CN114350851A - Reagent for detecting enterovirus - Google Patents
Reagent for detecting enterovirus Download PDFInfo
- Publication number
- CN114350851A CN114350851A CN202111657052.2A CN202111657052A CN114350851A CN 114350851 A CN114350851 A CN 114350851A CN 202111657052 A CN202111657052 A CN 202111657052A CN 114350851 A CN114350851 A CN 114350851A
- Authority
- CN
- China
- Prior art keywords
- reagent
- cdv
- detecting
- enterovirus
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000003153 chemical reaction reagent Substances 0.000 title claims abstract description 31
- 241000709661 Enterovirus Species 0.000 title claims abstract description 24
- 239000000523 sample Substances 0.000 claims abstract description 54
- 238000006243 chemical reaction Methods 0.000 claims abstract description 45
- 238000001514 detection method Methods 0.000 claims abstract description 39
- 238000000034 method Methods 0.000 claims abstract description 29
- 238000003757 reverse transcription PCR Methods 0.000 claims abstract description 21
- 239000003795 chemical substances by application Substances 0.000 claims description 15
- 239000000203 mixture Substances 0.000 claims description 6
- 238000002156 mixing Methods 0.000 claims description 5
- 238000011002 quantification Methods 0.000 claims description 5
- 238000005119 centrifugation Methods 0.000 claims description 4
- 239000007788 liquid Substances 0.000 claims description 4
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 230000003197 catalytic effect Effects 0.000 claims description 3
- 238000012360 testing method Methods 0.000 claims description 3
- 210000004916 vomit Anatomy 0.000 claims description 3
- 230000008673 vomiting Effects 0.000 claims description 3
- 241000702670 Rotavirus Species 0.000 abstract description 13
- 241001263478 Norovirus Species 0.000 abstract description 7
- 238000005516 engineering process Methods 0.000 abstract description 4
- 238000000605 extraction Methods 0.000 abstract description 4
- 108020004707 nucleic acids Proteins 0.000 abstract description 4
- 150000007523 nucleic acids Chemical class 0.000 abstract description 4
- 102000039446 nucleic acids Human genes 0.000 abstract description 4
- 108700039887 Essential Genes Proteins 0.000 abstract description 2
- 238000000746 purification Methods 0.000 abstract description 2
- 238000003908 quality control method Methods 0.000 abstract description 2
- 239000007984 Tris EDTA buffer Substances 0.000 abstract 1
- 238000003556 assay Methods 0.000 abstract 1
- 239000002904 solvent Substances 0.000 abstract 1
- 241000700605 Viruses Species 0.000 description 10
- 238000001493 electron microscopy Methods 0.000 description 9
- 230000035945 sensitivity Effects 0.000 description 6
- 206010012735 Diarrhoea Diseases 0.000 description 5
- 241000532183 Norovirus GI Species 0.000 description 5
- 238000013461 design Methods 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 238000002965 ELISA Methods 0.000 description 3
- 241000532184 Norovirus GII Species 0.000 description 3
- 230000007547 defect Effects 0.000 description 3
- 238000002649 immunization Methods 0.000 description 3
- 230000003053 immunization Effects 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 206010067470 Rotavirus infection Diseases 0.000 description 2
- 241000473945 Theria <moth genus> Species 0.000 description 2
- 206010051511 Viral diarrhoea Diseases 0.000 description 2
- 239000000427 antigen Substances 0.000 description 2
- 108091007433 antigens Proteins 0.000 description 2
- 102000036639 antigens Human genes 0.000 description 2
- 230000006806 disease prevention Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000003018 immunoassay Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 239000002245 particle Substances 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 238000003127 radioimmunoassay Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 208000004998 Abdominal Pain Diseases 0.000 description 1
- 241000714198 Caliciviridae Species 0.000 description 1
- 206010061166 Gastroenteritis bacterial Diseases 0.000 description 1
- 206010022678 Intestinal infections Diseases 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 208000026555 breast adenosis Diseases 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 230000002550 fecal effect Effects 0.000 description 1
- 230000036046 immunoreaction Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 208000026775 severe diarrhea Diseases 0.000 description 1
- 238000012289 standard assay Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 241000701161 unidentified adenovirus Species 0.000 description 1
