CN114349847A

CN114349847A - Specific TCRs targeting novel coronavirus RNA-dependent RNA polymerase

Info

Publication number: CN114349847A
Application number: CN202210118369.7A
Authority: CN
Inventors: 马意朋; 王明军; 刘凤兰; 李彬
Original assignee: Shenzhen Innovation Immunotechnology Co ltd; Shenzhen Innovation Conversion Medical Science Research Institute
Current assignee: Shenzhen Innovation Immunotechnology Co ltd; Shenzhen Innovation Conversion Medical Science Research Institute
Priority date: 2022-02-08
Filing date: 2022-02-08
Publication date: 2022-04-15
Anticipated expiration: 2042-02-08
Also published as: CN114349847B

Abstract

The invention discloses a specific TCR of a targeted novel coronavirus RNA-dependent RNA polymerase, and relates to the technical field of cellular immunotherapy. The TCR can specifically recognize epitope polypeptide (RdRp) derived from novel coronavirus RNA-dependent RNA polymerase_829‑837LPYPDPSRI), in particular, the TCR having the ability to recognise HLA-B51: 01-RdRp_829‑837A property of the antigen complex, the TCR comprising a TCR α chain variable region and a TCR β chain variable region. The invention also provides a nucleic acid molecule comprising a nucleotide sequence encoding the TCR, or a complement thereof, and a vector comprising the nucleic acid molecule, and a cell transducing the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and uses of the TCR, nucleic acid molecule, vector, cell, pharmaceutical composition. The invention provides a method for identifying human novel coronavirus HLA-B51:01 restriction RdRp_829‑837The TCR of the epitope polypeptide has good specificity and affinity.

Description

Specific TCRs targeting novel coronavirus RNA-dependent RNA polymerase

Technical Field

The invention relates to the technical field of cellular immunotherapy, in particular to a TCR capable of specifically recognizing a novel coronavirus RNA-dependent RNA polymerase (RNA-dependent RNAPLyhydrase, RdRp) epitope, a nucleic acid molecule comprising a nucleotide sequence coding for the TCR or a complementary sequence thereof, a vector containing the nucleic acid molecule, a cell for transducing the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector or the cell as an active ingredient, and a use of the TCR, the nucleic acid molecule, the vector, the cell and the pharmaceutical composition.

Background

The new type of coronavirus pneumonia (COVID-19) caused by the new type of coronavirus (SARS-CoV-2) is currently the most urgent public health problem to be solved worldwide. COVID-19 has a great influence on the economic development of China and the world.

Several recent studies have demonstrated that virus-specific T cells can provide protection against SARS-CoV-2 infection and play an important role in the clearance of the virus. Meanwhile, clinical studies on patients with COVID-19 demonstrated that some patients were able to clear viral infections with persistent negative neutralizing antibodies targeting structural proteins in vivo. At the same time, several studies demonstrated that T lymphocyte numbers in patients with severe COVID-19 disease were significantly less in milder patients, suggesting that reinfusion of SARS-CoV-2 specific T cells may contribute to patient recovery. SARS-CoV-2, upon infection of human cells, expresses a virus-derived protein such as RdRp (RNA-dependent RNA polymerase, RNA-dependent RNADelyme) intracellularly. Thus, T lymphocytes, which recognize epitopes derived from viral proteins, can recognize and kill infected cells. T Cell antigen Receptor (TCR) which can specifically recognize SARS-CoV-2 protein source epitope is obtained by separation and identification, then TCR gene is integrated into T Cell, so that T Cell which does not have antigen specificity recognition capability can recognize and kill target Cell expressing corresponding antigen, and the T Cell can be used for treating and preventing SARS-CoV-2 infection.

Disclosure of Invention

The study found that HLA-B51:01 and RdRp presented_829-837(LPYPDPSRI) the antigen short peptide forms "HLA-short peptide" complexes expressed on the surface of virus-infected cells or antigen-presenting cells and macrophage cells that have phagocytosed viral antigens.

