CN114350525B

CN114350525B - Ganoderma lucidum strain SS30 and application thereof

Info

Publication number: CN114350525B
Application number: CN202210030256.1A
Authority: CN
Inventors: 王洪鹏; 王�琦; 赵婷婷; 苏恒; 刘洋; 苏玲
Original assignee: Anhui Sipurui Biotechnology Co ltd
Current assignee: Anhui Sipurui Biotechnology Co ltd
Priority date: 2022-01-12
Filing date: 2022-01-12
Publication date: 2022-09-09
Anticipated expiration: 2042-01-12
Also published as: CN114350525A

Abstract

The invention discloses a ganoderma lucidum strain SS30 and application thereof, belonging to the field of bioengineering.A ganoderma lucidum mutant strain SS30 is preserved in China general microbiological culture collection center (CGMCC) with the address of No. 3 Xilu No. 1 Beijing Kogyo north Chen, the preservation date is 2021 year, 9 month and 30 days, and the preservation number is CGMCC No. 23283. The content of nutrient components of the mutagenized strain mycelium is generally higher than that of the original strain, and the ganoderma lucidum mutagenized strain mycelium water extract has good immunocompetence. The invention provides a new material for the development and utilization of ganoderma lucidum and products thereof, provides a new technical means for the breeding of edible and medicinal fungi, and has important economic value and market value.

Description

Ganoderma lucidum strain SS30 and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to a ganoderma lucidum strain SS30 and application thereof.

Background

Ganoderma (Ganoderma sp.) belonging to Polyporales (Polyporales) family Polyporaceae (Polyporaceae) genus Ganoderma (Ganoderma) belonging to Basidiomycetes (Basidiomycetes) is an important medicinal fungus. Ganoderma lucidum has been used as a traditional medicinal material in China for more than 2000 years, and according to records of Shen nong's herbal classic, Ganoderma lucidum has the effects of strengthening body resistance, consolidating constitution, nourishing, strengthening body constitution, and prolonging life; in Bencao gang mu, ganoderma lucidum is recorded as being able to refresh and prolong life. Modern scientific research shows that the ganoderma lucidum contains various nutritional ingredients such as protein, fat, dietary fiber, amino acid, mineral substances, saccharides and the like required by a human body, and has pharmacological effects of resisting oxidation, resisting tumors, protecting liver, reducing blood sugar, treating neurasthenia and the like. Therefore, the research on the nutritional ingredients and the pharmacological activity of the ganoderma lucidum is increasing day by day.

The ganoderma aqueous extract is rich in ganoderma polysaccharide which is a main immunoregulation substance, so that the immunoregulation function of the ganoderma aqueous extract is one of important standards for evaluating the quality of ganoderma. The variety of the ganoderma lucidum causes the variety of the ganoderma lucidum in China to be uneven.

Disclosure of Invention

The invention aims to provide a ganoderma lucidum strain SS30 and application thereof, aiming at solving the problems in the prior art, the ganoderma lucidum strain SS30 is an aerospace mutagenesis ganoderma lucidum strain, the nutrient content of mycelium is generally higher than that of an original strain, and the aqueous extract of the mycelium of the ganoderma lucidum mutagenesis strain has good immunocompetence; the screening of the strain provides a new material for the subsequent development of lucid ganoderma and lucid ganoderma products, and fills the blank of researching the nutrient components of the mycelium of the space mutation lucid ganoderma strain.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a Ganoderma lucidum mutant strain (Ganoderma lucidum) SS30, which is preserved in China general microbiological culture Collection center (CGMCC) with the address of No. 3 of No. 1 Xilu-Beichen, No. 9-30 days in 2021 year and the preservation number of CGMCC No.23283 in the Korean-yang region in Beijing.

The gene sequence of the ganoderma lucidum mutant strain SS30 is obviously changed from that of the original strain, and the contents of reducing sugar, crude fat and linoleic acid in the mycelium are respectively higher than 15.8%, 50% and 51.04% of the mycelium of the original strain.

The invention also provides application of the ganoderma lucidum mutant strain SS30 in preparation of immunoregulation medicaments or health-care products.

The mycelium water extract of the ganoderma lucidum mutant strain SS30 has good immunoregulation activity. The water extract can remarkably improve thymus index and spleen index of immunosuppressive mice, and can simultaneously improve the expression of cytokines IL-2, IL-6, INF-gamma and TNF-alpha in serum of immunosuppressive mice.

