CN114350693A

CN114350693A - Tn5 transposase and preparation method thereof

Info

Publication number: CN114350693A
Application number: CN202111657653.3A
Authority: CN
Inventors: 吴宁; 张惠丹
Original assignee: Suzhou Huizhen Biotechnology Co ltd; Suzhou Yimei Biotechnology Co ltd
Current assignee: Suzhou Huizhen Biotechnology Co ltd; Suzhou Yimei Biotechnology Co ltd
Priority date: 2021-12-30
Filing date: 2021-12-30
Publication date: 2022-04-15

Abstract

The invention discloses Tn5 transposase and a preparation method thereof. The Tn5 purified transposase obtained by constructing a full-length target gene sequence containing Tn5 transposase gene, an intein gene and a chitin gene, connecting the full-length target gene sequence to a vector and then introducing the vector into escherichia coli for expression and adopting a novel protein fusion expression and purification system can efficiently insert Tn5 transposon into a target sequence without sequence bias selection.

Description

Tn5 transposase and preparation method thereof

Technical Field

The invention relates to the technical field of biological enzymes, in particular to a transposase, and especially relates to a Tn5 transposase and a preparation method thereof.

Background

Tn5 transposon can be inserted into a vector containing target DNA in vitro, and in the absence of magnesium ion incubation, Tn5 transposon can form a stable Tn5 transposome complex, and can enter living cells through electric shock, and the transposome can be randomly inserted into the genome DNA of a host after being activated by magnesium ions in the cells.

Tn5 transposase recognized the Inner End (IE), Outer End (OE) and chimeric end (ME) sequences of the Tn5 transposon sequence, and transposition in vitro was most efficient with fragments containing the ME sequences. The insertion site of Tn5 transposon has high randomness, so it is widely used in the field of in vitro transgene (exogenous gene is integrated into host cell) and second generation sequencing and database construction.

However, the current Tn5 transposase in the industry is generally sequence-biased and not highly stable when it breaks down a DNA sequence. Therefore, how to construct and prepare a novel Tn5 transposase mutant leads the Tn5 transposase to have non-sequence biased selection and higher stability when inserting a DNA sequence, and is a hotspot and difficulty of the research of the industry.

Disclosure of Invention

The present invention is directed to a Tn5 transposase and a method for preparing the same, which solves the above problems of the prior art.

Definition of the enzyme activity unit of Tn5 transposase: 1 unit of Tn5 transposase means the amount of enzyme required to completely cleave 1ug of DNA fragments containing the recognition sequence at 37 ℃ for 1 hour.

A Tn5 transposase has the expression genes including Tn5 transposase gene, intein gene and chitin gene.

Preferably, the expression gene sequence is shown in SEQ ID NO. 1.

Preferably, the amino acid sequence expressed by the expression gene is shown as SEQ ID NO. 2.

The invention constructs a full-length target gene sequence containing Tn5 transposase gene, an intein gene and a chitin gene, connects the full-length target gene sequence to a vector and then introduces the vector into escherichia coli for expression, adopts a novel protein fusion expression and purification system to obtain purified Tn5 transposase, and can efficiently insert Tn5 transposon into a target sequence.

A novel protein fusion expression and purification system (IMPACT) is disclosed, wherein the IMPACT expressed target protein, intein and chitin binding protein (CBD) form a fusion protein, the fusion protein is affinity purified by a chitin column, DTT induces the peptide bond cleavage activity of the intein to release the target protein on the chitin medium, and the intein and the chitin binding protein are still combined on the chitin medium to achieve the purpose of single-column protein separation and purification.

The preparation process comprises the following steps:

1. constructing a vector, and performing seed culture to obtain a plasmid containing a target gene; 2. inducing expression: transferring the plasmid of the target gene into escherichia coli for expression; 3. enriching thalli, and crushing escherichia coli to obtain a crude enzyme lysate; 4. performing hydrophobic chromatography to remove impurities with large hydrophobic difference; 5. affinity chromatography of Chitin (Chitin) for capturing fusion protein of Tn5, Chitin and intein; 6. cutting off intein by DTT, and removing chitin label to obtain coarse Tn5 transposase; 7. purifying Tn5 by ion exchange chromatography; 8. displacing Tn5 transposase into a preservation solution by adopting gel filtration chromatography; 9. the Tn5 transposase with high purity and high concentration is obtained by ultrafiltration concentration.

Preferably, the plasmid vector is pET-28a, and the RBS is shown as SEQ ID NO. 3.

The preparation principle of the invention is as follows:

1) synthesis of full-Length Gene sequence according to SEQ ID NO.1

2) The spliced full-length gene sequences Xho I and Xba I were double-digested and cloned on a pET-28a vector by T4 ligase.

3) Ligation products were transformed into DH 5. alpha. competent cells by plating kanamycin sulfate resistant plates.

4) Positive clones were screened by PCR. And the mutants were verified by sequencing.

5) And transforming the screened positive clones into Rosetta competent cells, and inducing expression.

6) The cells after the wet bacterial body of the escherichia coli is broken and induced, and the target protein is purified through affinity chromatography, chitin resin, ion exchange chromatography and the like.

7) And (5) detecting the activity of the mutant.

The Tn5 transposase expressed by the IMPACT system increases the random alignment and thermal stability of the Tn5 transposase.

Compared with the prior art, the invention has the following beneficial effects:

1. compared with other Tn5 transposases and methods for their preparation, Tn5 transposases obtained by the methods of the present invention are of higher purity and concentration.