The technical problem to be solved by the invention is to provide the RdRp capable of identifying the presentation of human leukocyte antigen HLA-B51:01_829-837(LPYPDPSRI) a TCR of an epitope and a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or a sequence complementary thereto and a vector comprising the nucleic acid molecule and a cell transducing the nucleic acid molecule or the vector and a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector or the cell as an active ingredient and the use of the TCR, the nucleic acid molecule, the vector, the cell, the pharmaceutical composition.

In order to solve the above problems, the present invention proposes the following technical solutions:

in one aspect, the invention provides a method for identifying SARS-CoV-2 HLA-B51:01 restricted RdRp_829-837A TCR specific for an epitope, the TCR having an RdRp which recognises presentation of HLA-B51:01_829-837A property of an epitope, said TCR comprising a TCR α chain variable region and a TCR β chain variable region;

the amino acid sequence of CDR3 of the TCR alpha chain variable region is CAYRSRVSDSGAGSYQLTF;

the amino acid sequence of CDR3 of the TCR beta variable region is CASSLESGSHYEQYF.

Alternatively, the first and second electrodes may be,

the amino acid sequence of CDR3 of the TCR alpha chain variable region is CAFTRGADGLTF;

the amino acid sequence of CDR3 of the TCR beta variable region is CASTSEKGGYTF.

Preferably, the amino acid sequences of the 3 complementarity determining regions of the TCR α chain and β chain variable regions are:

αCDR1：TSESDYY；SEQ ID NO：1；

αCDR2：QEAYKQQN；SEQ ID NO：3；

αCDR3：CAYRSRVSDSGAGSYQLTF；SEQ ID NO：5；

βCDR1：SGHVS；SEQ ID NO：7；

βCDR2：FNYEAQ；SEQ ID NO：9；

βCDR3：CASSLESGSHYEQYF；SEQ ID NO：11；

alternatively, the first and second electrodes may be,

αCDR1：SSNFYA；SEQ ID NO：13；

αCDR2：MTLNGDE；SEQ ID NO：15；

αCDR3：CAFTRGADGLTF；SEQ ID NO：17；

βCDR1：SEHNR；SEQ ID NO：19；

βCDR2：FQNEAQ；SEQ ID NO：21；

βCDR3：CASTSEKGGYTF；SEQ ID NO：23。

more preferably, the nucleotide sequences of the 3 complementarity determining regions of the α chain and β chain variable regions of the TCR are:

αCDR1：accagtgagagtgattattat；SEQ ID NO：2，

αCDR2：caagaagcttataagcaacagaat；SEQ ID NO：4，

αCDR3：tgtgcttataggagccgggtttccgactctggggctgggagttaccaactcactttc；SEQ ID NO：6。

βCDR1：tcgggtcatgtatcc；SEQ ID NO：8，

βCDR2：ttcaattatgaagcccaa；SEQ ID NO：10，

βCDR3：tgtgccagcagcttagagagcgggagtcactacgagcagtacttc；SEQ ID NO：12。

alternatively, the first and second electrodes may be,

αCDR1：tccagcaatttttatgcc；SEQ ID NO：14，

αCDR2：atgactttaaatggggatgaa；SEQ ID NO：16，

αCDR3：tgtgcctttacgagaggtgctgacggactcaccttt；SEQ ID NO：18。

βCDR1：tctgaacacaaccgc；SEQ ID NO：20，

βCDR2：ttccagaatgaagctcaa；SEQ ID NO：22，

βCDR3：tgtgccagcacctcggagaagggcggctacaccttc；SEQ ID NO：24。

preferably, the amino acid sequences of the TCR α chain variable region and the TCR β chain variable region are SEQ ID NOs: 25 and SEQ ID NO: 26, or the amino acid sequences of the TCR α chain variable region and the TCR β chain variable region are SEQ ID NOs: 27 and SEQ ID NO: 28.

in a second aspect, the present invention provides a nucleic acid molecule comprising a nucleic acid encoding a SARS-CoV-2RdRp recognition molecule according to the first aspect_829-837A nucleotide sequence of a TCR or TCR chain specific for the epitope or a complementary sequence thereof.