- 230000009385 viral infection Effects 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a reagent for detecting enteroviruses, belongs to the technical field of molecular biology, and discloses a method for quickly detecting rotaviruses, norovirus and enteroviruses by only one PCR reaction system based on an RT-PCR method. The detection reagent contains: primers and probes: NR1-F, NR1-R, NR2-F, NR2-R, NR1-P, NR2-P, LZ-F, LZ-R, LZ-P, CDV-F, CDV-R, CDV-P, RP-F1, RP-R1, and RP-P2 (the volumes of the above primers and probe are 0.01. mu.l to 1. mu.l), and the solvent is TE buffer. Using this method, the quality control of the whole assay can be carried out using the human housekeeping gene as an internal reference. The method saves the steps of nucleic acid extraction and purification, has a multiplex detection technology of multiple RT-PCR, and can rapidly complete detection within 80 minutes.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a method for rapidly detecting rotavirus, norovirus (GI and GII) and enteroadenovirus (40 and 41) by only one PCR reaction system based on an RT-PCR method.
Background
The most common etiological agents of viral diarrhea are mainly caused by infection with Rotavirus (RV), Calicivirus (HuCV), adenosis Enteralis (EV), and the like.
Rotavirus infection accounts for the largest proportion, and rotavirus, calicivirus and enteroadenovirus are main factors of viral diarrhea infection in clinic.
The norovirus is a group of viruses of norovirus of human Caliciviridae, is frequently outbreak in collective units such as schools, hospitals and orphans, has the characteristics of acute morbidity, high transmission speed and the like, relates to adults and children, and is a main pathogen of nonbacterial diarrhea outbreak epidemic situation.
The rotavirus is divided into seven kinds, which are respectively expressed by capital English A, B, C, D, E, F, G, wherein A is the most common kind, A often causes outbreak of diarrhea of children and presents as severe diarrhea of infants, the treatment is not timely and is easy to die, B rotavirus infection mainly causes adult diarrhea, and the pandemic of million adult diarrhea is caused in China in the last 80 th century.
The intestinal infection symptoms caused by the three viruses are very similar to the symptoms of bacterial gastroenteritis, mainly include vomit, diarrhea and abdominal pain, and all have strong infectivity. The existing detection methods are an electron microscope method, an immunization method and an RT-PCR method.
The electron microscopy comprises two detection methods, namely a direct Electron Microscopy (EM) method and an Immune Electron Microscopy (IEM), wherein the EM method has low observation sensitivity and requires that each milliliter of fecal sample cannot contain less than about 106 virus particles, so that the EM method can only be used for detecting samples collected when a large amount of viruses are discharged in early stage of illness. The sensitivity of the IEM method can be improved by 100 times compared with the EM method, and the serum of a patient in the recovery period is mainly used for capturing homotype antigen, so that the detection rate is increased.
The electron microscopy has the defects that the equipment is very expensive and the operation is very complicated, so the electron microscopy cannot be widely popularized; and the detection result has direct relation with the skill and experience of the operator; the sensitivity is relatively low; not suitable for large-scale epidemiological investigation.
The immunization methods include Radioimmunoassay (RIA), Biotin-Avidin immunization (Biotin-Avidin Immunoassay), and enzyme-linked immunosorbent assay (ELISA).
The sensitivity of the method is 10-100 times higher than that of the IEM method, the raised level of the antibody can be detected, and data with higher reference value is provided for epidemiology. The RIA method has disadvantages in that the detection time is extremely long, about 6 days, and a radioisotope label is required. Later, the united states disease prevention and control center established a biotin-avidin immunoassay with sensitivity comparable to the RIA method, which has become one of the standard assays for detecting NLV antigens and antibodies in the united states disease prevention and control center. The enzyme-linked immunoassay method is rapid, sensitive and economical, and has the defect that the specificity of the plant type of the immunoreaction is too strong, so the application range is narrow.
