CN114366814B - Inhibitors of miR-27a-3p and application thereof - Google Patents

Abstract

The invention discloses an inhibitor of miR-27a-3p and application thereof, and belongs to the technical field of biomedicine. The nucleotide sequence of the inhibitor is CGGAACTTAGCCACTGTG, and the inhibitor has good application in preparing products for preventing and/or treating liver cell cancer. The invention provides a new medicine source for preventing, diagnosing, detecting, protecting, treating and researching liver cell liver cancer, is easy to popularize and apply clinically, and can generate huge clinical application prospect and social benefit in a short time.

Description

Inhibitors of miR-27a-3p and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to an inhibitor of miR-27a-3p and application thereof.

Background

Hepatocellular carcinoma (hepatocellular carcinoma, HCC) is a major histological subtype of liver cancer, accounting for 75% -85% of primary liver cancer, with high malignancy, poor prognosis, and 2018 resident fourth cause of cancer death worldwide, the second cause of cancer death in China. In China, liver cell cancer has a background of liver fibrosis and cirrhosis. The high mortality rate of liver cancer is largely due to its strong concealment and the easy recurrence after surgery.

Hepatic injury causes activation of hepatic stellate cells, transformation into fibroblasts, and synthesis of a large number of extracellular matrices is the central link for fibrosis and cirrhosis of the liver. Activated stellate cells are associated with immunosuppressive microenvironments that damage the liver, play an important role in the development of liver cancer, and are also associated with recurrent tumors formed in the residual liver after resection of the liver cancer.

mirnas are important molecules involved in epigenetic regulation, which can regulate differentiation and function of immune cells. It functions not only intracellularly, but also can be packaged into small extracellular vesicles (small extracellular veclse, sEV) and released into the extracellular environment where it is transferred to other cells and functions.

Activating hepatic stellate cells affects immune cells such as neighboring liver cells (liver cancer cells) and macrophages by releasing extracellular vesicle components carrying specific miRNAs. Along with the deep research of the action of vesicle miRNA (sEV-miRNA) on tumor immunity micro-environment mechanism, the vesicle miRNA is expected to bring new breakthrough in tumor treatment and prognosis evaluation, and becomes an important treatment target.

Disclosure of Invention

The technical problems to be solved are as follows: aiming at the technical problems, the invention provides the miR-27a-3p inhibitor and the application thereof, provides a new medicine source for preventing, diagnosing, detecting, protecting, treating and researching liver cell liver cancer, is easy to popularize and apply clinically, and can generate huge clinical application prospect and social benefit in a short time.

The technical scheme is as follows: an inhibitor of miR-27a-3p, said inhibitor having nucleotide CGGAACTTAGCCACTGTG (SEQ ID No. 1).

Application of miR-27a-3p inhibitor in preparation of products for preventing and/or treating liver cell cancer.

Preferably, the product is a pharmaceutical, additive or active ingredient agent.

Preferably, the medicament comprises an inhibitor of miR-27a-3p and pharmaceutically-addable auxiliary materials.

Preferably, the auxiliary materials comprise one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers and lubricants.

Preferably, the dosage form of the medicine comprises tablets, capsules, powder, pills, granules, syrup, solution, suspension, emulsion, suspension, injection or powder injection.

Preferably, the method of administering the drug comprises: oral, injection, osmotic, absorption, and physical or chemical mediated methods of introduction into body tissue; or mixed or wrapped with other substances and introduced into the body.

The beneficial effects are that: the inhibitor (anti-AHSC-sEV-miRNA) of miR-27a-3p provided by the invention has the effects of preventing and/or treating liver cell liver cancer and inhibiting and activating specific miRNA components in hepatic stellate cell extracellular vesicles, and the nucleotide sequence is as follows: CGGAACTTAGCCACTGTG, the complement of miR-27a-3 p. Through adjusting the base sequences of the 5 'end and the 3' end, the GC proportion is regulated to a proper range, and the GC proportion is subjected to special chemical modification, so that the GC proportion can compete with the mature miRNA for binding, and the complementary pairing of the miRNA and the target gene mRNA is prevented, so that the action of the miRNA is inhibited. The anti-AHSC-sEV-miRNA inhibitor is the reverse complementary sequence of partial fragment including seed sequence in the mature chain of miR-27a-3p, the whole chain is subjected to 2 'OMe-modification, two thio skeletons are arranged at the 5' end and four thio skeletons are arranged at the 3 'end, and high-affinity cholesterol modification is connected at the 3' end. The anti-AHSC-miRNA is easy to pass through cell membranes and tissue gaps in animal and cell experiments, and is more stable and better in inhibition effect.