2. By adopting the novel protein fusion expression and purification system (IMPACT), the conventional complicated extraction process is simplified, the obtained Tn5 transposase can efficiently insert the Tn5 transposon into a target sequence, has disordered column bias, and shows that the sorting of a target fragment (300-600bp) is more concentrated and the stability of the Tn5 transposon inserted into the target sequence is higher.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:

FIG. 1 is a schematic diagram of the working principle of IMPACT;

FIG. 2 is a schematic flow chart of a process for preparing Tn5 transposase of the present invention;

FIG. 3 is the plasmid map Tn5 transposase sequence information of the gene of interest;

FIG. 4 is a hydrophobic chromatography chromatogram one of Tn5 transposase prepared in example 4;

FIG. 5 is a hydrophobic chromatography chromatogram of Tn5 transposase prepared in example 4;

FIG. 6 is a first hydrophobic chromatogrAN _ SNhy diagram of Tn5 transposase prepared in example 4;

FIG. 7 is a hydrophobic chromatogrAN _ SNhy of Tn5 transposase prepared in example 4;

FIG. 8 is a first chromatographic chromatogram of Tn5 transposase Ni column prepared in example 5;

FIG. 9 is a Ni column chromatography chromatogram of Tn5 transposase prepared in example 5;

FIG. 10 is a first chromatogrAN _ SNhy of Tn5 transposase Ni column prepared in example 5;

FIG. 11 is a second diagram of a Tn5 transposase Ni column chromatography electrophoresis prepared in example 5;

FIG. 12 is the first electrophoretogram of the protein with Chitin affinity of example 6;

FIG. 13 is a second electrophoretogram of the protein with Chitin affinity of example 6;

FIG. 14 is an ion exchange chromatogram of Tn5 transposase obtained in example 7;

FIG. 15 is a first ion exchange electrophoresis chart of Tn5 transposase obtained in example 7;

FIG. 16 is a second ion exchange electrophoresis chart of Tn5 transposase obtained in example 7;

FIG. 17 is a third photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 7;

FIG. 18 is a fourth photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 7;

FIG. 19 is a first Tn5 transposase gel filtration chromatogram obtained in example 8;

FIG. 20 is a second gel filtration chromatography of Tn5 transposase obtained in example 8;

FIG. 21 is a first ion exchange electrophoresis chart of Tn5 transposase obtained in example 8;

FIG. 22 is a second ion exchange electrophoresis chart of Tn5 transposase obtained in example 8;

FIG. 23 is a third photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 8;

FIG. 24 is a fourth photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 8;

FIG. 25 is a first ion exchange electrophoresis chart of Tn5 transposase obtained in example 9;

FIG. 26 is a second ion exchange electrophoresis chart of Tn5 transposase obtained in example 9;

FIG. 27 is a third photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 9;

FIG. 28 is a first ion exchange electrophoresis chart of Tn5 transposase obtained in example 10;

FIG. 29 is a flat drawing of the 50ul bacterial suspension-coated plate of example 12;

FIG. 30 is a flat drawing showing the application of 100. mu.l of the bacterial suspension of example 12;

FIG. 31 is a first ion exchange electrophoresis chart of Tn5 transposase obtained in example 12;

FIG. 32 is a second ion exchange electrophoresis chart of Tn5 transposase obtained in example 13;

FIG. 33 is a third photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 13;

FIG. 34 is a fourth photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 13;

FIG. 35 is a fifth photograph of an ion exchange electrophoresis of Tn5 transposase obtained in example 13;

FIG. 36 is a schematic diagram of the Tn5 transposase fragment products obtained in example 14;

FIG. 37 is a second scheme showing the Tn5 transposase fragment product obtained in example 14;

FIG. 38 is a third schematic diagram of the Tn5 transposase fragment product obtained in example 14;

FIG. 39 is a fourth schematic diagram of the Tn5 transposase fragment product obtained in example 14;

FIG. 40 is a schematic diagram of the Tn5 transposase fragment product obtained in example 14;

FIG. 41 is a diagram of the Tn5 transposase fragment product obtained in example 14.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The translocase in the examples is abbreviated by Suzhou translocase Biotech.

Example 1:

construction of vectors

The gene sequence was synthesized according to SEQ ID NO:1 and the whole gene fragment was inserted into the vector pET-28a (Xho I/Xba I) vector.

In this example, the pET-28a expression vector is used, but not limited thereto.

Plasmid map of the target gene Tn5 transposase sequence information:

expression vector: pET-28a

Enzyme cutting site: xho I/Xba I

A promoter: t7

RBS sequence:

TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATTTAAAT

(not pET-28a original RBS sequence)

Purification tag: c-terminal CBD tag

C end 10 His label.

The RBS sequence is important for the expression of prokaryotic genes, and if a strong secondary structure is formed between the CDS sequence and the RBS sequence in the mRNA sequence, the translation process is seriously influenced, so that the expression quantity of the genes is greatly different from the expected quantity. Therefore, in the standardized design of the sequence of the prokaryotic transcription unit, RBS factors should be considered, and RBS calculation using RBS Calculator is recommended to reasonably control the expression level of the desired gene.

The RBS sequence in the embodiment 1 is matched with the synthetic gene sequence of SEQ ID NO.1, so that the stability of the expressed fusion protein is improved, and the expression level of the gene required by the invention is ensured.

Example 2:

inducible expression

Tn5 transposase mutant transformation experiments

Placing 1 Rosetta competent (Cat: CW0811S, lot: 40426) cell on ice for 20min, and thawing the competent cell into liquid state;

adding 1 μ L of 10ng/μ L Tn5-pET 28a plasmid into thawed competent cells (50-100 μ L), gently flicking, mixing, and standing on ice for 25 min;

performing water bath heat shock at 42 ℃ for 90s, and rapidly performing ice bath for 5 min;

adding 1000 μ L of fresh non-resistant LB liquid medium (batch No. 20200304#1), and culturing at 37 deg.C for 1h at 200rpm of shaking table;

kan + resistance (batch No. 20200304#1) (concentration 0.5%): 200. mu.L of the suspension was uniformly spread on a Kan + LB plate (0.5%) and incubated in a 37 ℃ incubator for 16 hours.

Inducible expression

The monoclonal colonies with high resistance and normal growth were picked up and cultured in 150mL of Kan + LB liquid medium (100ug/mL Kan +, stock solution 50mg/mL) in a shaker at 200rpm and 37 ℃ for 16 hours.

10mL of the strain cultured in the previous step was inoculated into 1L of Kan + TB liquid medium (100ug/mL Kan +), and cultured in a shaker at 200rpm and 37 ℃ for about 4 hours.

When the concentration OD600 of the cultured bacterial liquid is about 0.8-1.0, the temperature is reduced to 25 ℃, IPTG is added to the bacterial liquid to achieve the final concentration of 0.5 mM and 1.0mM, and after the IPTG is added, timing induction expression is started for 16 hours.

Collecting bacteria by using a standard centrifuge, setting 6500rpm, 4 ℃ and 15min, removing residual culture medium, collecting precipitate, weighing and recording the wet weight of all bacteria, and storing all bacteria at-20 ℃.