The invention also provides a ganoderma aqueous extract prepared from the ganoderma mutant strain SS 30.

The invention also provides an immunoregulation medicament, which comprises the ganoderma lucidum mutant strain SS30, powder of the ganoderma lucidum mutant strain SS30 and/or an extract of the ganoderma lucidum mutant strain SS30, and pharmaceutically acceptable auxiliary materials.

The invention also provides an immunoregulation health product, which comprises the ganoderma lucidum mutant strain SS30, powder of the ganoderma lucidum mutant strain SS30 and/or an extract thereof, and pharmaceutically acceptable auxiliary materials.

The invention discloses the following technical effects:

the invention provides a ganoderma lucidum mutant strain SS30, wherein the content of nutrient components in mycelium of the mutant strain is generally higher than that of an original strain, and the aqueous extract of the mycelium of the ganoderma lucidum mutant strain has good immunocompetence. The invention provides a new material for the development and utilization of ganoderma lucidum and products thereof, provides a new technical means for the breeding of edible and medicinal fungi, and has important economic value and market value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows the content of mouse serum cytokines in water extract of Ganoderma lucidum mutant strain mycelium; compared with the normal control group, the composition has the advantages that, ^# p < 0.05 is significant, ^## p is less than 0.01, which is extremely remarkable; in comparison to the set of models, ^* p < 0.05 is significant, ^** p < 0.01 is very significant.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1

The preparation method of the mutagenized ganoderma lucidum strain SS30 comprises the following steps:

1) preparing a slant culture medium: 500g of potatoes are cleaned, cut into squares with the size of 2 centimeters, added with a proper amount of water, boiled and filtered with 1000 milliliters of water, and then added with 30g/L of glucose, 2g/L of peptone, 3g/L of monopotassium phosphate, 1.5g/L of magnesium sulfate and 20g/L of agar.

2) Inoculation: subpackaging the prepared culture medium liquid into test tubes when the culture medium liquid is hot, wherein the content is one fifth of the test tube, tightly plugging a cotton plug, sterilizing for 40min at 121 ℃ in an autoclave, opening a cover, taking out the test tubes when the test tubes are hot, placing the test tubes on an inclined plane, operating in a sterile operating platform after 10h, inoculating the mother seed blocks with the size of 3 mm into a strain tube, and placing the strain tube into an incubator to culture for 15 days at the temperature of 25 ℃.

3) Strain mutagenesis: original strains with good growth state are cultured and stored in a storage tube, a Shenzhou No. eleven ship is carried on the air at 17 th month 10 th year 2016, the original strains are returned to the ground at 18 th month 11 th year 2016, and the mutant ganoderma lucidum strain SS30 is obtained through strain screening.

The mutant strain is preserved in China general microbiological culture Collection center (CGMCC) at 9 months and 30 days in 2021, the address is No. 3 of Navy No. 1 Hospital, Beijing, the south China, and the classification is named as lucid Ganoderma (Ganoderma lucidum), and the preservation number is CGMCC No. 23283.

Example 2

After the original strain and the mutant strain SS30 are cultured, a certain amount of mycelium is taken and ground into powder by liquid nitrogen, and the total DNA of the two strains is extracted according to the kit instructions. Subsequently, 35 cycles of pre-denaturation at 94 ℃ for 4min, annealing at 55.5 ℃ for 1min, and extension at 72 ℃ for 4min were performed; extension was performed at 72 ℃ for 5min, and PCR amplification was performed. And finally, analyzing the ITS sequence obtained by sequencing through online BLAST analysis in an NCBI database and DNA star software. The obtained original strain and the mutant strain have obviously different genome sequences, and the mutant strain is a new strain.