The sequence of the miR-27a-3p is as follows: UUCACAGUGGCUAAGUUCCGC (SEQ ID NO. 2).

The invention constructs a clinic related nude mouse transplantation tumor model: hepG2 cells transfected with the anti-AHSC-sEV-miRNA inhibitor are injected into mice, and the occurrence and development of the transplanted tumor model are obviously improved through direct action on liver cancer cells and indirect action on tumor immune microenvironment, so that the anti-AHSC-sEV-miRNA inhibitor can be used for clinically preventing/treating liver cell liver cancer. Meanwhile, the in-vitro experiment verification result of the invention indicates that the anti-AHSC-sEV-miRNA inhibitor realizes the inhibition effect on liver cell liver cancer progress through direct action on liver cancer cells and indirect action on tumor immune microenvironment.

The medicine for inhibiting liver cell cancer has high safety, strong pharmacological action and definite curative effect. The invention provides a new medicine source for preventing, diagnosing, detecting, protecting, treating and researching liver cell liver cancer, is easy to popularize and apply clinically, and can generate huge clinical application prospect and social benefit in a short time.

Drawings

FIG. 1 is a plot of miR-27a-3p expression in activated primary HSC and aLX cells and vesicles from example 1: wherein a is NTA analysis chart showing 3d HSC and 14d HSC svvs particle size distribution and concentration; b is RT-PCR detection of expression of primary SD rat 3d HSC and 11d HSC cell miR-27a-3 p; c is RT-PCR to detect the expression of miR-27a-3p in primary SD rat 3dHSC and 14d HSC cell supernatant vesicles; d is RT-PCR detection of qLX and aLX2 cell miR-27a-3p expression in the LX2 activation model; e is RT-PCR to detect the expression of miR-27a-3p in qLX and aLX2 cell supernatant vesicles in an LX2 activation model;

FIG. 2 is the effect of overexpression of miR-27a-3p on hepatoma cell biology in example 2: wherein A is RT-PCR detection of miR-27a expression in human liver cancer cell lines Huh7 and HepG 2; b is the migration capacity of Huh7 and HepG 2; C-D is the RT-PCR analysis of miR-27a expression in Huh7 and HepG2 cells after transfection of miR-27a mimic and anti-AHSC-sEV-miRNA inhibitors; cell growth assessed by CCK 8;

FIG. 3 is a graph showing the results of in vivo miR-27a-3p promotion of HCC formation and development in example 3: wherein A is a statistical histogram of tumor formation rate in a nude mouse transplanted tumor model; b is a line graph of the volumes of tumors formed by each group 7d,14d,21d and 28d in the nude mice transplanted tumor model; c is a statistical histogram of tumor weight at the time of sacrifice of each group of mice in the nude mice engrafting tumor model; d is a visual image of each group of mice and tumors in the nude mice transplanted tumor model;

FIG. 4 is a histological observation of the effect of miR-27a on tumor cell and macrophage distribution and number in example 3: wherein A is immunohistochemical staining of a nude mouse transplanted tumor section; b is the positive cell count of tumor cells Ki67 and liver macrophages CD68, CD11B, INOS, CD;

FIG. 5 is a graph showing the results of the action of LX2 cell-derived vesicle miR-27a on HepG2 in example 4: wherein A is a Transwell experimental result of the mixture of a conditioned medium of the supernatant sEVs of the transfected LX2 cells and THP1-M0 and 5% FBS DMEM on HepG2 cells; and B is a statistical histogram formed after the number of the migration cells is manually counted.

Detailed Description

In order to enable those skilled in the art to better understand the present invention, the following description will make clear and complete descriptions of the technical solutions according to the embodiments of the present invention with reference to the accompanying drawings.

The reagent materials used in the examples are all commercially available, and the quantitative experiments referred to in the examples are all performed in at least three replicates, and the results are averaged.

Human monocytic cell line THP1 cells (catalog number: SCSP-567) were used; human hepatoma cell line HepG2, huh7 cells were purchased from the national academy of sciences of the classical culture collection committee cell bank/stem cell bank.