Example 3:

treatment of bacterial cells

The bacterial cells were crushed under high pressure, 40g of wet bacterial cells were weighed using an electronic balance, 50mL of Tn5 Ni Buffer A (20mM HEPES, 800mM NaCl, 10% Glycerol, 0.2% Triton X-100, pH 7.2, 25 ℃) was added, vortexed rapidly and uniformly using a vortexing machine until no significant clumps were observed by naked eyes, 50mL of a constant volume centrifuge tube was 400mL, and placed in an ice bath for use.

The cold trap of the high-pressure cell crusher is circularly precooled to 4 ℃ in advance, 75% ethanol in the pipeline is drained, the pipeline is cleaned by 500mL of co-process water, then 200mL of Tn5 Ni Buffer A is added to rinse the pipeline and then is drained, the heavy suspension liquid is poured into the pipeline at 1200bar, the flow speed is adjusted to 50, the cell is crushed for 6 times, and the cell crushed liquid is temporarily stored in an ice bath. After pressure relief, 500mL of pure water is added to flush the pipeline, 200mL of 75% ethanol is added to flush the pipeline, and finally the whole pipeline is ensured to be soaked in 75% ethanol.

Treatment of the crushing liquid

Centrifuging: transferring the broken solution into a centrifuge tube, trimming two by two, and centrifuging for 30min at 15000rpm and 4 ℃. The precipitate and supernatant were separated.

And (3) filtering: transferring the supernatant to a clean container, filtering with 0.45um and 0.22um filter membranes respectively in sequence, and standing at 4 deg.C.

Precipitation of PEI

Adding 10% PEI mother liquor (batch No. 2021009#1) to 400mL of supernatant obtained after centrifugation while magnetically stirring until the final concentration of added PEI is 0.4%, adding 16mL in total, and paying attention to slow addition to prevent target protein from precipitating;

magnetically stirring at room temperature for balancing for 10min, and standing at 4 deg.C for 20 min;

centrifuging at 15000rpm and 4 deg.C for 30min, collecting supernatant, and adding to 400 mL;

adding 3M (NH4)2SO4 for salt supplement;

the supernatant was tested using a conductivity meter and conductivity values were recorded.

3M (NH4)2SO4 mother liquor was added and sulfur was added with magnetic stirring (little more than one addition of supernatant) until the conductivity showed around 100. + -.5 ms/cm. The volume of 3M (NH4)2SO4 added was recorded and allowed to equilibrate with stirring at room temperature for 10min after complete addition.

Filtering with 0.22 μm water phase microporous membrane, measuring supernatant volume, and preparing for loading.

Example 4:

hydrophobic chromatography

Purification on a hydrophobic column (Capto Butyl, XK26/200mm, CV. RTM. 50mL, flow rate 8mL/min)

Tn5 Capto Butyl Buffer A 20mM Hepes，1.2M(NH4)2SO4，pH7.2，25℃

Tn5 Capto Butyl Buffer B 20mM Hepes，pH7.2，25℃

Pipeline cleaning

The process water, Tn5 Capto Butyl Buffer A, Tn5 Capto Butyl Buffer B ultrasonic degassing for 5 minutes.

A1, A2, B1, B2, S1 and Buffer Pump heads of AKTA are put into process water, Pump B2, A2, B1, S1, Buffer and A1 Pump Wash are set and executed.

System pump and Buffer placement.

AKTA A1, A2, B1, B2, S1 and Buffer pumps were placed in the following Table Buffer

Pump	Moving phase
		System Pump A1	Tn5 Capto Butyl Buffer A
System Pump A2	Process water
		System Pump B1	Tn5 Capto Butyl Buffer B
System Pump B2	0.2M NaOH
		Sample Pump Buffer	Tn5 Capto Butyl Buffer A
Sample Pump S1	Tn5 Capto Butyl Buffer A

Pump B2, A2, B1, S1, Buffer and A1 Pump Wash are set and executed.

A2 pump flow rate of 0.5mL/min was set and the column was connected.

Sample loading and purification

Sample preparation: the supernatant after salt supplementation and filtration was recorded in volume.

The method comprises the following steps:

cleaning a pipeline and a purification column: after the experiment is finished, the chromatographic column is sequentially washed by using 20% ethanol, the chromatographic column and the system pipeline are stored in the 20% ethanol, the chromatographic column is detached and connected with an AKTA pipeline, and the chromatographic column is stored at 4 ℃.

Example 5:

affinity chromatography: Ni-HP column purification (Ni-HP, flow 5ml/min)

Filling: HisTrap FF 5ML

Column volume: 10ml of

Sample loading volume: 160ml of

The flow rate of the system: 5ml/min

Buffer solution:

Tn5 Ni Buffer A：20mM HEPES，800mM KCl，10％Glycerol，0.2％TritonX-100，pH＝7.2，25℃

Tn5 Ni Wash Buffer：20mM HEPES，800mM KCl，10％Glycerol，2％TritonX-100，pH＝7.2，25℃

Tn5 Ni Buffer B：20mM HEPES，800mM KCl，10％Glycerol，0.2％TritonX-100，250mM Imidazole)，pH＝7.2，25℃

pipeline cleaning

The process water, Tn5 Ni Buffer A, Tn5 Ni Wash Buffer and Tn5 Ni Buffer B are respectively subjected to ultrasonic treatment for 5 minutes for degassing treatment.

System pump and Buffer placement

AKTA A1, A2, B1, B2, S1 and Buffer Pump heads were placed in the following Table Buffer

Pump	Moving phase
		System Pump A1	Tn5 Ni Buffer A
System Pump A2	Tn5 Ni Wash Buffer
		System Pump B1	Tn5 Ni Buffer B
System Pump B2	Process water
		Sample Pump Buffer	Tn5 Ni Buffer A
Sample Pump S1	Tn5 Ni Buffer A/Sample

Pump B2, A2, B1, S1, Buffer and A1 Pump Wash are set and executed.

A B2 pump flow rate of 0.5mL/min was set and the column was connected.

Sample loading and purification

Sample preparation: and (4) recording the sample loading volume of the target protein eluent after the hydrophobic chromatography.

The method comprises the following steps:

remarking: the first Ni target protein elution peak was not collected, only the second target protein elution peak was collected.

Cleaning a pipeline and a purification column: after the experiment is finished, the chromatographic column is washed by using 500mM Imidazole, process water and 20% ethanol in sequence, the chromatographic column and a system pipeline are stored in the 20% ethanol, the chromatographic column is detached and connected with an AKTA pipeline, and the chromatographic column is stored at 4 ℃.

