CN114350530B - Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria - Google Patents
Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria Download PDFInfo
- Publication number
- CN114350530B CN114350530B CN202210133102.5A CN202210133102A CN114350530B CN 114350530 B CN114350530 B CN 114350530B CN 202210133102 A CN202210133102 A CN 202210133102A CN 114350530 B CN114350530 B CN 114350530B
- Authority
- CN
- China
- Prior art keywords
- aspergillus
- strain
- pathogenic bacteria
- plant pathogenic
- botrytis cinerea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/34—Aspergillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria. Aspergillus sp S53 was isolated from suaeda glauca rhizosphere soil collected from the ocean river estuary of Qingdao city and deposited at China center for type culture collection, date of deposit: 2021, 11/11, accession number: cctccc No. m 20211401. The strain fermentation product can obviously inhibit pathogenic bacteria of important cash crops such as multi-drug resistant botrytis cinerea and apple rot bacteria. In addition, the strain has remarkable stress resistance and saline-alkali tolerance, and can grow rapidly even on the surface of a PDA culture medium added with 3.5% sea salt. This shows that the aspergillus glaucus S53 from suaeda has the potential to be developed as a biological bactericide for broad-spectrum control of various plant pathogenic bacteria, and can be applied to the saline-alkali soil environment.
Description
Technical Field
The invention belongs to the field of microbial pesticides. In particular, the invention relates to an aspergillus S53 strain and its use in inhibiting plant pathogenic bacteria.
Background
Botrytis cinerea (Botrytis cinerea) is a pathogenic fungus of Botrytis cinerea and is listed as one of ten plant fungal diseases in the world. Botrytis cinerea can infect rhizomes, leaves, flowers and fruits of plants, affecting over 200 crops. In China, botrytis cinerea seriously damages the growth of important cash crops such as tomatoes, strawberries, grapes and the like, and huge economic losses are caused each year. Botrytis cinerea is a plant pathogenic bacterium suitable for growing in a low-temperature and high-humidity environment. In agricultural production, the temperature in the greenhouse is usually kept at 15-20 ℃, and the temperature has higher relative humidity, so that the gray mold disease is easy to occur in a large range. During the storage and transportation of the picked crops, botrytis cinerea can accelerate the decay and deterioration of the Botrytis cinerea, which leads to serious logistic loss.
At present, the control means of the botrytis cinerea mainly uses chemical bactericides, and can effectively inhibit diseases, but compared with other plant pathogenic bacteria, the genetic variability of the botrytis cinerea is strong, the botrytis cinerea is easy to generate drug resistance to the chemical bactericides with relatively single action targets, and the problem of neck blocking which needs to be solved in the current control of the botrytis cinerea is solved. In addition, excessive application of chemical bactericides for a long time can cause pesticide residues to exceed standards, pollute the environment and harm the health of people and animals. Similar to Botrytis cinerea, apple rot germ (Valsa mali) is one of important plant diseases in apple production, and also faces the problems caused by long-term application of chemical bactericides.
Compared with chemical bactericides, research and development of biological bactericides have become one of important measures for controlling plant diseases. Among them, the search for potential strains from microorganisms that inhibit plant pathogenic bacteria has become one of the most important directions of biological bactericides. At present, part of strains in bacteria such as bacillus and streptomyces, fungi such as trichoderma and penicillium have been successfully developed into commercial bactericides. The application of the biological bactericide can effectively reduce the use of chemical pesticides, has good compatibility with the environment, and also accords with the development trend of green and healthy agricultural product production in China.
Disclosure of Invention
The invention aims to provide aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria. The strain is easy to ferment and produce in a large scale, and the fermentation product can obviously inhibit pathogenic bacteria of important cash crops such as multi-resistant botrytis cinerea, apple canker and the like, has obvious stress resistance and salt and alkali resistance, and can be developed into a biological bactericide for preventing and treating various plant pathogenic bacteria in a broad spectrum.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
a strain S53 of Aspergillus sp, isolated from suaeda salsa rhizosphere soil collected from the ocean river estuary of Qingdao city; the strain is preserved in China Center for Type Culture Collection (CCTCC) No. M20211401 at 11 and 11 days 2021.