The anti-AHSC-sEV-miRNA inhibitor used was constructed by Guangzhou Ruibo biotechnology Co., ltd: the nucleotide sequence is (5 'to 3'): CGGAACTTAGCCACTGTG.

Example 1

MiR-27a-3p is elevated in both cells of primary activated HSC and aLX2 cells and in supernatant vesicles

LX2 cell culture and activation model establishment

(1) Taking LX2 cells with good growth state, planting 5×10ζ5 cells per bottle in T25 cm ² The flask was stably cultured with DMEM medium supplemented with 10% (v/v) FBS for 24 hours.

(2) After 24h 2% (v/v) of the vesicle-free FBS DMEM stock solution was changed and 10ng/mL of recombinant human TGF-. Beta.1 was added to induce LX2 activation, and the same volume of PBS buffer containing 5% (v/v) of alginate (TGF-. Beta.1 buffer) was added as a negative control group.

(3) After 24h, cells and supernatant were harvested, RT-PCR verified, and after 48h cells were harvested, western Blot verified.

2. Cellular RNA sample extraction

(1) Cell samples were taken, washed three times with PBS, drained, 1mL TRIzol was added, blown several times, and aspirated several times with a 1mL syringe.

(2) Incubation was performed at room temperature for 5min, 0.2mL chloroform was added per 1mL TRIzol, thoroughly mixed, and incubated at room temperature for 3min.

(3) The mixture is pre-cooled to 4 ℃,12000g and centrifuged for 15min.

(4) The upper aqueous phase was pipetted 300. Mu.L into a new EP tube, added with equal volume of isopropanol, vortexed and incubated for 1h at-20 ℃.

(5) After centrifugation at 12000g at 4℃for 15min, a white precipitate formed on the bottom side of the tube.

(6) The supernatant was discarded, 1mL of 75vt% ethanol was vortexed, washed, and centrifuged at 4 ℃,7500g, for 5min. The supernatant was discarded and a precipitate was left.

(7) The RNA pellet was dried, dissolved in DEPC water, and incubated in a 60℃water bath for 10min.

(8) RNA was placed on ice and Nanodrop 2000 detected RNA concentration.

3. Isolation and purification of cell supernatant vesicles from 3d HSC and 14d HSC and cell supernatant vesicles from qLX and aLX2

(1) Collecting culture supernatant, centrifuging at 4deg.C and 3000g for 15min, collecting supernatant, and removing precipitate.

(2) The supernatant was filtered through a 0.22 μm sieve to remove non-vesicle particulate components.

(3) The collected supernatant was added to a 15mL ultrafilter tube, centrifuged at 4000g at 4℃for 30min (bucket).

(4) The concentrate was mixed with SBI reagent in a 5:1 (v/v) ratio and incubated overnight at 4℃in the absence of light.

(5) Centrifuging at 4deg.C for 30min at 1500g, discarding supernatant, and leaving precipitate.

(6) Again at 4 ℃,1500g, centrifuged for 5min, and enriched for vesicles.

(7) Adding proper amount of buffer solution to resuspend vesicle sediment.

4. Extraction of extracellular vesicle RNA from supernatant

(1) Adding 0.25mL of extracellular vesicle sample solution into 0.75mL of TRIzol LS reagent, adding external reference cel-miR-39 50fmol, and uniformly mixing; incubate at room temperature for 10min and leave on ice for 30min.

(2) Adding 0.2mL chloroform into every 0.75mL TRIzol LS, and fully mixing for 15s; standing at room temperature for 15min; placing on ice for 30min.

(3) Centrifuging at 4deg.C for 15min at 12000 g; transferring the aqueous phase, adding 8 μg glycogen to assist in RNA precipitation; equal volumes of isopropanol were added and vortexed and mixed well overnight at-20 ℃.

(4) After centrifugation at 17000g at 4deg.C for 10min, white precipitate was visible on the bottom side wall of the tube.

(5) The supernatant from the centrifuge tube was removed, 1mL 75vt% ethanol was added to each 0.75mL TRIzol LS reagent to wash the RNA pellet, and the samples were vortexed.

(6) Centrifuge at 4 ℃,12000g for 15min, discard supernatant.

(7) Repeating the two steps (5) and (6).

(8) Drying the RNA precipitate; the DEPC water was resuspended and homogenized.