Example 6:

affinity chromatography: chitin affinity purification (Chitin Resin x 2, CV ═ 20mL x 2, filler loading: 2mg/mL)

1. A chromatographic column:

Chromatography Columns

(Bio-Rad #7372507)1CV ═ 10ml (Filler)

2. Chromatography packing: chitin Resin (NEB # S6651L)

3.Buffer

Tn5 Chitin AC Buffer A：20mM HEPES，800mM KCl，1mM EDTA，10％glycerol，0.2％TritonX-100pH＝7.2，25℃

Tn5 Chitin AC Buffer B：20mM HEPES，800mM KCl，1mM EDTA，10％glycerol，0.2％TritonX-100

100mM DTT，pH＝7.2，25℃

Sample loading amount: 20mL of purification column was loaded with 20g of wet bacteria to obtain 100mL of sample, Chitin Resin x 2, and total loading of 100mL x 2

DTT cleavage intein treatment time: 64h

The method comprises the following steps: (the protein of interest is in Elution 3)

The protein electrophoretogram of Chitin affinity is shown in FIG. 12 and FIG. 13:

the size of the Tn5 transposase was approximately 60kDa, and the size of the Tn5-Intein-His fusion protein was approximately 80 kDa.

Example 7:

ion exchange chromatography: CM-FF column purification (CM-FF)

1. A chromatographic column: HiTrap CM FF, 5ml (GE, #17515501)

2.Buffer:

Tn5 IEX Buffer A：20mM HEPES，20mM NaCl，1mM EDTA，5％Glycerol，0.05％Tween-20，1mM DTT，pH＝7.2，25℃

Tn5 IEX Wash Buffer：20mM HEPES，20mM NaCl，1mM EDTA，5％Glycerol，1％TritonX-100，1mM DTT，pH＝7.2，25℃

Tn5 IEX Buffer B：20mM HEPES，500mM NaCl，1mM EDTA，5％Glycerol，0.05％Tween-20，1mM DTT，pH＝7.2，25℃

Pipeline cleaning

The process water, Tn5 IEX Buffer A, Tn5 Wash Buffer, Tn5 IEX Buffer B were degassed by ultrasound for 5 minutes, respectively.

A1, A2, B1, B2, S1 and Buffer Pump heads of AKTA were put into the co-process water, and Pump B2, A2, B1, S1, Buffer and A1 Pump Wash were set and performed.

System pump and Buffer placement

Pump	Moving phase
		System Pump A1	Tn5 IEX Buffer A
System Pump A2	Tn5 Wash Buffer
		System Pump B1	Tn5 IEX Buffer B
System Pump B2	Process water
		Sample Pump Buffer	Tn5 IEX Buffer A
Sample Pump S1	Tn5 IEX Buffer A/Sample

Pump B2, A2, B1, S1, Buffer and A1 Pump Wash are set and executed.

A B2 pump was set at a flow rate of 0.5mL/min, and the column was connected to flush out the ethanol with water.

Sample loading and purification

Sample preparation: after the Chitin column, the eluate was diluted to a conductivity of 3mS/cm or less with Tn5 IEX Dilute Buffer (5mM HEPES, 2.5% Glycerol, pH 7.2, 25 ℃) and subjected to ion exchange chromatography.

The method comprises the following steps:

cleaning a pipeline and a purification column: after the experiment is finished, the chromatographic column is washed by 3M KCl, process water, 0.2M NaOH, process water and 20% ethanol in sequence, then the chromatographic column and a system pipeline are stored in the 20% ethanol, the chromatographic column is detached and connected with an AKTA pipeline, and the chromatographic column is stored at 4 ℃.

Example 8:

gel filtration chromatography: (HiLoad 16/600Superdex 200pg, 16mm x 700mm, CV 120mL)

1. Filling: HiLoad 16/600Superdex 200pg

Column volume: 120ml of

Flow rate: 1ml/min

Sample loading amount: 1ml of

Buffer solution:

Tn5 Gel Buffer:100mM HEPES，200mM NaCl，0.2mM EDTA，5％Glycerol，2mM DTT，pH＝7.4，25℃

pipeline cleaning

H2O and Tn5 Gel Buffer were degassed by sonication for 5 minutes, respectively.

A1, A2, B1, B2, S1 and Buffer Pump heads of AKTA were put into DEPC H2O, and Pump B2, B1, A2, S1, Buffer and A1 Pump Wash were set and executed.

System pump and Buffer placement

AKTA A1, B1, A2, B2, S1 and Buffer Pump heads were placed in the following Table Buffer

Pump	Moving phase
		System Pump A1	Tn5 Gel Buffer
Sample Pump Buffer	Tn5 Gel Buffer
		Sample Pump S1	Tn5 Gel Buffer/sample
System Pump B1	H2O
		System Pump A2	0.2M NaOH
System Pump B2	20% ethanol

Pump B1, S1, Buffer, and A1 Pump Wash are set and executed.

A B1 pump flow rate of 0.5mL/min was set and the column was connected.

Purification by loading (loading volume: 2% -3% of the CV, 0.22 μm filter or 10000g centrifugation for 10min, Conc. <10 mg/mL).

Sample preparation: the target eluate after the CM column was tested for concentration using UV280 with an extinction coefficient K of 1.475, and the concentration and volume were recorded. The protein eluate was centrifuged (3500rpm, 4 ℃) using a 30KD ultrafiltration tube to a concentration of less than 10mg/mL and the total volume after concentration was recorded, and the batch was loaded with 1-2mL portions of quantification circle.

The method comprises the following steps:

cleaning a pipeline and a purification column: after the experiment is finished, the chromatographic column and the system pipeline are stored in 20% ethanol, the chromatographic column is detached and connected with an AKTA pipeline, and the chromatographic column is stored at 4 ℃.

Remarking: if the pressure before the column is less than or equal to 0.8MPa, the flow rate can be adjusted to 1.5 mL/min.