The application of the aspergillus strain S53 in preparing a fermentation product for inhibiting plant pathogenic bacteria; the plant pathogenic bacteria are multi-drug resistant botrytis cinerea and apple rot bacteria.
Based on the scheme, the preparation method of the fermentation product of the aspergillus strain S53 comprises the following steps:
1) Inoculating Aspergillus strain S53 on the surface of PDA plate containing 3.5% sea salt, culturing at 28deg.C until colony is spread on the surface of plate;
2) Cutting the activated strain, inoculating to sterilized liquid culture medium, standing at 28deg.C, fermenting for 30d; the liquid culture medium is prepared from 2% of sucrose, 2% of mannitol, 0.5% of peptone, 0.3% of yeast extract powder, 20% of artificial seawater (3.5% of sea salt) potato extract liquid and pH 7; the above percentages are by weight;
3) Extracting the fermentation medium with an organic solvent, and distilling the extracting solution under reduced pressure to obtain a fermentation product; the organic solvent is one or more of dichloromethane, ethyl acetate or n-butanol; ethyl acetate is preferred.
Based on the scheme, the fermentation product of the aspergillus strain S53 is used for preparing a biological bactericide for inhibiting plant pathogenic bacteria; the plant pathogenic bacteria are multi-drug resistant botrytis cinerea and apple rot bacteria.
The invention has the following advantages:
1) The fermentation product of the invention can be obtained by fermenting, culturing, extracting and separating aspergillus strain S53, and has the advantages of easy mass fermentation production, relatively simple process, easy degradation in environment, low toxicity to human and livestock, and the like.
2) The antibacterial circle of the fermentation product of the invention for two strains of multi-drug resistant botrytis cinerea is larger than 20mm, and the antibacterial circle for apple rot pathogen is also larger than 20mm, thus being capable of obviously inhibiting the hypha growth of the plant pathogen. This suggests that aspergillus strain S53 has the potential to develop a biological bactericide for broad-spectrum control of a variety of plant pathogenic bacteria.
3) Aspergillus strain S53 has remarkable stress resistance and salt and alkali resistance, and can be spread on the whole plate after being inoculated in the center of a 9cm PDA plate containing 3.5% sea salt for 3 days. This shows that the strain can be applied to the saline-alkali soil environment and has stronger adaptability.
Drawings
FIG. 1 is a photograph of the front and back sides of a PDA plate of Aspergillus strain S53
FIG. 2 shows the inhibition of the growth of the Aspergillus strain S53 fermentation product against the multiple resistant Botrytis cinerea WC1-3
FIG. 3 shows the inhibition of the growth of the multidrug-resistant Botrytis cinerea WC1-4 by the fermentation product of Aspergillus strain S53
FIG. 4 shows the inhibitory effect of fermentation product of Aspergillus strain S53 on growth of apple rot germ
Biological preservation information
The strain S53 is identified as Aspergillus sp and is preserved in China center for type culture collection, the preservation address is eight-path 299-No. WU Han university China center for type culture collection in He Wuhan mountain area of Hubei province, the preservation number is CCTCC No. M20211401, and the preservation date is 2021, 11 and 11 days.
Detailed Description
The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are illustrative only and are not intended to limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.
Example 1: isolation and identification of Aspergillus sp Strain S53
(1) Isolation of strains
The strain S53 is separated from suaeda salsa rhizosphere soil collected by a green island ocean river sea entrance wetland, and is obtained by adopting a flat plate dilution coating and scribing method, and the specific steps are as follows: (1) Placing suaeda salsa rhizosphere soil in an oven, and drying residual moisture at 60 ℃; (2) Taking 1g of soil sample to a 250 mL triangular flask, adding 100mL of sterile water, shaking at 28 ℃ for 10min at 150r/min to obtain a soil suspension mother solution, and sequentially diluting to 10 -1 、10 -2 10 -3 Concentration; (3) Respectively sucking 100 mu L of the diluent, uniformly coating on a PDA double-antibody culture medium plate containing 3.5% sea salt, and arranging three parallel gradients; (4) Standing and culturing the flat plate at 28 ℃, picking out colonies with different forms on the surface of a culture medium, carrying out streak separation on a PDA double-antibody culture medium flat plate containing 3.5% sea salt, and observing the growth condition of the colonies at regular time; (4) And (5) continuing to adopt a plate streaking method to separate and purify the strain, and numbering and storing.