Preferably, the nucleic acid molecule comprises nucleotide sequences encoding a TCR α chain variable region and a TCR β chain variable region, respectively, of SEQ ID NOs: 29 and SEQ ID NO: 30 or the nucleic acid molecule comprises the nucleotide sequences encoding the TCR α chain variable region and the TCR β chain variable region of SEQ ID NOs: 31 and SEQ ID NO: 32.

in a third aspect, the present invention provides a vector comprising a nucleic acid molecule according to the second aspect.

Preferably, the vector is a viral vector.

More preferably, the vector is a retroviral vector or a lentiviral vector.

In a fourth aspect, the invention provides a cell which transduces a nucleic acid molecule according to the second aspect or a vector according to the third aspect, which cell specifically recognizes RdRp presented by HLA-B51:01_829-837TCR of an antigenic epitope.

Preferably, the cell is a T cell or a stem cell.

In a fifth aspect, the present invention provides a pharmaceutical composition comprising any one of the aboveIdentification of SARS-CoV-2RdRp_829-837A TCR specific for an epitope, a nucleic acid molecule as defined above, a vector as defined above or a cell as defined above as active ingredient.

The present invention also provides the use of any of the above for identifying RdRp_829-837The TCR of the antigen, the nucleic acid molecule of any of the above, the vector of any of the above, the cell of any of the above, the pharmaceutical composition of any of the above, for use in the preparation of a medicament for treating or preventing a viral infection.

Preferably, any of the above-described methods for recognizing SARS-CoV-2RdRp_829-837The specific TCR of the epitope, any nucleic acid molecule, any vector, any cell and any pharmaceutical composition are respectively used for preparing medicines for treating or preventing various diseases caused by virus infection; further, the compound is used for preparing medicaments for treating or preventing coronavirus infection.

Compared with the prior art, the invention can achieve the following technical effects:

the invention provides RdRp capable of specifically recognizing HLA-B51:01 presentation_829-837A TCR of an epitope, as well as a nucleic acid molecule comprising a nucleotide sequence encoding said TCR or a sequence complementary thereto, and a vector comprising said nucleic acid molecule, and a cell transducing said nucleic acid molecule or said vector, and a pharmaceutical composition comprising said TCR, nucleic acid molecule, vector or cell as an active ingredient, and the use of said TCR, nucleic acid molecule, vector, cell, pharmaceutical composition, respectively, for the manufacture of a medicament for the treatment of a viral infection.

The invention provides a method for identifying SARS-CoV-2RdRp_829-837The TCR of the epitope has specificity and good affinity, so that the T cell which does not have antigen specificity recognition capability originally can effectively recognize SARS-CoV-2RdRp antigen and kill target cells expressing the corresponding antigen, thereby achieving the purpose of treating virus infection.

Drawings

FIG. 1 is a schematic diagram of the assembly of a TCR sequence device.

FIG. 2 shows the results of positive rate of TCR detection by flow assay.

FIG. 3 is a graph of the ability of an enzyme-linked immunosorbent assay (ELISA) to detect the release of the cytokine IFN-. gamma.from TCR-T cells co-cultured with target cells.

Detailed Description

The technical solutions in the embodiments will be described clearly and completely with reference to the accompanying drawings in the embodiments of the present invention, wherein like reference numerals represent like elements in the drawings. It is apparent that the embodiments to be described below are only a part of the embodiments of the present invention, and not all of them. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: HLA-B51: 01-RdRp_829-837Cloning and sequencing of specific T cells

Peripheral Blood Mononuclear Cells (PBMC) from HLA-B51:01 genotype were stimulated in vitro with chemically synthesized short peptide LPYPDPSRI (Biotechnology engineering, Shanghai, Inc.). After 2 rounds of polypeptide stimulation, polyclonal T cells were co-cultured overnight at 37 ℃ using LPYPDPSRI short peptide stimulations, and target T cells positive for the T cell activation marker were sorted by flow cytometry.

Sorted T cells (1X 10)⁶) The supernatant was removed by centrifugation and resuspended in 1mL Trizol (RNeasy Plus universal Mini Kit, QIAGEN), frozen in liquid nitrogen and sequenced (immunohistochemical library sequencing, Kinzhi Biotech, Suzhou). Based on the sequencing results, the TCR α chain and the TCR β chain were paired, PCR constructed to include the full-length TCR of the constant region (the schematic diagram of the elements of the TCR sequence is shown in fig. 1) and inserted into a retroviral vector.