(9) The RNA concentration is detected by incubating at 55 ℃ for 10-15min,Nanodrop 2000, and the downstream operation is continued or frozen at-80 ℃.

NTA analysis to identify HSC extracellular vesicles

RT-PCR detection of expression of cell-derived supernatant vesicles miR-27a-3p in primary SD rat hepatic stellate cells and in an LX2 activation model.

PrimeScript II 1st Strand cDNA Synthesis Kit is manufactured by Takara corporation of Japan. miDETECT A Track miRNA qRT-PCR Starter Kit was purchased from Guangzhou Ruibo Biotechnology Co.

Reverse transcription-PCR reaction of miRNA:

(1) Poly (A) Tailing reaction system:

reaction conditions: reacting for 1h at 37 ℃; preserving heat at 4 ℃.

(2) Reverse transcription reaction system:

reaction conditions: reacting for 1h at 42 ℃, and then incubating for 10min at 72 ℃; on ice or stored at-20deg.C.

(3) PCR amplification after reverse transcription of miRNA (in-process attention is paid to light-shielding)

The reaction system was placed on ice and was placed as follows:

reaction conditions: 95 ℃ for 10min;40 cycles: 95℃for 2s,60℃for 20s,70℃for 10s (fluorescence is collected); and (5) generating a melting curve.

7. Statistical method

Statistical analysis was performed using GraphPad Prism 6 software. For quantitative data, groups were reported as mean±sem, and differences between groups were compared for significance using unpaired two-tailed t-test or One-way ANOVA test, P <0.05 indicating that differences were statistically significant. Unless otherwise indicated, all experiments were repeated three more times. Picture processing software Photoshop, flow analysis software Cflow Plus, adobe Illustrator make puzzles, image J analyzes the grey values of the Western Blot result images.

8. Results

As shown in FIG. 1, miR-27a is upregulated not only intracellularly in activated HSC cells, but also in cell supernatant vesicles. Subsequently, we again validated this result in the LX2 activation model, with up-regulation of miR-27a-3p expression in both aLX2 cell intracellular and supernatant vesicles. * Representing significant difference P <0.05, representing significant difference P < 0.01, representing significant difference P < 0.001.

Example 2

In vitro miR-27a-3p overexpression promotes growth and migration of liver cancer cell lines HepG2 and Huh7 cells

1. Transfection of miR-27a mimic and anti-AHSC-sEV-miRNA inhibitor and detection of intracellular expression

(1) 1.5X10-6 cells LX2 cells were inoculated into a T75 cm2 flask containing 15mL of complete medium for culturing, and transfection was performed when the cell density reached 60-70%.

(2) Preparation of transfection fragment dilutions a: mu.L of 20. Mu.M miRNA mixer/inhibitor was diluted every 157.5. Mu.L of serum-free medium DMEM and gently mixed.

(3) Preparation of Lipo2000 dilution B: mu.L Lipo2000 was diluted per 150. Mu.L serum-free medium DMEM and gently mixed.

(4) The solution A and the solution B are evenly mixed according to the equal amount of 1:1 (v/v), and the mixture is kept stand for 10min at room temperature.

(5) During the rest period, the stock solution was replaced with serum-free DMEM.

(6) After standing for 5min, the mixed solution is evenly and dropwise added into cell supernatant, 360 mu L of the mixed solution is respectively added into each bottle, the final volume of each bottle is quantified to 6mL, the final concentration of transfected fragments is 75nM, and the mixture is evenly mixed by a light shaking pore plate.

(7) Placed at 37 ℃ and 5% CO ² Culturing in an incubator for 4-6 h.

(8) After 4-6 h, the complete culture of 10% vesicle-free FBS DMEM was replaced with 20mL at 37℃with 5% CO ² Culturing for 24-48 h under the condition, collecting cells and supernatant vesicles, and identifying.

2. Transwell experiments were performed on transfected HepG2 or Huh7 cells

(1) HepG2 cells were taken, pre-serum starved for 4h, and transwell cells were immersed in DMEM medium 1h ahead of time.

(2) Pre-starved HepG2 cells were harvested, pancreatin digested, centrifuged at 1000rpm,5min at 4℃and resuspended at 4X 10. Sup.5/mL cells.