Example 9:

membrane-pack concentration

Measuring the protein concentration by using UV280, and quantifying the protein concentration mg/mL collected in the step by using an extinction coefficient K of 1.475, and respectively recording the volume and the amount of the target protein;

cleaning a film package: connecting the membrane package to a peristaltic pump, setting the rotation speed of the peristaltic pump to be 300rpm, placing a liquid inlet pipe into ultrapure water, placing a liquid outlet pipe into a waste liquid barrel, starting to clean the membrane package, and cleaning the liquid in the membrane package after the volume of the membrane package is about 200 ml;

protein concentration: putting the liquid inlet pipe and the liquid outlet pipe into a medium to be concentrated at the same time, starting a peristaltic pump to concentrate until the volume of Tn5-Gel is the minimum volume of the membrane package, and then emptying the membrane package and the enzyme liquid in the pipeline;

after membrane concentration, after filtration through a 0.22um filter membrane, the protein concentration was tested using UV280, and the filtered protein concentration was quantified at 1.0mg/mL with an extinction coefficient K of 1.475;

adding isovolumetric sterilized glycerol, recording batch number and addition volume (mL), the concentration is 0.50 mg/mL;

adding additives:

the final concentration was 0.1% Triton-100, and the 100% Triton-100 mother liquor batch number (batch number: SLBW7103) and addition volume (. mu.L) were recorded;

the final concentration was 0.1% Tween-20, and the batch number (batch number: SLBZ8563) and addition volume (μ L) of the 100% Tween-20 mother liquor were recorded;

the high concentration product Tn5, recorded lot number, was 0.50mg/ml), the mother liquor was divided into 500. mu.L/tube and stored at-20 ℃.

Example 10:

tn5 transposase quantification and purity determination

And (3) detection process: protein concentration was tested using UV280 and the filtered protein concentration was quantified with an extinction coefficient K of 1.475 of 1.0 mg/mL;

equal volume of sterilized glycerol was added, and the batch number (batch number: 20181212) and the volume of addition (mL) were recorded at a concentration of 0.50 mg/mL;

20200304#1P1 has a purity of less than about 80% after concentration and SDS-PAGE analysis.

The electrophoretogram is shown in FIG. 25.

	1	2	3
				Source	Translation enzyme Tn5	Mark marker	Qiangwei special for curing cancer
Sample loading volume	5ul	3ul	2ul
				Amount of Lane enzyme	3.7ug	-	Estimated to be 1.23ug

12g of the bacteria (1L of the bacterial solution) can be purified to obtain 10mg of protein

Pierce^TM BCA Protein Assay Kit

(Thermo Scientific，Lot：23227)

The concentration of the separation gel is 10 percent

Single well loading volume: 5ul

The electrophoretogram is shown in FIG. 26 and FIG. 27,

20200313#1P1 was concentrated and analyzed by SDS-PAGE to be 89.3% pure,

20200313#1P2 was concentrated and 92.8% pure by SDS-PAGE.

Example 11:

tn5 transposase endonuclease residue detection

Detection is carried out according to the national standard GB/T35542 and 2017.

pUC19 plasmid reaction

Adding 4ul pUC19 plasmid DNA (1ug/ul), 14ul purified water and 2ul enzyme into the test tube, mixing with an oscillator, and water-bathing for 1 h;

adding 4ul pUC19 plasmid DNA (1ug/ul) and 16ul purified water into the control tube, mixing with an oscillator, and water-bathing for 1 h;

electrophoresis is carried out on 1% -1.5% agarose gel, the electrophoresis voltage is 5V/cm-10V/cm, the electrophoresis is stopped when bromophenol blue rays reach a gel plate 2/3, the gel plate is taken out and placed in an ultraviolet light transmission analyzer for observation and photographing;

after reacting at 37 ℃ for 1h, 20ul of sample is removed and stored at-80 ℃ in a cold state, the rest sample (about 30ul) reacts at 37 ℃ for 14h, and the electrophoresis detection is carried out, which is detailed in figure 28.

Example 12:

tn5 transposase exonuclease residue detection

The detection method carries out detection according to the national standard GB/T35542-

And (3) carrying out long-time enzyme digestion: after the reaction is carried out for 10 hours at the temperature of 37 ℃,

after reacting for 10h at 37 ℃, sampling and carrying out agarose gel electrophoresis detection

DNA recovery

20ul of the product of the long-term digestion was added to 20ul of chloroform-isoamyl alcohol solution (chloroform: isoamyl alcohol (V/V) ═ 24:1) to elute the foreign matter, precipitate DNA, and the DNA was lyophilized under vacuum.

Ligation reaction

Item	Adding amount of
		Vacuum drying of samples	0ul
T4 DNA Ligase	1ul
		10*T4 Buffer	2ul
ddH2O	17ul
		Total volume	20ul

After reaction at 15 ℃ for 8h, 2ul of the ligation products were transformed into DH5 α cells, plated on different gradients and incubated overnight at 37 ℃.

The total number of white spots of the experimental groups (2, 3 and 4) is respectively less than that of the blue spots of the previous control group (1), and the ratio is less than 1/9, which is detailed in FIG. 29 and FIG. 30.

The electrophoretogram is shown in FIG. 31.

Example 13:

the mutant showed more concentrated sorting of the fragment of interest (300-600bp) compared to the wild type.

The Tn5 transposase mutant in this example 13 refers to the Tn5 transposase prepared by the procedures of examples 1-12, and the commercial enzymes mentioned or the Tn5 transposase wild type are both strong Tn5 transposases (model M0221)

Tn5MEDS preparation

Tn5ME-A, Tn5ME-B and Tn5MERev 12000rpm were centrifuged for 1min and diluted to 100uM by adding 1 XTE Buffer.

The system was formulated as follows and the thermal cycling program was run:

Components	Concentration
		Tn5ME-A(100μM)	50μl
Tn5MErev(100μM)	50μl

Components	Concentretion
		Tn5ME-B(100μM)	50μl
Tn5MErev(100μM)	50μl

transposome Synthesis

The PCR instrument is stored at 60 ℃, 25 ℃, 1h and-20 ℃ respectively.

gDNA fragmentation and purification (50ng)

Components	Concentration
		K562gDNA(Qubit 10ng/μl)	5μl
5x LM Buffer/5xTAMD Buffer	6μl
		Transposome	1ul/2μl
DEPC Water	Up to 30μl

The PCR instrument was preheated to 55 ℃ and covered with a hot lid at 105 ℃.

Fragmenting at 55 deg.C for 10min, immediately taking out, cooling in ice bath for 3min, adding 1ul 5% SDS, and mixing.