Wherein the amino acid sequences of the TCR alpha chain variable region and the TCR beta chain variable region are respectively SEQ ID NO: 25 and SEQ ID NO: 26, or the amino acid sequences of the TCR α chain variable region and the TCR β chain variable region are SEQ ID NOs: 27 and SEQ ID NO: 28.

accordingly, the nucleotide sequences of the TCR α chain variable region and the TCR β chain variable region are SEQ ID NOs: 29 and SEQ ID NO: 30, or the nucleotide sequences of the TCR α chain variable region and the TCR β chain variable region are SEQ ID NOs: 31 and SEQ ID NO: 32.

example 2: preparation of HLA-B51: 01-RdRp_829-837Specific TCR-T cells

Cloning of the target TCR into the retroviral vector pMSGV1 (addge) A pMSGV1-TCR vector was constructed. The viral packaging cell line 293GP cells pMSGV1-TCR and pVSV-G plasmid were transfected, retroviruses were prepared and the viral supernatants were used to transduce T cells.

The transfection procedure was as follows: day 0 293GP cells were seeded into 6 well plates (6X 10)⁵Hole/bore); on day 1, 293GP cells (2. mu.g pMSGV1-TCR and 1.4. mu.g pVSV-G/well) were transfected with pMSGV1-TCR and pVSV-G plasmid, on the same day PBMC of healthy humans were activated with anti-human CD3 antibody (OKT 3); on day 3, the culture medium containing the virus supernatant was collected and fresh culture medium (DMEM containing 10% fetal bovine serum) was added to 293GP cells; centrifugally transfecting the activated T cells with the collected viral supernatant; second transfection of activated T cells on day 4 using the same method; transfected T cells were collected on day 5 into a T25 flask and cultured (X-VIVO (Lonza)) in a medium containing 10% fetal bovine serum and 300IU/mL IL 2. The expression level of the target TCR was subjected to flow assay on day 10, and as shown in fig. 2, the positive rates of TCR detection by antibody detection of the expression rate of mouse TCR β chain constant region (mTRBC) were 35.3% and 29.7%, respectively.

Example 3: HLA-B51: 01-RdRp_829-837In vitro functional validation of specific TCR-T cells

ELISA detection, the RdRp is loaded respectively_829-837Polypeptides (LPYPDPSRI) and non-related polypeptides (N)_67-75FPRGQGVPI) and TCR-T cells were co-cultured at 37 ℃ for 16 hours, and then ELISA was performed to detect the release of cytokine IFN-. gamma.after T cells specifically recognized the corresponding epitope, as shown in FIG. 3, the TCR-T cells of the present invention specifically recognized RdRp_829-837Polypeptide (LPYPDPSRI) and release cytokines, and does not recognize HLA-B51:01 restriction epitope from SARS-CoV-2 nucleocapsid protein (nucleocapsid) (FPRGQGVPI). Also, the TCR-T cell pairs of the invention are RdRp_829-837Recognition of the polypeptide can be blocked by an anti-HLA-B/C antibody (clone No. B1.23.2), thereby further illustrating HLA-TCR interaction-mediated specific recognition.

In conclusion, the SARS-CoV-2RdRp recognition method provided by the invention_829-837The TCR of the epitope has good specificity and affinity, so that the T cell which does not have antigen specificity recognition capability can effectively recognize SARS-CoV-2RdRp antigen and kill target cells expressing corresponding antigens, thereby achieving the purpose of treating virus infection.

In the above embodiments, the descriptions of the respective embodiments have respective emphasis, and for parts that are not described in detail in a certain embodiment, reference may be made to related descriptions of other embodiments.