(3) Taking 24-well plates, grouping the lower chambers according to experiments, adding 500 mu L of mixed culture solution respectively, placing the pre-soaked chambers in small holes containing 5% (v/v) FBS DMEM culture solution, adding 200 mu L of cell heavy suspension into the upper chamber, and dropwise adding (about 8×10≡4 cells/hole) (the action is gentle, cells are uniformly planted, and air bubbles are taken away by attention)

(4) Placed in a 5% CO2 incubator at 37℃for 24h. (observing the adherence and the occurrence of bubbles, if any, driving away in time)

(5) After 24h, the chamber was removed, the supernatant was discarded, washed three times with 1 XPBS, and transferred into a well where 200. Mu.L of 2% paraformaldehyde had been previously added, and fixed at room temperature for 10min.

(6) Taking out ddH ₂ O-washing three times, slightly drying, transferring into a small hole with 200 mu L of 0.1% crystal violet solution added in advance, and incubating for 10min at room temperature.

(7) Taking out, recovering crystal violet solution, and using ddH in cell ₂ O washing for 3-5 times, taking medical cotton swab to wipe cells in the upper chamber, observing under a microscope, and counting.

(8) And analyzing the experimental result.

3. Assessment of cell growth by CCK-8

36h after transfection, cell growth was assessed by Cell Counting Kit-8 (CCK 8), showing absorbance at 450 nm.

4. Statistical method

Statistical analysis was performed using GraphPad Prism 6 software. For quantitative data, groups were reported as mean±sem, and differences between groups were compared for significance using unpaired two-tailed t-test or One-way ANOVA test, P <0.05 indicating that differences were statistically significant. Unless otherwise indicated, all experiments were repeated three more times. Picture processing software Photoshop, flow analysis software Cflow Plus, adobe Illustrator make puzzles, image J analyzes the grey values of the Western Blot result images.

5. Results

As shown in fig. 2, HCC cell migration and proliferation capacity of transfected miR-27a mimic were significantly enhanced; and HCC cell migration ability is decreased and cell activity is decreased after transfection of anti-AHSC-sEV-miRNA inhibitor. * Representing significant difference P <0.05, representing significant difference P < 0.01, representing significant difference P < 0.001.

Example 3

miR-27a promotes macrophage infiltration in vivo, thereby promoting HCC progression

1. Establishing a nude mouse transplantation tumor model

4 groups of mice (the HepG2 cells transfected with miRNA-27a-3p mimic and inhibitor and mimic NC and inhibitor NC are respectively labeled as mimic-miR-27a group, anti-AHSC-sEV-miRNA inhibitor group, mimic-NC group and anti-NC group), 5 mice per group, and 5X 10A-6 transfected miRNA-27a mimic and inhibitor and NC control HepG2 cells were injected into each mouse respectively according to the groups.

2. Tumor size measurement and weighing

The size of the tumor formed was measured at the time of injection of tumor cells 7d,14d,21d,28d, respectively. Tumors were weighed after mice were sacrificed.

3. Immunohistochemical analysis.

(1) Baking the slices in a baking oven at 60 ℃ for 2 hours.

(2) Xylene was used twice, 1h each.

(3) Absolute ethyl alcohol is used for two times, each time is 10min, and each time is 2min of alcohol with the concentration of 95%, 90% and 85%. The cells were washed three times with PBS for 5min.

(4) After a water bath of citrate buffer at 100℃for 20min, it was cooled naturally to room temperature.

(5) 3% (v/v) methanol-hydrogen peroxide for 10min. The cells were washed three times with PBS for 5min.

(6) The Rodent Block M was blocked for 10min and thrown off.

(7) Incubating the primary antibody according to the concentration of the reagent, dripping the same amount of PBS into a blank control, placing the pieces in a wet box, and refrigerating at 4 ℃ overnight.

(8) The temperature was returned to room temperature for 1h, and PBST was washed three times for 5min each.

(9) Secondary antibody was added dropwise and incubated for 1h at room temperature. PBST was washed three times for 5min each.

(10) DAB color development, room temperature 15-30s, and observation and control under a mirror. Washing with tap water for 2min.

(11) Hematoxylin is dyed for 3min, washing is carried out for 1min, hydrochloric acid alcohol is differentiated for 3s, warm water turns blue, and washing is carried out for 2min.

(12) 85%,90%,95%,100% and 100% alcohol, xylene is transparent, and the gel is sealed.

(13) Observing under a mirror, photographing and counting.