The reverse transcription polymerase chain reaction (RT-PCR) can more accurately and sensitively detect the virus in a specimen, particularly the virus infection with low concentration, has the greatest advantage that the RT-PCR can further research the genotype of the virus, is not limited by obtaining a typing monoclonal antibody, and has important significance for epidemiological research. Meanwhile, RT-PCR can also detect virus particles existing in food due to its ultra-high sensitivity. However, the current detection is only limited to the PCR detection of single virus, which not only increases the operation steps, but also increases the detection cost.
In summary, the above technical solutions obviously have obvious defects and inconveniences in practical use, so there is a need for improvement.
Disclosure of Invention
In order to realize the rapid, accurate and low-cost detection of rotavirus, norovirus (GI and GII) and enteroadenovirus (40 and 41), the invention discloses a method for rapidly detecting rotavirus, norovirus (GI and GII) and enteroadenovirus (40 and 41) only by one PCR reaction system based on an RT-PCR method.
To achieve the above object, the present invention: "an enterovirus detection reagent" provides a detection reagent comprising: primers and probes: NR1-F (0.01. mu.l-1. mu.l), NR1-R (0.01. mu.l-1. mu.l), NR2-F (0.01. mu.l-1. mu.l), NR2-R (0.01. mu.l-1. mu.l), NR1-P (0.01. mu.l-1. mu.l), NR2-P (0.01. mu.l-1. mu.l), LZ-F (0.01. mu.l-1. mu.l), LZ-R (0.01. mu.l-1. mu.l), LZ-P (0.01. mu.l-1. mu.l), CDV-F (0.01. mu.l-1. mu.l), CDV-R (0.01. mu.l-1. mu.l), CDV-P (0.01. mu.l-1. mu.l), RP-F1 (0.01. mu.l-1. mu.l), RP-R1 (0.01. mu.l-1. mu.l), 2. mu.l-1. mu.l); enzyme system for catalytic detection reaction: such as the FastKing one-step reverse transcription-fluorescence quantification kit (probe method) (Tiangen).
The sequences corresponding to the primers and probes contained in the reagents are shown in Table 1:
table 1: primer and probe correspondence sequence table
The invention adopts Oligo7 primer design software to carry out RT-PCR primer and probe design on the gene, and in order to enhance the specificity of detection, the design adopts Taqman-MGB technology.
In the present invention, the concentration of the detection reagent is 1 to 100. mu.M, and the detection reagent is mixed with a sample releasing agent (patent publication No.: CN 113462742A) developed by my company in the ratio of 1: 24-149, can be used for directly detecting a sample to be detected without nucleic acid extraction, and then participates in RT-PCR reaction.
According to the reagent for detecting enterovirus of the present invention, the sample to be tested is: stool samples, vomit samples, throat swabs, anal swabs, oral swabs.
The blending of the reagent for detecting the enterovirus is as follows: the mixture was shaken vigorously on a homogenizer for 20s and then stopped for 10s, and after repeating this three times, the liquid hanging on the tube wall was centrifuged to the bottom of the tube by centrifugation.
According to the reagent for detecting the enterovirus, an RT-PCR reaction system refers to that: mixing a uniform mixture obtained by uniformly mixing a sample to be detected and a sample releasing agent with a FastKing one-step reverse transcription-fluorescence quantitative kit (probe method), and reacting for 5 minutes at the reaction temperature of 50 ℃ for 1 cycle; then reacting for 3 minutes at the reaction temperature of 95 ℃ for 1 cycle; then, the reaction was carried out at a reaction temperature of 95 ℃ for 15 seconds, followed by reaction at a reaction temperature of 60 ℃ for 30 seconds, and the RT-PCR reaction was carried out by repeating 40 cycles.