While the invention has been described with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Sequence listing

<110> Shenzhen Shennuo transform medical institute; shenzhen jinuo immune Co Ltd

Ma, Yi Peng

King, Ming Jun

Liu, Feng lan

Li, Bin

<120> specific TCR targeting novel coronavirus RNA-dependent RNA polymerase

<141> 2022-02-08

<160> 32

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7

<212> PRT

<213> Homo sapiens

<400> 1

Thr Ser Glu Ser Asp Tyr Tyr

1 5

<210> 2

<211> 21

<212> DNA

<213> Homo sapiens

<400> 2

accagtgaga gtgattatta t 21

<210> 3

<211> 8

<212> PRT

<213> Homo sapiens

<400> 3

Gln Glu Ala Tyr Lys Gln Gln Asn

1 5

<210> 4

<211> 24

<212> DNA

<213> Homo sapiens

<400> 4

caagaagctt ataagcaaca gaat 24

<210> 5

<211> 19

<212> PRT

<213> Homo sapiens

<400> 5

Cys Ala Tyr Arg Ser Arg Val Ser Asp Ser Gly Ala Gly Ser Tyr Gln

1 5 10 15

Leu Thr Phe

<210> 6

<211> 57

<212> DNA

<213> Homo sapiens

<400> 6

tgtgcttata ggagccgggt ttccgactct ggggctggga gttaccaact cactttc 57

<210> 7

<211> 5

<212> PRT

<213> Homo sapiens

<400> 7

Ser Gly His Val Ser

1 5

<210> 8

<211> 15

<212> DNA

<213> Homo sapiens

<400> 8

tcgggtcatg tatcc 15

<210> 9

<211> 6

<212> PRT

<213> Homo sapiens

<400> 9

Phe Asn Tyr Glu Ala Gln

1 5

<210> 10

<211> 18

<212> DNA

<213> Homo sapiens

<400> 10

ttcaattatg aagcccaa 18

<210> 11

<211> 15

<212> PRT

<213> Homo sapiens

<400> 11

Cys Ala Ser Ser Leu Glu Ser Gly Ser His Tyr Glu Gln Tyr Phe

1 5 10 15

<210> 12

<211> 45

<212> DNA

<213> Homo sapiens

<400> 12

tgtgccagca gcttagagag cgggagtcac tacgagcagt acttc 45

<210> 13

<211> 6

<212> PRT

<213> Homo sapiens

<400> 13

Ser Ser Asn Phe Tyr Ala

1 5

<210> 14

<211> 18

<212> DNA

<213> Homo sapiens

<400> 14

tccagcaatt tttatgcc 18

<210> 15

<211> 7

<212> PRT

<213> Homo sapiens

<400> 15

Met Thr Leu Asn Gly Asp Glu

1 5

<210> 16

<211> 21

<212> DNA

<213> Homo sapiens

<400> 16

atgactttaa atggggatga a 21

<210> 17

<211> 12

<212> PRT

<213> Homo sapiens

<400> 17

Cys Ala Phe Thr Arg Gly Ala Asp Gly Leu Thr Phe

1 5 10

<210> 18

<211> 36

<212> DNA

<213> Homo sapiens

<400> 18

tgtgccttta cgagaggtgc tgacggactc accttt 36

<210> 19

<211> 5

<212> PRT

<213> Homo sapiens

<400> 19

Ser Glu His Asn Arg

1 5

<210> 20

<211> 15

<212> DNA

<213> Homo sapiens

<400> 20

tctgaacaca accgc 15

<210> 21

<211> 6

<212> PRT

<213> Homo sapiens

<400> 21

Phe Gln Asn Glu Ala Gln

1 5

<210> 22

<211> 18

<212> DNA

<213> Homo sapiens

<400> 22

ttccagaatg aagctcaa 18

<210> 23

<211> 12

<212> PRT

<213> Homo sapiens

<400> 23

Cys Ala Ser Thr Ser Glu Lys Gly Gly Tyr Thr Phe

1 5 10

<210> 24

<211> 36

<212> DNA

<213> Homo sapiens

<400> 24

tgtgccagca cctcggagaa gggcggctac accttc 36