(2) Identification of strains
Strain S53 was inoculated onto the surface of PDA plates containing 3.5% sea salt and incubated at 28℃for 3d, see FIG. 1. As can be seen, the strain S53 is cultured for 3 days, and hyphae can be paved on the whole plate, so that the strain has obvious stress resistance and salt and alkali resistance. The mycelia at the center of the colonies were tan and yellow-brown at the edges, and a large number of brown conidia were scattered. The center of the back of the colony is yellow brown, and the edge is light yellow.
The rDNA gene sequence of the strain (ITS-5.8S-ITS 2 region) was determined as follows:
GGGTTCTGAGTGAGGTCCTCGGGGCCCAACCTCCCACCCGTGTATACCGT ACCTTGTTGCTTCGGCGGGCCCGCCGCGCAAGCGGCCGCCGGGGGGGGCGTC AAACCCCCCTCCCTAGGCGAGCGCCCGCCGGAGACACCAACGTGAACACTGTC TGAAGTTTTGTTGTCTGAGTTCGATTGTATCGCAATCAGTTAAAACTTTCAACAA TGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAAT GTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCACCCCC TGGTATTCCGGGGGGTATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGC TTGTGTGTTGGGTCGTCGTCCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGG CACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTTGTAGGCCC GGCCGGCGCTGGCCGACGCTGAAAAGCAACCAACTATTTCTCCAGGTTGACCT CGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGA
the sequence information is compared with the corresponding sequence information of known strains in a Genbank database, and the similarity with the strain Aspergillus subramanianii (Accession number: KP 329614.1) is the highest, and is 99.31%.
In summary, strain S53 was identified as Aspergillus sp, which was deposited with the chinese collection of typical cultures at 11/2021 under the accession number cctccc No. m 20211401.
Example 2: preparation of fermentation product of Aspergillus strain S53
(1) Selecting a small amount of aspergillus strain S53 stored on the inclined surface of a PDA culture medium containing 3.5% sea salt, inoculating the aspergillus strain S53 on the surface of a PDA flat plate containing 3.5% sea salt, and culturing at 28 ℃ until bacterial colonies are fully paved on the surface of the flat plate for later use;
(2) Cutting Aspergillus strain S53 (about 2cm×2 cm) on the surface of the above plate, inoculating into sterilized conical flask containing liquid culture medium, standing at 28deg.C, fermenting for 30d; the liquid culture medium is prepared from 2% of sucrose, 2% of mannitol, 0.5% of peptone, 0.3% of yeast extract powder, 20% of artificial seawater (3.5% of sea salt) potato extract liquid and pH 7;
(3) Extracting the fermentation medium with ethyl acetate, and distilling the extractive solution under reduced pressure to obtain fermentation product.
Example 3: determination of bacteriostatic Activity
The antibacterial activity determination method adopts a filter paper sheet method and comprises the following specific steps:
(1) Test plant pathogenic bacteria
The multi-drug resistant Botrytis cinerea SG1-3 and SG1-4 are respectively separated from vegetable greenhouses of Shandong longevity lights. Wherein, the strain SG1-3 is a common chemical control bactericide for Botrytis cinerea: boscalid, azoxystrobin and iprodione have drug resistance; the strain SG1-4 has drug resistance to boscalid, azoxystrobin, iprodione and pyrimethanil.
(2) Preparation of sample solutions
The fermentation product of Aspergillus strain S53 was dissolved in methanol to prepare a 200mg/mL solution for use.
(3) Test method
The bacterial cake with the length of about 5mm is picked up at the edge of the bacterial colony of the plant pathogenic bacteria to be tested by a puncher, and the bacterial cake and a 5mm sterile filter paper sheet are respectively placed on the surface of a PDA flat plate with the length of 9 cm. Both are 25mm from the edge of the plate and are on the same straight line. mu.L of the fermentation product solution of Aspergillus strain S53 was pipetted onto a filter paper (loading 1 mg) and an equal volume of methanol was added as control. Culturing at 28deg.C for 5d, and observing whether the fermentation product can inhibit the growth of the tested plant pathogenic bacteria.