The reaction system of the invention is also added with human housekeeping genes as internal reference, and can carry out quality control on the whole detection. The detection saves the steps of nucleic acid extraction and purification, and can be finished within 80 minutes by a multiplex detection technology of multiple RT-PCR.
Description of the drawings:
FIG. 1 shows the results of experiments in which norovirus GI was detected in a PCR reaction with internal controls.
FIG. 2 shows the results of a PCR reaction performed with the enteroadenovirus 40 detected and the internal control.
FIG. 3 shows the results of experiments in which rotavirus was detected in a PCR reaction and simultaneously compared with an internal reference.
FIG. 4 shows the results of experiments in which norovirus GII was detected in a PCR reaction with an internal control.
FIG. 5 shows the results of the PCR reaction performed with the enteroadenovirus 41 detected and the internal control.
FIG. 6 shows the results of experiments in which adenovirus enterica, rotavirus and norovirus samples were detected simultaneously in PCR reactions with internal reference.
The specific implementation process comprises the following steps:
the following embodiments further illustrate the contents of "a reagent for detecting enterovirus" of the present invention, but should not be construed as limiting the present invention. Modifications or substitutions to methods, conditions, steps and applications of the invention may be made without departing from the spirit and substance of the invention.
The invention comprises the following steps: "an enterovirus detection reagent" provides a detection reagent comprising:
1) primers and probes: NR1-F (0.01. mu.l-1. mu.l), NR1-R (0.01. mu.l-1. mu.l), NR2-F (0.01. mu.l-1. mu.l), NR2-R (0.01. mu.l-1. mu.l), NR1-P (0.01. mu.l-1. mu.l), NR2-P (0.01. mu.l-1. mu.l), LZ-F (0.01. mu.l-1. mu.l), LZ-R (0.01. mu.l-1. mu.l), LZ-P (0.01. mu.l-1. mu.l), CDV-F (0.01. mu.l-1. mu.l), CDV-R (0.01. mu.l-1. mu.l), CDV-P (0.01. mu.l-1. mu.l), RP-F1 (0.01. mu.l-1. mu.l), RP-R1 (0.01. mu.l-1. mu.l), 2. mu.l-1. mu.l);
2) enzyme system for catalytic detection reaction: such as the FastKing one-step reverse transcription-fluorescence quantification kit (probe method) (Tiangen).
The sequences of the primers and probes contained in the reagents are shown in Table 1.
The invention adopts Oligo7 primer design software to carry out RT-PCR primer and probe design on the gene, and in order to enhance the specificity of detection, the design adopts Taqman-MGB technology.
In order to verify the effect of the "reagent for detecting enterovirus" of the present invention, the present invention further provides several examples, wherein the results of the tests of the examples are shown in fig. 1, fig. 2, fig. 3, fig. 4, fig. 5, and fig. 6.
Three virus conserved genes were selected. As shown in table 2 below
Table 2: detecting target spot
The samples collected are shown in table 3 below:
table 3: sample condition
The reaction system is shown in table 4:
table 4: test reaction System Table (25. mu.l reaction System)
The reaction conditions are shown in table 5:
table 5: reaction conditions
Example 1: the detection of norovirus GI, enteroadenovirus 40, rotavirus, norovirus GII and enteroadenovirus 41 is simultaneously compared with the control of internal references.
The detection method comprises the following steps.
Step one.
Sample 1, sample 2, sample 3, sample 4, sample 5 were taken as follows: and (3) respectively mixing the mixture with the sample release agent according to the volume ratio of 24 (volume ratio), violently shaking the mixture on a homogenizer for 20s, stopping the shaking for 10s, and centrifuging the liquid hung on the tube wall to the tube bottom by simple centrifugation after repeating the steps for three times.
And step two.
An RT-PCR reaction system was prepared as shown in Table 4, wherein the sample release agent was derived from My, the primers and probes were synthesized by Thermo Fisher Scientific, the FastKing one-step reverse transcription-fluorescence quantification kit was derived from Tiangen Biotechnology Ltd (Beijing), and the positive control plasmid was derived from Anhui Universal Biotechnology Ltd.