4. Statistical method

Statistical analysis was performed using GraphPad Prism 6 software. For quantitative data, groups were reported as mean±sem, and differences between groups were compared for significance using unpaired two-tailed t-test or One-way ANOVA test, P <0.05 indicating that differences were statistically significant. Unless otherwise indicated, all experiments were repeated three more times. Picture processing software Photoshop, flow analysis software Cflow Plus, adobe Illustrator make puzzles, image J analyzes the grey values of the Western Blot result images.

5. Results

As shown in fig. 3, 3 mice in each of the mic-NC group and the anti-NC group formed xenograft tumors; of the mice in the mimic-miR-27a group, 4 developed xenograft tumors; while none of the 5 mice in the anti-AHSC-sEV-miRNA inhibitor group had xenograft tumors. On day 28 post injection, the tumor volume of the mic-miR-27a group was significantly greater than that of the mic-NC group (p=0.004); accordingly, the tumor weight of the mimic-miR-27a group at the time of mice sacrifice was about 195% of that of the control group; the tumor volumes and weight differences of the mic-NC group and the anti-NC group have no statistical significance (P=0.345)

As shown in FIG. 4, the positive expression of Ki67 in the miR-27a mimic group is spread over the full field of view, while the expression of NC group is obviously reduced, which suggests that miR-27a promotes tumor proliferation and the malignancy is high. The positive expression of the miR-27a mimic group CD68 is obviously higher than that of the NC group, so that the miR-27a is suggested to promote infiltration of liver intrinsic macrophages and participate in the tumor microenvironment. Compared with NC group, miR-27a mic group has large tumor necrosis range, which indicates that the malignancy of tumor is higher. * Representing significant difference P <0.05, representing significant difference P < 0.01, representing significant difference P < 0.001.

Example 4

The treated LX2 supernatant was collected and vesicles were co-cultured with THP1-M0 and HepG 2.

1.LX2 cells (complete blank control group, mimic NC group, miR-27a-3p mimic group, anti NC group, anti-AHSC-sEV-miRNA inhibitor group, transfection concentration 75 nM) were transfected separately, 100mL of supernatant was collected, and experimental procedure was the same as in example 2.

2. Number of vesicle particles: the cell number was 10000:1, and then adding THP1-M0 cells in a proportion to the conditioned medium for co-culture for 24 hours.

3. Cell supernatants collected after 24h of co-culture were co-cultured with HepG2 and subjected to a Transwell assay, which was performed as in example 2.

4. Statistical method

Statistical analysis was performed using GraphPad Prism 6 software. For quantitative data, groups were reported as mean±sem, and differences between groups were compared for significance using unpaired two-tailed t-test or One-way ANOVA test, P <0.05 indicating that differences were statistically significant. Unless otherwise indicated, all experiments were repeated three more times. Picture processing software Photoshop, flow analysis software Cflow Plus, adobe Illustrator make puzzles, image J analyzes the grey values of the Western Blot result images.

5. Results

As shown in FIG. 5, the LX2 cell vesicles over-expressing miR-27a-3p miICE promote migration of liver cancer cells HepG2, supernatant obtained after co-culture of the cell vesicles and THP1 further promotes migration of liver cancer cells HepG2, and the anti-AHSC-sEV-miRNA inhibitor group weakens the migration phenomenon. * Representing significant difference P <0.05, representing significant difference P < 0.01, representing significant difference P < 0.001.

The above is only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited by this, and any modification made on the basis of the technical scheme according to the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<110> university of Nantong

<120> miR-27a-3p inhibitor and application thereof

<130> 20220124

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

cggaacttag ccactgtg 18

<210> 2

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

uucacagugg cuaaguuccg c 21

Claims (5)

1. An inhibitor of miR-27a-3p, wherein the nucleotide sequence of said inhibitor is CGGAACTTAGCCACTGTG.

2. The use of an inhibitor of miR-27a-3p of claim 1 in the preparation of a medicament for treating hepatocellular carcinoma.

3. The use according to claim 2, wherein the medicament comprises an inhibitor of miR-27a-3p and a pharmaceutically-addable adjuvant.

4. The use according to claim 3, wherein the auxiliary materials comprise one or more of diluents, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, lubricants.

5. The use according to claim 2, wherein the pharmaceutical dosage form comprises a tablet, capsule, powder, pill, granule, syrup, solution, suspension, emulsion or powder injection.

Images