The reaction was terminated at 55 ℃ for 5min, and immediately taken out of the ice bath to cool for 3 min.

The recovered fragments were purified using 1 XKAPAPure Beads, and eluted with 23ul DEPC Water.

cDNA fragmentation and purification (5ng)

Components	Concentration
		K562cDNA(Qubit 4ng/μl)	125μl
5x LM Buffer/5xTAMD Buffer	6ul
		Transposome	1ul/2μl
DEPC Water	Up to 30μl

PCR enrichment and fragment sorting.

Components	Concentration
		N5XX(10μM)	2ul
N7XX(10μM)	2μl
		2×KAPA HiFi HotStar Ready Mix	25μl
DNA	21μl

PCR enrichment was complete and 300-600bD fragments were sorted using 0.6X/0.15X KAPAPure Beads, eluted with 26ul DEPC Water.

Fragmentation of gDNA human genome DNA, PCR enrichment and sorting of 300bp-600 bp:

and (4) experimental conclusion: fragmentation at 55 ℃ for 10 min: 20200313#1P1Tn5 transposase mutant has similar fragmentation effect to commercial enzyme, and the addition of the same Transposome transposon results in less Adapter linker shedding from Tn5 transposase than commercial enzyme, but the two sets of minor bands of 20200313#1P1 and 20200313#1P2 are different from Tn5 transposase in fragmentation effect, which is shown in FIG. 32.

PCR enrichment and 300bp-600bp sorting: the difference between the size of the PCR-enriched translation enzyme Tn5 fragment library and the size of the strong special group is not obvious, and after the separation of 300-bp fragments, all experimental groups have no small fragments below 300 bp. 20200313#1P1Tn5 transposase mutant transposase performance was superior to 20200304#1P1 wild type Tn5, as detailed in FIG. 33.

30ul fragmentation system the strong microtome group and 20200313#1P1Tn5 transposase mutant group in the 1ul Transposome group were added and fragmented completely, and the 20200304#1P 1Tn5 wild type group was apparently not fragmented completely.

The 30ul fragmentation system added the strong microtome group and 20200313#1P1Tn5 transposase mutant group in the 2ul Transposome group, which fragmented completely, while the 20200304#1P 1Tn5 wild-type group did not fragment completely.

Overall analysis shows that the fragmentation effect of 20200313#1P1Tn5 transposase mutant is close to that of commercial enzyme, and the Adapter released from Tn 5-producing transposase is less than that of commercial enzyme under the same addition amount of the Transposome, but the fragmentation effect of the Tn5 transposase is not obvious due to the difference of two side bands of 20200313#1P1 and 20200313#1P 2.

PCR enrichment and 300-fold 600bp fragment sorting:

the difference between the size of the PCR-enriched translation enzyme Tn5 fragment library and the size of the strong special group is not obvious, and after the separation of 300-bp fragments, all experimental groups have no small fragments below 300 bp.

The 30ul fragmentation system has large fragments of more than 1000bp in 1ul Transposome group, and the large fragments of the Tn5 transposase self-produced in 3 groups have no obvious difference with the commercial enzyme.

The difference between the two groups of side bands of 20200313#1P1 and 20200313#1P2 in the group is Tn5 transposase, and the sorting difference after PCR enrichment and fragmentation is not obvious.

The 30ul fragmentation system added 2ul of the Transposome group 20200313#1P1 with fragment effect and large fragment residual closest to the commercial enzyme. The two groups of minor band differences of 20200313#1P1 and 20200313#1P2 in the group are Tn5 transposases, 20200313#1P1Tn5 transposases (minor band) have the closest effect to commercial enzymes, and the residue of large fragments is less than 20200313#1P2 (major minor band).

It can be seen that 20200313#1Tn5 transposase mutant has better performance than 20200304#1P 1Tn5 transposase wild type.

cDNA fragmentation, PCR enrichment and 300bp-600bp sorting:

and (4) experimental conclusion: fragmentation at 55 ℃ for 10min, i.e., the adapters detached from Tn 5-producing transposase were all less than the commercial enzymes at the same amount of Transposome transposon added. See fig. 34 for details.

PCR enrichment and 300bp-600bp sorting: 20200313#1P1Tn5 transposase group and the commercial enzyme group have no obvious total difference in library size after enrichment. See fig. 35 for details.

It is clear that the adapters that fall off from Tn 5-producing transposase were less than the commercial enzymes at the same amount of Transposome added.

PCR enrichment and 300-fold 600bp fragment sorting:

20200304#1P 1Tn5 transposase wild group also has heavier residual Dimer, and the total difference of the size of the library and the like after the 20200313#1Tn5 transposase mutant group and the commercial enzyme group are enriched is not obvious.

The library amount and purity of the 1ul Transposome group added by the 30ul fragmentation system are better than those of the 2ul Transposome group added by the 30ul fragmentation system, and the conclusion is that the addition of too much Transposome in a small amount of the initial template leads to fragmentation and over-fragmentation to generate small fragments, so that the required target fragments (300bp-600bp) are reduced.

Under the same addition amount of the Transposome, the 20200313#1Tn5 transposase mutant group and the commercial enzyme group are not obviously different.

It can be seen that 20200313#1Tn5 transposase mutant has better performance than 20200304#1P 1Tn5 transposase wild group.

Example 14:

tn5 transposase the mutant has a non-sequence bias

Fragmentation experiments were performed using the KAPA digestion kit (KAPA cat # KK8600)

The Tn5 transposase mutant in this example 14 refers to the Tn5 transposase prepared by the procedures of examples 1-12, and the control wild type Tn5 transposase was a strong Tn5 transposase (model M0221)

The experimental results are as follows:

(1) as can be seen from FIG. 36, Tn5 transposase mutant: 20200313#1P1, the uniformity was relatively good.

(2) As can be seen from FIG. 37, Tn5 transposase mutant: 20200313#1P2, the uniformity was relatively good.

(3) As can be seen from FIGS. 38 and 39, wild type Tn5 transposase: 20200304#1P1, the uniformity was poor.

(4) As can be seen from fig. 40 and 41, the control kit: the cut fragments were not uniform in size or the fragments were not cut.

In conclusion: the Tn5 purified transposase obtained by constructing a full-length target gene sequence containing Tn5 transposase gene, an intein gene and a chitin gene, connecting the full-length target gene sequence to a vector and then introducing the vector into escherichia coli for expression and adopting a novel protein fusion expression and purification system can efficiently insert Tn5 transposon into a target sequence without sequence bias selection.

It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Suzhou translation enzyme Biotechnology Ltd

SUZHOU HUIZHEN BIOTECHNOLOGY Co.,Ltd.

<120> Tn5 transposase and preparation method thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2208

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tctagaaata attttgttta actttaagaa ggagatttaa atatgattac atcagcttta 60

catcgtgctg ctgattgggc taaatcagtt tttagttcag ctgctttagg ggatccacgt 120

cgcactgcac gtttggtaaa cgtcgcggca caactggcta agtattcagg caaatctatc 180

acgatctcta gtgaggggag caaggctatg caggagggag cgtatcgttt tattcgcaat 240

cccaatgttt ccgctgaggc tattcgtaag gccggagcca tgcagactgt aaaactggca 300

caagaattcc cggaactttt ggcaattgaa gatacaacct cgcttagtta tcgtcaccaa 360

gtggcagaag agcttggtaa attaggctcc atccaggata agagtcgtgg ctggtgggta 420

cattcggtgc tgttgttaga ggcgacgact tttcgcacgg tgggtttatt gcaccaggag 480

tggtggatgc gcccagatga cccagcagat gccgatgaaa aggagtccgg taaatggtta 540

gctgcggcgg ccacatcccg tctgcgcatg gggtcaatga tgagtaacgt catcgcagtc 600

tgtgaccgtg aagcggacat ccacgcctac cttcaagata agcttgcgca taacgagcgt 660

tttgtcgttc gcagcaaaca tccccgcaag gatgtcgaat ctggactgta cttgtatgac 720

catttaaaga accagcctga gctgggaggt taccagatta gcattcctca gaaaggcgtg 780

gtagacaaac gcggtaaacg caagaaccgt ccagcccgta aggcctcttt gagcctgcgt 840

agcgggcgca tcacacttaa acagggcaac atcaccttaa acgcggtcct ggccgaagaa 900

attaaccccc caaagggtga gactccattg aagtggttat tgcttacctc agaaccagtt 960

gagagtttgg cgcaggccct gcgtgttatc gacatttaca cacatcgttg gcgtattgag 1020

gaattccaca aggcatggaa gacaggtgct ggcgcagagc gtcagcgtat ggaggaaccg 1080

gataatctgg agcgtatggt ctcgattctt tcgttcgtag cggtgcgcct tcttcagctg 1140

cgtgaatcat tcacaccgcc acaggctctt cgcgcgcagg gtctgttgaa ggaagcagag 1200

cacgtcgagt cacaaagcgc agagactgtg cttactccag atgaatgcca gttgcttggg 1260

tacttggaca aaggaaaacg taagcgtaag gaaaaggccg ggagtcttca gtgggcttac 1320

atggctattg cacgtttagg tgggttcatg gattccaaac gtacagggat tgccagttgg 1380

ggcgcgcttt gggagggctg ggaggcattg cagtcaaagc tggacggatt tctggccgcc 1440

aaggacctta tggcccaagg aattaagatc ggttgcctgt ccttcggtac cgaaatcctg 1500

accgttgaat acggtccgct gccgatcggt aaaatcgttt ccgaagaaat caactgctcc 1560

gtttactccg ttgacccgga aggtcgtgtt tacacccagg ctatcgctca gtggcacgac 1620

cgtggtgaac aggaagttct ggaatacgaa ctggaagacg gatctgttat ccgtgctacc 1680

tccgaccacc gtttcctgac caccgactac cagctgctgg ctatcgaaga aatcttcgct 1740

cgtcagctgg acctgctgac cctggaaaac atcaaacaga ccgaagaagc tctggacaac 1800

caccgtctgc cgttcccgct gctggacgct ggcaccatca aaggtgcctc tacaaatcct 1860

ggtgtatccg cttggcaggt caacacagct tatactgcgg gacaattggt cacatataac 1920

ggcaagacgt ataaatgttt gcagccccac acctccttgg caggatggga accatccaac 1980

gttcctgcct tgtggcagct tcaaggtggt ggctctatgg ttaaagttat cggtcgtcgt 2040

tccctgggtg ttcagcgtat cttcgacatc ggtctgccgc aggaccacaa cttcctgctg 2100

gctaacggtg ctatcgctgc tgctggcacc ggtatgaaaa agattatttt gactgtcgag 2160

ggtggcggtc atcatcacca ccaccatcat caccatcact aactcgag 2208

<210> 3

<211> 733

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ser Ala Ala Ala Pro Val Leu Gly Gly Ala Leu Ala Met Ile Thr Ser

1 5 10 15

Ala Leu His Ala Ala Ala Ala Thr Ala Leu Ser Val Pro Ser Ser Ala

20 25 30

Ala Leu Gly Ala Pro Ala Ala Thr Ala Ala Leu Val Ala Val Ala Ala

35 40 45

Gly Leu Ala Leu Thr Ser Gly Leu Ser Ile Thr Ile Ser Ser Gly Gly

50 55 60

Ser Leu Ala Met Gly Gly Gly Ala Thr Ala Pro Ile Ala Ala Pro Ala

65 70 75 80

Val Ser Ala Gly Ala Ile Ala Leu Ala Gly Ala Met Gly Thr Val Leu

85 90 95

Leu Ala Gly Gly Pro Pro Gly Leu Leu Ala Ile Gly Ala Thr Thr Ser

100 105 110

Leu Ser Thr Ala His Gly Val Ala Gly Gly Leu Gly Leu Leu Gly Ser

115 120 125

Ile Gly Ala Leu Ser Ala Gly Thr Thr Val His Ser Val Leu Leu Leu

130 135 140

Gly Ala Thr Thr Pro Ala Thr Val Gly Leu Leu His Gly Gly Thr Thr

145 150 155 160

Met Ala Pro Ala Ala Pro Ala Ala Ala Ala Gly Leu Gly Ser Gly Leu

165 170 175

Thr Leu Ala Ala Ala Ala Thr Ser Ala Leu Ala Met Gly Ser Met Met

180 185 190

Ser Ala Val Ile Ala Val Cys Ala Ala Gly Ala Ala Ile His Ala Thr

195 200 205

Leu Gly Ala Leu Leu Ala His Ala Gly Ala Pro Val Val Ala Ser Leu

210 215 220

His Pro Ala Leu Ala Val Gly Ser Gly Leu Thr Leu Thr Ala His Leu

225 230 235 240

Leu Ala Gly Pro Gly Leu Gly Gly Thr Gly Ile Ser Ile Pro Gly Leu

245 250 255

Gly Val Val Ala Leu Ala Gly Leu Ala Leu Ala Ala Pro Ala Ala Leu

260 265 270

Ala Ser Leu Ser Leu Ala Ser Gly Ala Ile Thr Leu Leu Gly Gly Ala

275 280 285

Ile Thr Leu Ala Ala Val Leu Ala Gly Gly Ile Ala Pro Pro Leu Gly

290 295 300

Gly Thr Pro Leu Leu Thr Leu Leu Leu Thr Ser Gly Pro Val Gly Ser

305 310 315 320

Leu Ala Gly Ala Leu Ala Val Ile Ala Ile Thr Thr His Ala Thr Ala

325 330 335

Ile Gly Gly Pro His Leu Ala Thr Leu Thr Gly Ala Gly Ala Gly Ala

340 345 350

Gly Ala Met Gly Gly Pro Ala Ala Leu Gly Ala Met Val Ser Ile Leu

355 360 365

Ser Pro Val Ala Val Ala Leu Leu Gly Leu Ala Gly Ser Pro Thr Pro

370 375 380

Pro Gly Ala Leu Ala Ala Gly Gly Leu Leu Leu Gly Ala Gly His Val

385 390 395 400

Gly Ser Gly Ser Ala Gly Thr Val Leu Thr Pro Ala Gly Cys Gly Leu

405 410 415

Leu Gly Thr Leu Ala Leu Gly Leu Ala Leu Ala Leu Gly Leu Ala Gly

420 425 430

Ser Leu Gly Thr Ala Thr Met Ala Ile Ala Ala Leu Gly Gly Pro Met

435 440 445

Ala Ser Leu Ala Thr Gly Ile Ala Ser Thr Gly Ala Leu Thr Gly Gly

450 455 460

Thr Gly Ala Leu Gly Ser Leu Leu Ala Gly Pro Leu Ala Ala Leu Ala

465 470 475 480

Leu Met Ala Gly Gly Ile Leu Ile Gly Cys Leu Ser Pro Gly Thr Gly

485 490 495

Ile Leu Thr Val Gly Thr Gly Pro Leu Pro Ile Gly Leu Ile Val Ser

500 505 510

Gly Gly Ile Ala Cys Ser Val Thr Ser Val Ala Pro Gly Gly Ala Val

515 520 525

Thr Thr Gly Ala Ile Ala Gly Thr His Ala Ala Gly Gly Gly Gly Val

530 535 540

Leu Gly Thr Gly Leu Gly Ala Gly Ser Val Ile Ala Ala Thr Ser Ala

545 550 555 560

His Ala Pro Leu Thr Thr Ala Thr Gly Leu Leu Ala Ile Gly Gly Ile

565 570 575

Pro Ala Ala Gly Leu Ala Leu Leu Thr Leu Gly Ala Ile Leu Gly Thr

580 585 590

Gly Gly Ala Leu Ala Ala His Ala Leu Pro Pro Pro Leu Leu Ala Ala

595 600 605

Gly Thr Ile Leu Gly Ala Ser Thr Ala Pro Gly Val Ser Ala Thr Gly

610 615 620

Val Ala Thr Ala Thr Thr Ala Gly Gly Leu Val Thr Thr Ala Gly Leu

625 630 635 640

Thr Thr Leu Cys Leu Gly Pro His Thr Ser Leu Ala Gly Thr Gly Pro

645 650 655

Ser Ala Val Pro Ala Leu Thr Gly Leu Gly Gly Gly Gly Ser Met Val

660 665 670

Leu Val Ile Gly Ala Ala Ser Leu Gly Val Gly Ala Ile Pro Ala Ile

675 680 685

Gly Leu Pro Gly Ala His Ala Pro Leu Leu Ala Ala Gly Ala Ile Ala

690 695 700

Ala Ala Gly Thr Gly Met Leu Leu Ile Ile Leu Thr Val Gly Gly Gly

705 710 715 720

Gly His His His His His His His His His His Leu Gly

725 730

<210> 3

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tctagaaata attttgttta actttaagaa ggagatttaa at 42

Claims

1. A Tn5 transposase comprising: the expression genes include Tn5 transposase gene, intein gene and chitin gene.

2. A Tn5 transposase as claimed in claim 1 wherein: the expression gene sequence is shown as SEQ ID NO. 1.

3. A Tn5 transposase as claimed in claim 2 wherein: the amino acid sequence expressed by the expression gene is shown as SEQ ID NO. 2.

4. A preparation method of Tn5 transposase is characterized in that: the method comprises the following steps:

(1) synthesizing an expression gene containing Tn5 transposase gene, an intein gene and a chitin gene;

(2) obtaining fusion protein of Tn5 transposase, chitin and intein through an escherichia coli expression system;

(3) performing chitin affinity chromatography to capture fusion protein of Tn5 transposase, chitin and intein;

(4) cutting off intein by DTT, and removing chitin label to obtain coarse Tn5 transposase;

(5) the crude Tn5 transposase was purified and concentrated by chromatography to obtain Tn5 transposase.

5. The method of claim 4, wherein the Tn5 transposase comprises: the sequence of the synthetic expression gene is shown as SEQ ID NO. 1.

6. The method of claim 4, wherein the Tn5 transposase comprises: the Escherichia coli expression system comprises the following specific steps:

a. constructing a vector, and performing seed culture to obtain a plasmid containing a target gene;

b. inducing expression: transferring the plasmid of the target gene into escherichia coli for expression;

c. enriching thalli, and crushing escherichia coli to obtain a crude enzyme lysate;

d. performing hydrophobic chromatography to remove impurities with large hydrophobic difference;

7. the method of claim 4, wherein the Tn5 transposase comprises: the chromatography specifically comprises:

e. purifying the Tn5 transposase by ion exchange chromatography;

f. displacing Tn5 transposase into a preservation solution by adopting gel filtration chromatography;

g. the Tn5 transposase with high purity and high concentration is obtained by ultrafiltration concentration.

8. The method of claim 6, wherein the plasmid of the target gene is pET-28a, and the RBS sequence of the plasmid is shown as SEQ ID No. 3.