And step three.
The detection device comprises: ABI 7500, PCR reactions were performed as shown in Table 5.
And (5) experimental results.
Referring to fig. 1, it can be seen that the reagent for detecting enterovirus of the present invention is uniformly mixed with a sample to be detected treated with a sample releasing agent, and norovirus GI is detected after PCR reaction.
Referring to fig. 2, it can be seen that the reagent for detecting enterovirus of the present invention is uniformly mixed with a sample to be detected treated with a sample releasing agent, and then enterovirus 40 is detected after a PCR reaction.
Referring to fig. 3, it can be seen that the reagent for detecting enterovirus of the present invention is uniformly mixed with the sample to be detected treated with the sample release agent, and then rotavirus is detected after the PCR reaction.
Referring to fig. 4, it can be seen that the "reagent for enterovirus detection" of the present invention is uniformly mixed with a sample to be detected treated with a sample releasing agent, and norovirus GII is detected after a PCR reaction.
Referring to fig. 5, it can be seen that the reagent for detecting enterovirus of the present invention is uniformly mixed with the sample to be detected treated with the sample releasing agent, and then the enterovirus 41 is detected after the PCR reaction.
Example 2: and (4) detecting the mixed sample.
The detection method comprises the following steps.
Step one.
The detection method mixes five samples to obtain a mixed sample 6, and the mixed sample 6 is prepared by the following steps of 1: 49 are respectively mixed with the sample releasing agent uniformly, the mixture is shaken on a homogenizer for 20s violently, then the operation is stopped for 10s, and after the operation is repeated for three times, the liquid hung on the tube wall is centrifuged to the tube bottom by simple centrifugation.
And step two.
An RT-PCR reaction system was prepared as shown in Table 4, wherein the sample release agent was derived from My, the primers and probes were synthesized by Thermo Fisher Scientific, the FastKing one-step reverse transcription-fluorescence quantification kit was derived from Tiangen Biotechnology Ltd (Beijing), and the positive control plasmid was derived from Anhui Universal Biotechnology Ltd.
And step three.
The detection device comprises: ABI 7500, PCR reactions were performed as shown in Table 5.
And (5) experimental results.
Referring to fig. 6, it can be seen that the detection reagent of the present invention is a reagent for detecting enterovirus, which is uniformly mixed with a sample to be detected treated by a sample releasing agent, and a detection result still meets expectations after a PCR reaction. In addition, when two mixed viruses (norovirus GI + GII and enteroadenovirus 40+ 41) exist, the detection can be well detected, and the detection result still presents typical S-type amplification.
In conclusion, the invention can detect 40 and 41 types of norovirus GI, GII, rotavirus and enteroadenovirus at one time. The kit is combined with a sample releasing agent product which is researched and sold by me department, and can be used for directly carrying out RT-PCR detection on a sample to be detected without nucleic acid extraction, so that the effect of quick and accurate detection can be achieved.
Claims (7)
1. A reagent for detecting an enterovirus, comprising: primers and probes: NR1-F (0.01. mu.l-1. mu.l), NR1-R (0.01. mu.l-1. mu.l), NR2-F (0.01. mu.l-1. mu.l), NR2-R (0.01. mu.l-1. mu.l), NR1-P (0.01. mu.l-1. mu.l), NR2-P (0.01. mu.l-1. mu.l), LZ-F (0.01. mu.l-1. mu.l), LZ-R (0.01. mu.l-1. mu.l), LZ-P (0.01. mu.l-1. mu.l), CDV-F (0.01. mu.l-1. mu.l), CDV-R (0.01. mu.l-1. mu.l), CDV-P (0.01. mu.l-1. mu.l), RP-F1 (0.01. mu.l-1. mu.l), RP-R1 (0.01. mu.l-1. mu.l), 2. mu.l-1. mu.l); enzyme system for catalytic detection reaction: such as the FastKing one-step reverse transcription-fluorescence quantification kit (probe method) (Tiangen).