The results are shown in FIGS. 2 to 4. It can be seen that the fermentation product of the aspergillus strain S53 is capable of significantly inhibiting the growth of the plant pathogenic bacteria tested. The antibacterial circles of the multi-drug resistant Botrytis cinerea SG1-3, SG1-4 and apple canker are 28mm, 39mm and 38mm respectively. This suggests that aspergillus strain S53 has the potential to develop a biological bactericide for broad-spectrum control of a variety of plant pathogenic bacteria.
While the foregoing is directed to embodiments of the present invention, other and further details of the invention may be embodied and described herein, it will be appreciated that the foregoing description is merely illustrative of the present invention and, accordingly, not limited to the principles of the invention, but rather, all modifications, equivalents, and improvements may be made within the spirit and principles of the invention.
Sequence listing
<110> Shang Ji Biotechnology Co., ltd in Qingdao
<120> A strain of Aspergillus S53 and its use in inhibiting plant pathogenic bacteria
<130> 2010
<140> 1
<141> 2022-01-04
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 562
<212> DNA
<213> Aspergillus S53 (Aspergillus sp.S 53. 5.8S rDNA)
<400> 1
gggttctgag tgaggtcctc ggggcccaac ctcccacccg tgtataccgt accttgttgc 60
ttcggcgggc ccgccgcgca agcggccgcc ggggggggcg tcaaaccccc ctccctaggc 120
gagcgcccgc cggagacacc aacgtgaaca ctgtctgaag ttttgttgtc tgagttcgat 180
tgtatcgcaa tcagttaaaa ctttcaacaa tggatctctt ggttccggca tcgatgaaga 240
acgcagcgaa atgcgataat taatgtgaat tgcagaattc agtgaatcat cgagtctttg 300
aacgcacatt gcaccccctg gtattccggg gggtatgcct gtccgagcgt cattgctgcc 360
ctcaagcacg gcttgtgtgt tgggtcgtcg tccccccggg gacgggcccg aaaggcagcg 420
gcggcaccgc gtccggtcct cgagcgtatg gggctttgtc acccgctctt gtaggcccgg 480
ccggcgctgg ccgacgctga aaagcaacca actatttctc caggttgacc tcggatcagg 540
tagggatacc cgctgaactt aa 562
Claims (4)
1. Aspergillus sp. Strain S53 from Suaeda salsa, deposited with the China center for type culture collection, date of deposit: 2021, 11/11, accession number: cctccc No. m 20211401.
2. The use of aspergillus strain S53 according to claim 1 for the preparation of fermentation products for inhibiting phytopathogens, wherein said phytopathogens are multi-resistant botrytis cinerea and apple rot pathogens.
3. A process for the preparation of a fermentation product of aspergillus strain S53 according to claim 1, characterized in that it comprises the following steps:
1) Inoculating Aspergillus strain S53 on the surface of PDA plate containing 3.5% sea salt, culturing at 28deg.C until colony is spread on the surface of plate;
2) Cutting the activated strain, inoculating to sterilized liquid culture medium, standing at 28deg.C, fermenting for 30d; the liquid culture medium is prepared from 2% of sucrose, 2% of mannitol, 0.5% of peptone, 0.3% of yeast extract, 20% of artificial seawater and potato extract, and the pH value is 7;
3) Extracting the fermentation medium with an organic solvent, and distilling the extracting solution under reduced pressure to obtain a fermentation product; the organic solvent is one or more of dichloromethane, ethyl acetate or n-butanol.