The gene sequence of the original strain is as follows:

CCTTAAGGGACGGGAAATCTACCTGAATTTGAGGTCAGAGGTCATAAAGCTGTCTCACAAACGAGACGGTTAGAAGCTCGCCAAAACGCTTCACGGTCACGGCGTAGACATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATACATTTAAGAGGAGCCGACCGAAACACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCCGCAAAGGTTTGTAAGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTACATAGATGCGTTACATCGCAATACACATTCTAATACTTTATAGAGTTTGTGGTAAACGCAGGCACAGACACGCTCTACAAGCTCCGTAAAGAGCCCGCTTCACGACGTCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGGAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTTCCCCCTACGGAAG

the gene sequence of the mutant strain is as follows:

CGTGAACGGCTGTCTACTGATTTGAGGTCAGAGGTCATAAAGCTGTCTCACAAACGAGACGGTTAGAAGCTCGCCAAAACGCTTCACGGTCACGGCGTAGACATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATACATTTAAGAGGAGCCGACCGAAACACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCCGCAAAGGTTTGTAAGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTACATAGATGCGTTACATCGCAATACACATTCTAATACTTTATAGAGTTTGTGGTAAACGCAGGCACAGACACGCTCTACAAGCTCCGTAAAGAGCCCGCTTCACGACGTCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGGAGGCCAGCTACAACCCAGTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAG

example 3

The nutrient components of the invention are detected by the following method:

1) the specific method for detecting the content of reducing sugar comprises the following steps: respectively taking 0, 0.2, 0.4, 0.6, 0.8 and 1.0ml of glucose standard solution (1mg/ml), supplementing to 1.0ml with distilled water, respectively and accurately adding 1ml of DNS reagent, heating in a boiling water bath for 5min, cooling with running water, respectively adding 8ml of distilled water into each tube, mixing uniformly, and measuring the absorbance value at the wavelength of 540 nm. And drawing a standard curve by taking the mass concentration of the glucose as an abscissa and the absorbance value as an ordinate. The original strain and the solution of the mycelium of the mutagenized strain were tested in the same manner and were introduced into the standard culture.

2) The specific method for detecting the content of the crude fat comprises the following steps: weighing about 2g of sample by using a weighing vessel dried to constant weight, adding a proper amount of sea sand, placing on a water bath to evaporate water, continuously stirring by using a glass rod in the process to form a loose state, transferring the sample into a filter paper cylinder, wiping the weighing vessel and the glass rod by absorbent cotton stained with petroleum ether, placing the filter paper cylinder and the absorbent cotton on the filter paper cylinder together, placing a small amount of absorbent cotton on the filter paper cylinder, placing the filter paper cylinder in an electric heating blowing drying box for drying, and drying for 2 hours at 103 ℃. Placing the dried filter paper cylinder in a Soxhlet extractor, connecting a bottom bottle, adding petroleum ether to a height above a siphon pipe, adding the petroleum ether with the height of 1/3 of the siphon pipe after the extraction liquid is completely extracted, and connecting a condensing pipe for refluxing for about 12 hours. In the process, a small amount of absorbent cotton is inserted into the opening of the condenser pipe. Recovering the extractive solution, evaporating petroleum ether in water bath, drying in electrothermal blowing dry box to constant weight, cooling in drier, and weighing.

3) The content detection method of linoleic acid comprises the following steps: 0.2g of a homogeneous sample was weighed, transferred to a 250mL flat-bottomed flask, added with about 100mg of pyrogallic acid, added with several grains of zeolite, added with 2mL of 95% ethanol, and mixed well. 8ml of 2% sodium hydroxide solution in methanol was added and refluxed in a 80 ℃ water bath until the oil droplets disappeared. 7ml of a 14% solution of boron trifluoride in methanol are added, boiling is continued for 10min, the heating is stopped, the flask is taken off from the water bath and rapidly cooled to room temperature. Accurately adding 10mL of n-heptane, shaking for 2min, adding saturated sodium chloride aqueous solution, and standing for layering. Sucking the upper layer of n-heptane extractive solution about 5mL, adding into 25mL test tube, adding anhydrous sodium sulfate about 3g, shaking for 1min, standing for 5min, sucking the upper layer of solution, passing through membrane, and loading on machine.

Chromatographic conditions

A chromatographic column: CNW CD-2560100 mm × 0.25mm × 0.20 μm;

sample inlet temperature: 250 ℃; detector type: FID; detector temperature: 260 ℃;

sample injection amount: 1 mu L of the solution; the split ratio is as follows: 10: 1; carrier gas flow rate: 0.5 mL/min.

Gradient condition

The nutrient content of the mycelium of the mutagenized strain of ganoderma lucidum of the invention was analyzed in comparison with the original strain as shown in table 1, and the contents of reducing sugar, crude fat and linoleic acid in the mycelium of the mutagenized strain were higher than those of the mycelium of the original strain by 15.80%, 50.00% and 51.04%.

TABLE 1 analysis of the nutrient content of the mycelia of the mutant strain and the original strain

Example 4

After the ganoderma lucidum mutant strain mycelium is dried, hot water extraction is carried out for 3 hours under the conditions that the temperature is 90 ℃ and the liquid-material ratio is 85:1, so as to obtain an extracting solution. Repeating the above steps for leaching again, mixing the two extracting solutions, concentrating and drying the leaching solution at 60-70 ℃, and grinding into powder to obtain the ganoderma lucidum mutagenic strain mycelium water extract. The immune activity of the ganoderma lucidum mutant strain mycelium aqueous extract is inspected by establishing a mouse in vivo model.

60 Kunming mice, 10 mice were taken as normal control group, the remaining 50 mice were used to establish immunosuppressive model, and cyclophosphamide was continuously intraperitoneally injected at a dose of 80mg/kg for 5d, administered 1 time per day. After the model building is successful, the 50 mice are randomly divided into a model group, a positive group (50mg/kg astragalus polysaccharide), a ganoderma lucidum mutant strain mycelium water extract high-dose group (500mg/kg), a medium-dose group (250mg/kg) and a low-dose group (125mg/kg), the normal control group is given with physiological saline with the same volume in the whole process, the model group is injected with physiological saline with the same volume in the abdominal cavity, the administration is carried out for 1 time every day, and the administration is carried out for 20 days continuously. After the last administration, water is not interrupted, the eyeball is anaesthetized and blood is taken after 12h, the thymus and spleen are immediately separated and weighed. Serum was isolated and serum TNF- α, INF- γ, IL-6 and IL-2 levels were determined by ELISA. The results are shown in Table 2.

TABLE 2 Effect of aqueous extracts of mycelium from mutagenized strains of Ganoderma lucidum on the organ index of immunosuppressed mice

Note: compared with the normal control group, the compound preparation, ^# p < 0.05 is significant, ^## p is less than 0.01, is extremely remarkable; in comparison to the set of models, ^* p < 0.05 is significant, ^** p < 0.01 is very significant.

Then, the serum cytokine content of each group of mice is respectively detected, and the experimental result is shown in figure 1. From the experimental results, the serum cytokines IL-2, IL-6, IFN-gamma and TNF-alpha content of the model group is obviously reduced compared with that of the control group. Compared with a model group, the aqueous extract of the ganoderma lucidum mutant strain mycelium can obviously improve the content of the cell factor in the serum of a mouse, and further shows that the aqueous extract of the ganoderma lucidum mutant strain mycelium has the immunoregulation effect and has good protection effect on immune-damaged mice.

As can be seen from the experimental results in Table 2, compared with the control group, the thymus index and the spleen index of the model group are significantly reduced, which indicates that the immune organs of the mice are damaged and the experimental modeling is successful. Compared with a model group, the ganoderma lucidum mutant strain mycelium aqueous extract can obviously improve thymus index and spleen index of mice, which indicates that the ganoderma lucidum mutant strain mycelium aqueous extract has a protective effect on organs of immune-injured mice.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Claims

1. A Ganoderma lucidum mutant strain (Ganoderma lucidum) SS30 is characterized in that the strain is preserved in China general microbiological culture Collection center (CGMCC), the address is No. 3 of No. 1 Xilu-Beichen, the Korean district, Beijing, the preservation date is 2021 year, 9 month and 30 day, and the preservation number is CGMCC No. 23283.

2. Use of the ganoderma lucidum mutant strain SS30 as claimed in claim 1 in the preparation of immunomodulatory drugs or health products.

3. An aqueous extract of Ganoderma lucidum prepared from the mutagenized strain of Ganoderma lucidum SS30 of claim 1.

4. An immunomodulatory drug, comprising Ganoderma lucidum mutant strain SS30 of claim 1, powder of said Ganoderma lucidum mutant strain SS30 and/or aqueous extract thereof, and pharmaceutically acceptable excipients.

5. An immunoregulatory health product, which comprises the ganoderma lucidum mutant strain SS30 of claim 1, powder of the ganoderma lucidum mutant strain SS30 and/or an aqueous extract thereof, and a pharmaceutically acceptable auxiliary material.