2. The reagent for detecting an enterovirus according to claim 1, wherein the sequences (direction 5'→ 3') of the primers and probes contained in the reagent are:
NR1-F：GGAGCGGAACAAGGTAYTGG；
NR1-R：TCAACGCCCCCAAAGRCTG；
NR2-F：CGACACTATGGAGCCGAGTC；
NR2-R：GATGAACACTGTCGGGCTGA；
NR1-P：FAM- CAAAGTTTGGATCAGGATGGGG-MGB；
NR2-P：FAM-AGCACGTGGGAGGGCGATGG-MGB；
LZ-F：GTTAGACATAACAGCAGATCCAACA；
LZ-R：GCCACCAYYTTTTCCAATTCAC；
LZ-P：VIC- CTAATCCACAAACTGAGAGAATGATGA-MGB；
CDV-F：ACTTCAGCCTGGGGAACAAG；
CDV-R：GACCTGTCTGTGGTTACATCGT；
CDV-P：ROX-TCAGAAAYCCCAC-MGB；
RP-F1：TTAAAAGAGGATTGTCCTGGGC；
RP-R1：GCCAACCTCAGAGGAGACAAA；
RP-P2：CY5-CTTTACCTGAAGATACCTGGGA-MGB。
3. the reagent for detecting an enterovirus according to claim 1, wherein the concentration of the reagent for detecting an enterovirus is 1 to 100. mu.M.
4. The reagent for detecting enterovirus according to claim 1, wherein the ratio of the reagent to a sample to be tested treated with the sample-releasing agent is 1: 24-149, and then carrying out RT-PCR reaction.
5. The test sample of claim 4 refers to: stool samples, vomit samples, throat swabs, anal swabs, oral swabs.
6. The blending according to claim 4 means that: the mixture was shaken vigorously on a homogenizer for 20s and then stopped for 10s, and after repeating this three times, the liquid hanging on the tube wall was centrifuged to the bottom of the tube by centrifugation.
7. The RT-PCR reaction system of claim 4 refers to: the homogenate obtained by the treatment according to claim 4 was mixed with "FastKing one-step reverse transcription-fluorescence quantitative kit (probe method) (Tiangen organism)" and reacted at 50 ℃ for 5 minutes for 1 cycle; then reacting for 3 minutes at the reaction temperature of 95 ℃ for 1 cycle; then, the reaction was carried out at a reaction temperature of 95 ℃ for 15 seconds, followed by reaction at a reaction temperature of 60 ℃ for 30 seconds, and the RT-PCR reaction was carried out by repeating 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111657052.2A CN114350851A (en) | 2021-12-31 | 2021-12-31 | Reagent for detecting enterovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111657052.2A CN114350851A (en) | 2021-12-31 | 2021-12-31 | Reagent for detecting enterovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114350851A true CN114350851A (en) | 2022-04-15 |
Family
ID=81104907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111657052.2A Pending CN114350851A (en) | 2021-12-31 | 2021-12-31 | Reagent for detecting enterovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350851A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107090518A (en) * | 2017-04-05 | 2017-08-25 | 苏州协云基因科技有限公司 | The multiple RT PCR Polymorphism chip inspecting reagent units of the related pathogen of diarrhoea |
| CN111826464A (en) * | 2020-07-16 | 2020-10-27 | 亚能生物技术（深圳）有限公司 | Primer probe for detecting multiple gastrointestinal viruses in one tube, screening method and kit |
| CN113604611A (en) * | 2021-08-11 | 2021-11-05 | 中国人民解放军总医院第五医学中心 | Digital PCR method for detecting B1 group adenovirus |
| CN113621736A (en) * | 2021-08-11 | 2021-11-09 | 中国人民解放军总医院第五医学中心 | Primer probe combination for screening and identifying B2 group adenovirus and application thereof |
-
2021
- 2021-12-31 CN CN202111657052.2A patent/CN114350851A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107090518A (en) * | 2017-04-05 | 2017-08-25 | 苏州协云基因科技有限公司 | The multiple RT PCR Polymorphism chip inspecting reagent units of the related pathogen of diarrhoea |
| CN111826464A (en) * | 2020-07-16 | 2020-10-27 | 亚能生物技术（深圳）有限公司 | Primer probe for detecting multiple gastrointestinal viruses in one tube, screening method and kit |