4. The use of the fermentation product of claim 3 for the preparation of a biological bactericide against plant pathogenic bacteria, wherein the plant pathogenic bacteria are multi-resistant botrytis cinerea and apple rot pathogen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210133102.5A CN114350530B (en) | 2022-01-19 | 2022-01-19 | Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210133102.5A CN114350530B (en) | 2022-01-19 | 2022-01-19 | Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114350530A CN114350530A (en) | 2022-04-15 |
| CN114350530B true CN114350530B (en) | 2023-08-22 |
Family
ID=81093596
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210133102.5A Active CN114350530B (en) | 2022-01-19 | 2022-01-19 | Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350530B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116376708B (en) * | 2022-12-05 | 2024-06-07 | 青岛农业大学 | Cladosporium fungus and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055238A (en) * | 2018-08-29 | 2018-12-21 | 青岛农业大学 | One plant of aspergillus flavipes bacteria strain TR32 and its application for having inhibiting effect to phytopathogen |
| CN111943926A (en) * | 2020-08-10 | 2020-11-17 | 中国农业科学院烟草研究所 | Xanthone compound, preparation method thereof and application thereof in agricultural field |
| CN113234600A (en) * | 2021-02-18 | 2021-08-10 | 吉林大学 | Saline-alkali-tolerant anti-pathogenic fungus aspergillus terreus strain SYAT-1 and application thereof |
-
2022
- 2022-01-19 CN CN202210133102.5A patent/CN114350530B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055238A (en) * | 2018-08-29 | 2018-12-21 | 青岛农业大学 | One plant of aspergillus flavipes bacteria strain TR32 and its application for having inhibiting effect to phytopathogen |
| CN111943926A (en) * | 2020-08-10 | 2020-11-17 | 中国农业科学院烟草研究所 | Xanthone compound, preparation method thereof and application thereof in agricultural field |
| CN113234600A (en) * | 2021-02-18 | 2021-08-10 | 吉林大学 | Saline-alkali-tolerant anti-pathogenic fungus aspergillus terreus strain SYAT-1 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 一株烟曲霉抗植物病原菌活性次生代谢产物的研究;孔阳;马养民;王佳运;易军军;王丽红;;东北农业科学(第02期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114350530A (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113151062B (en) | Bacillus belgii LJBV19 and application thereof | |
| CN108148794A (en) | A kind of the bacillus subtilis DYr3.3 and preparation method and application of broad-spectrum antibacterial activity | |
| CN112322560B (en) | Bacillus belgii and application thereof in prevention and control of pear diseases | |
| CN113444651B (en) | Saffron endophytic fungus and application thereof in preventing and treating bulb rot | |
| CN112458011B (en) | Bacillus amyloliquefaciens ZJK1 and application thereof | |
| CN113755389A (en) | Bacillus belgii and application thereof | |
| CN114350530B (en) | Aspergillus S53 and application thereof in inhibiting plant pathogenic bacteria | |
| CN115960777B (en) | Bacillus pseudomycoides and application thereof in prevention and treatment of vegetable epidemic disease | |
| CN115975813B (en) | Isaria javanica strain DMC01 and application thereof in preventing and controlling yellow wild borer | |
| CN113832071B (en) | Brevibacillus halotolerans strain and application thereof in preparation of biocontrol microbial inoculum | |
| CN114467975B (en) | Application of staphylococcus equi in prevention and treatment of fruit and vegetable diseases | |
| CN114196551B (en) | Isaria javanica strain for preventing and controlling citrus pests and application thereof | |
| CN105907663B (en) | Bacillus pumilus and application thereof | |
| CN110964644B (en) | Penicillium and fermentation method and application thereof | |
| KR101953835B1 (en) | Aspergillus terreus isolate enhancing disease resisance and use thereof | |
| CN112195120A (en) | Biocontrol strain G2C3 for preventing and treating powdery mildew of strawberries and application thereof | |
| CN104962497B (en) | The dinitrogen of a kind of canker resistant pathogenic bacteria supports cholerae strain | |
| CN118126888B (en) | Streptomyces globisporus and application thereof | |
| CN116042492B (en) | Bacillus pumilus and application thereof in plant disease control | |
| CN115948248B (en) | Isaria javanica strain DMC01 and application thereof in preventing and controlling Hedyotis aurantiaca | |
| CN114907992B (en) | Strain C11 antagonizing plant pathogenic bacteria and application thereof | |
| CN117327593A (en) | Trichoderma harzianum ZM1 and application thereof | |
| CN117946864A (en) | Trichoderma harzianum ZM1 and application thereof | |
| CN116410889A (en) | Strain T9 and application thereof | |
| CN117305134A (en) | Isaria javanica strain DMC01 and application thereof in preventing and controlling Huang Chijuan wild borer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |