyanins, and cyanines. Wherein the anthocyanin which is obviously accumulated mainly comprises cyanidin-3-O- (6 ' -O-acetyl) glucoside, delphinidin-3-O- (6 ' -O-feruloyl) glucoside, cyanidin-3-O- (6 ' -O-caffeoyl) glucoside, paeoniflorin-3,5-O-diglucoside, cyanidin-3-O- (6 ' -O-p-coumaroyl) glucoside, peoniflorin-3-O- (6 ' -O-caffeoyl) glucoside, morning glory-3-O- (6 ' -O-caffeoyl) glucoside, malvidin-3-O- (6 ' -O-caffeoyl) glucoside, etc. The results show that under normal growth conditions, the anthocyanin content in the transgenic plants is significantly higher than that of the wild control. The over-expression of the VlbZIP30 gene of European and American hybrid grape variety 'Kyoho' is proved to remarkably promote the synthesis of anthocyanin in grapes (figure 2). The results show that under normal growth conditions, the anthocyanin content in the transgenic plants is significantly higher than that of the wild control. The over-expression of the VlbZIP30 gene of European and American hybrid grape variety 'Kyoho' obviously promotes the synthesis of anthocyanin in white grapes.

Example 2: vlbZIP30 can improve the synthesis of the anthocyanin by regulating the expression of key genes for anthocyanin biosynthesis

To further understand the mechanism of action of VlbZIP30 in anthocyanin biosynthesis, transcriptome sequencing was performed on 4-month-old wild-type and transgenic plants, and it was found that under normal growth conditions, there were 1796 differentially expressed genes up-regulated and 1398 differentially expressed genes down-regulated in transgenic plants compared to wild-type. After analysis by transcriptome in association with metabolome data, it was found that the expression of genes in the anthocyanin biosynthesis pathway (1 CHS, VIT _05s0136g00260, 1 CHI, VIT _13s0067g03820, 1F 3'5' H, VIT \/08s0007g05160, one F3' H VIT _17s0000g07200, one F3H, VIT _04s0023g03370, one DFR gene VIT _16s0039g 02350) was generally higher than WT in #25, and metabolites corresponding thereto, such as chalcone, naringenin, eriodictyol, dihydroquercetin, dihydrokaempferol, dihydromyricetin, anthocyanins, etc., were also increased to varying degrees (FIG. 3). Then, the inventors quantitatively analyze the expression of the differentially expressed genes which are up-regulated by induction of VlbZIP30, and found that the expression levels of the key genes, including genes such as VvCHI1, vvCHS3 and VvF3H, located at key node positions in the anthocyanin synthesis pathway are obviously increased in over-expressed plants (FIG. 4). These genes have been shown to be directly involved in anthocyanin synthesis in previous research reports, so the inventors speculate that the VlbZIP30 gene can improve anthocyanin synthesis in seedless grapes by regulating the expression of key genes for anthocyanin biosynthesis, such as VvCHI1, vvCHS3 and VvF 3H.

<110> northwest agriculture and forestry science and technology university

<120> VlbZIP30 gene promoting synthesis of vitis cyanin and application thereof <160>

<210>1

<211>1095

<212> coding region sequence of VlbZIP30 gene promoting synthesis of vitis anthocyanidin

<213>

<220>

<400> 1

1 ATGGGGATTCAGACTATGGGGTCTCAAGGTGGTGGTGGCGGTGGTGGTACTGGTAATGGT

61 AAACAATCTCAGTTTCAGCCATTGGCACGGCAAAACTCAATGTATAGTTTAACACTTGAT

121 GAGGTTCAAAATCAGTTAGGAGACTTGGGGAAACCGCTGACTAGTATGAACCTTGATGAG

181 CTTCTCAAGAATGTGTGGACGGTTGAGGCTAATAATTCTGTGGGTATGGATGCTGAGGGT

241 GCAGGTTTGAGTAACCAATCTGCTCTGCAACGAGAGCCTAGCCTGTCATTGACAGGTGCT

301 CTTAGCAAGAAGACAGTTGATGAGGTCTGGCGAGATATACAAGGGCATGGCAAGAACAGT

361 GAAGAGAAGAAATCTCGGGAGAGGCAGCCTACTTTGGGGGAGATGACATTGGAGGATTTC

421 CTGGTAAAGGCGGGAGTTGTCGCTGAACCATCAGATAAAAAGATTGCTGGTACTGTTATT

481 GGGGTTGATCCTAATGTAGGGCCACAATTCCCACAGCAGGGTCAGTGGATGCAGTACCCA

541 CAACCACAATTTCCGCATCCGCAACAGAATATGATAGGGGTTTATATGCCAGGCCAGCCA

601 ATGCCGCAGCCGCTACCCATGGGACCTAGCTCTGTCATGGATGTGACATATCCTGACAAC

661 CAAGTGGCCTTATCTTCTCCATTGATGGGAGCTTTATCAGATACACAGGCACCTGGGAGG

721 AAAAGAGTTTCCCAAGAGGATATGATTGAGAAAACTGTTGAGAGGAGACAGAAGAGGATG

781 ATCAAGAATCGGGAATCTGCTGCCCGTTCAAGGGCCAGGAAGCAGGCTTACACAAATGAA

841 CTGGAGAACAAAGTTTCACGTCTGGAAGAGGAAAATGAAAGGCTAAGGAAACGAAAGGAG

901CTGGAGAAGATGCTGCCAAGTGCACCACCCCCGGAACCCAAATACCAGCTTCGCAGAACG

961 AGTTCAGCCCCATTCTGA

Claims (1)

1. The application of VlbZIP30 gene in improving anthocyanin content of grapes is characterized in that the coding region sequence of the VlbZIP30 gene is as follows:

   1 ATGGGGATTCAGACTATGGGGTCTCAAGGTGGTGGTGGCGGTGGTGGTACTGGTAATGGT

   61 AAACAATCTCAGTTTCAGCCATTGGCACGGCAAAACTCAATGTATAGTTTAACACTTGAT

   121 GAGGTTCAAAATCAGTTAGGAGACTTGGGGAAACCGCTGACTAGTATGAACCTTGATGAG

   181 CTTCTCAAGAATGTGTGGACGGTTGAGGCTAATAATTCTGTGGGTATGGATGCTGAGGGT

   241 GCAGGTTTGAGTAACCAATCTGCTCTGCAACGAGAGCCTAGCCTGTCATTGACAGGTGCT

   301 CTTAGCAAGAAGACAGTTGATGAGGTCTGGCGAGATATACAAGGGCATGGCAAGAACAGT

   361 GAAGAGAAGAAATCTCGGGAGAGGCAGCCTACTTTGGGGGAGATGACATTGGAGGATTTC

   421 CTGGTAAAGGCGGGAGTTGTCGCTGAACCATCAGATAAAAAGATTGCTGGTACTGTTATT

   481 GGGGTTGATCCTAATGTAGGGCCACAATTCCCACAGCAGGGTCAGTGGATGCAGTACCCA

   541 CAACCACAATTTCCGCATCCGCAACAGAATATGATAGGGGTTTATATGCCAGGCCAGCCA

   601 ATGCCGCAGCCGCTACCCATGGGACCTAGCTCTGTCATGGATGTGACATATCCTGACAAC

   661 CAAGTGGCCTTATCTTCTCCATTGATGGGAGCTTTATCAGATACACAGGCACCTGGGAGG

   721 AAAAGAGTTTCCCAAGAGGATATGATTGAGAAAACTGTTGAGAGGAGACAGAAGAGGATG

   781 ATCAAGAATCGGGAATCTGCTGCCCGTTCAAGGGCCAGGAAGCAGGCTTACACAAATGAA

   841 CTGGAGAACAAAGTTTCACGTCTGGAAGAGGAAAATGAAAGGCTAAGGAAACGAAAGGAG

   901 CTGGAGAAGATGCTGCCAAGTGCACCACCCCCGGAACCCAAATACCAGCTTCGCAGAACG

   961 AGTTCAGCCCCATTCTGA

   the application is to over-express VlbZIP30 gene in grapes.

Images