| CN113604611A (en) * | 2021-08-11 | 2021-11-05 | 中国人民解放军总医院第五医学中心 | Digital PCR method for detecting B1 group adenovirus |
| CN113621736A (en) * | 2021-08-11 | 2021-11-09 | 中国人民解放军总医院第五医学中心 | Primer probe combination for screening and identifying B2 group adenovirus and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 罗欣等: "多重 RT-PCR 与液相悬浮芯片检测临床腹泻相关病毒的比较", 中华检验医学杂志, vol. 38, no. 6, pages 387 - 391 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Caruana et al. | Diagnostic strategies for SARS-CoV-2 infection and interpretation of microbiological results | |
| Saidin et al. | Update on laboratory diagnosis of amoebiasis | |
| CN108411036B (en) | Nucleic acid detection kit and method for rapidly detecting influenza A and influenza B viruses | |
| CN105441595B (en) | It is a kind of for detecting the digital pcr absolute quantitation parting detecting reagent of HBV-B/C | |
| Mahony et al. | Analytical sensitivity, reproducibility of results, and clinical performance of five PCR assays for detecting Chlamydia pneumoniae DNA in peripheral blood mononuclear cells | |
| Zhu et al. | Multiplex and visual detection of African Swine Fever Virus (ASFV) based on Hive-Chip and direct loop-mediated isothermal amplification | |
| CN105420416B (en) | Direct real-time quantitative fluorescence PCR method for layered packaging with indicator | |
| CN109913584A (en) | Four kinds of pig enterovirus multi-fluorescence RT-PCR kits and detection method | |
| CN109457050A (en) | Detect primer, probe, kit and the detection method of hbv nucleic acid | |
| CN104388592B (en) | A kind of Porcine epidemic diarrhea virus S gene RT LAMP detection kits and detection method | |
| CN105018647B (en) | A kind of kit and its detection method based on the accurate quantitative typing detection HPV16/18 of digital pcr | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| CN108998577A (en) | A kind of kit for detecting porcine circovirus 2 type and 3 types, primer pair, probe and method | |
| Wang et al. | Visual detection of porcine epidemic diarrhea virus using a novel reverse transcription polymerase spiral reaction method | |
| CN107304454A (en) | A kind of LAMP visual quick detection kit of porcine circovirus 2 type | |
| CN107022543A (en) | One kind extracts hbv nucleic acid with magnetic bead, extracts reagent, extracting method, quantitative detection kit | |
| Ren et al. | WU polyomavirus in fecal specimens of children with acute gastroenteritis, China | |
| CN113293236A (en) | Porcine reproductive and respiratory syndrome virus RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer group and kit | |
| Sun et al. | Rapid and sensitive detection of hepatitis C virus in clinical blood samples using reverse transcriptase polymerase spiral reaction | |
| CN114350851A (en) | Reagent for detecting enterovirus | |
| CN109971886A (en) | A kind of kit for detecting CPV nucleic acid, RPA primer pair, probe and method | |
| CN116042917A (en) | Triple RT-PCR primer group for detecting porcine epidemic diarrhea, transmissible gastroenteritis and T-coronavirus and application thereof | |
| CN112921123B (en) | Method for rapidly detecting feline calicivirus, primer for detection and kit | |
| Moret et al. | New commercially available PCR and microplate hybridization assay for detection and differentiation of human polyomaviruses JC and BK in cerebrospinal fluid, serum, and urine samples | |
| CN115927746A (en) | Primer probe set and kit for detecting norovirus and rotavirus dual RT-RAP and application of primer probe set and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20220415 |