<210> 25

<211> 141

<212> PRT

<213> Homo sapiens

<400> 25

Met Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu

1 5 10 15

Glu Phe Ser Met Ala Gln Thr Val Thr Gln Ser Gln Pro Glu Met Ser

20 25 30

Val Gln Glu Ala Glu Thr Val Thr Leu Ser Cys Thr Tyr Asp Thr Ser

35 40 45

Glu Ser Asp Tyr Tyr Leu Phe Trp Tyr Lys Gln Pro Pro Ser Arg Gln

50 55 60

Met Ile Leu Val Ile Arg Gln Glu Ala Tyr Lys Gln Gln Asn Ala Thr

65 70 75 80

Glu Asn Arg Phe Ser Val Asn Phe Gln Lys Ala Ala Lys Ser Phe Ser

85 90 95

Leu Lys Ile Ser Asp Ser Gln Leu Gly Asp Ala Ala Met Tyr Phe Cys

100 105 110

Ala Tyr Arg Ser Arg Val Ser Asp Ser Gly Ala Gly Ser Tyr Gln Leu

115 120 125

Thr Phe Gly Lys Gly Thr Lys Leu Ser Val Ile Pro His

130 135 140

<210> 26

<211> 134

<212> PRT

<213> Homo sapiens

<400> 26

Met Gly Thr Ser Leu Leu Cys Trp Val Val Leu Gly Phe Leu Gly Thr

1 5 10 15

Asp His Thr Gly Ala Gly Val Ser Gln Ser Pro Arg Tyr Lys Val Thr

20 25 30

Lys Arg Gly Gln Asp Val Ala Leu Arg Cys Asp Pro Ile Ser Gly His

35 40 45

Val Ser Leu Tyr Trp Tyr Arg Gln Ala Leu Gly Gln Gly Pro Glu Phe

50 55 60

Leu Thr Tyr Phe Asn Tyr Glu Ala Gln Gln Asp Lys Ser Gly Leu Pro

65 70 75 80

Asn Asp Arg Phe Ser Ala Glu Arg Pro Glu Gly Ser Ile Ser Thr Leu

85 90 95

Thr Ile Gln Arg Thr Glu Gln Arg Asp Ser Ala Met Tyr Arg Cys Ala

100 105 110

Ser Ser Leu Glu Ser Gly Ser His Tyr Glu Gln Tyr Phe Gly Pro Gly

115 120 125

Thr Arg Leu Thr Val Thr

130

<210> 27

<211> 133

<212> PRT

<213> Homo sapiens

<400> 27

Met Glu Lys Asn Pro Leu Ala Ala Pro Leu Leu Ile Leu Trp Phe His

1 5 10 15

Leu Asp Cys Val Ser Ile Leu Asn Val Glu Gln Ser Pro Gln Ser Leu

20 25 30

His Val Gln Glu Gly Asp Ser Thr Asn Phe Thr Cys Ser Phe Pro Ser

35 40 45

Ser Asn Phe Tyr Ala Leu His Trp Tyr Arg Trp Glu Thr Ala Lys Ser

50 55 60

Pro Glu Ala Leu Phe Val Met Thr Leu Asn Gly Asp Glu Lys Lys Lys

65 70 75 80

Gly Arg Ile Ser Ala Thr Leu Asn Thr Lys Glu Gly Tyr Ser Tyr Leu

85 90 95

Tyr Ile Lys Gly Ser Gln Pro Glu Asp Ser Ala Thr Tyr Leu Cys Ala

100 105 110

Phe Thr Arg Gly Ala Asp Gly Leu Thr Phe Gly Lys Gly Thr His Leu

115 120 125

Ile Ile Gln Pro Tyr

130

<210> 28

<211> 131

<212> PRT

<213> Homo sapiens

<400> 28

Met Gly Thr Ser Ile Met Cys Trp Met Ala Leu Cys Leu Leu Gly Ala

1 5 10 15

Asp His Ala Asp Thr Gly Val Ser Gln Asn Pro Arg His Lys Ile Thr

20 25 30

Lys Arg Gly Gln Asn Val Thr Phe Arg Cys Asp Pro Ile Ser Glu His

35 40 45

Asn Arg Leu Tyr Trp Tyr Arg Gln Thr Leu Gly Gln Gly Pro Glu Phe

50 55 60

Leu Thr Tyr Phe Gln Asn Glu Ala Gln Leu Glu Lys Ser Arg Leu Leu

65 70 75 80

Ser Asp Arg Phe Ser Ala Glu Arg Pro Lys Gly Ser Phe Ser Thr Leu

85 90 95

Glu Ile Gln Arg Thr Glu Gln Gly Asp Ser Ala Met Tyr Leu Cys Ala

100 105 110

Ser Thr Ser Glu Lys Gly Gly Tyr Thr Phe Gly Ser Gly Thr Arg Leu

115 120 125

Thr Val Val

130

<210> 29

<211> 423

<212> DNA

<213> Homo sapiens

<400> 29

atggcatgcc ctggcttcct gtgggcactt gtgatctcca cctgtcttga atttagcatg 60

gctcagacag tcactcagtc tcaaccagag atgtctgtgc aggaggcaga gaccgtgacc 120

ctgagctgca catatgacac cagtgagagt gattattatt tattctggta caagcagcct 180

cccagcaggc agatgattct cgttattcgc caagaagctt ataagcaaca gaatgcaaca 240

gagaatcgtt tctctgtgaa cttccagaaa gcagccaaat ccttcagtct caagatctca 300

gactcacagc tgggggatgc cgcgatgtat ttctgtgctt ataggagccg ggtttccgac 360

tctggggctg ggagttacca actcactttc gggaagggga ccaaactctc ggtcatacca 420

cat 423

<210> 30

<211> 402

<212> DNA

<213> Homo sapiens

<400> 30

atgggcacca gtctcctatg ctgggtggtc ctgggtttcc tagggacaga tcacacaggt 60

gctggagtct cccagtctcc caggtacaaa gtcacaaaga ggggacagga tgtagctctc 120

aggtgtgatc caatttcggg tcatgtatcc ctttattggt accgacaggc cctggggcag 180

ggcccagagt ttctgactta cttcaattat gaagcccaac aagacaaatc agggctgccc 240

aatgatcggt tctctgcaga gaggcctgag ggatccatct ccactctgac gatccagcgc 300

acagagcagc gggactcggc catgtatcgc tgtgccagca gcttagagag cgggagtcac 360

tacgagcagt acttcgggcc gggcaccagg ctcacggtca ca 402

<210> 31

<211> 399

<212> DNA

<213> Homo sapiens

<400> 31

atggagaaga atcctttggc agccccatta ctaatcctct ggtttcatct tgactgcgtg 60

agcatactga acgtggaaca aagtcctcag tcactgcatg ttcaggaggg agacagcacc 120

aatttcacct gcagcttccc ttccagcaat ttttatgcct tacactggta cagatgggaa 180

actgcaaaaa gccccgaggc cttgtttgta atgactttaa atggggatga aaagaagaaa 240

ggacgaataa gtgccactct taataccaag gagggttaca gctatttgta catcaaagga 300

tcccagcctg aagactcagc cacatacctc tgtgccttta cgagaggtgc tgacggactc 360

acctttggca aagggactca tctaatcatc cagccctat 399

<210> 32

<211> 393

<212> DNA

<213> Homo sapiens

<400> 32

atgggcacca gcatcatgtg ctggatggcc ctgtgtctcc tgggggcaga tcacgcagat 60

actggagtct cccagaaccc cagacacaag atcacaaaga ggggacagaa tgtaactttc 120

aggtgtgatc caatttctga acacaaccgc ctttattggt accgacagac cctggggcag 180

ggcccagagt ttctgactta cttccagaat gaagctcaac tagaaaaatc aaggctgctc 240

agtgatcggt tctctgcaga gaggcctaag ggatctttct ccaccttgga gatccagcgc 300

acagagcagg gggactcggc catgtatctc tgtgccagca cctcggagaa gggcggctac 360

accttcggtt cggggaccag gttaaccgtt gta 393

Claims

1. Identification of novel human coronavirus RdRp_829-837A TCR specific for an epitope, which TCR is characterised by recognition of Bx 51:01-RdRp_829-837A property of an antigen complex, the TCR comprising a TCR α chain variable region and a TCR β chain variable region;

the amino acid sequence of CDR3 of the TCR beta variable region is CASSLESGSHYEQYF;

alternatively, the first and second electrodes may be,

2. The method of claim 1 for identifying a novel human coronavirus RdRp_829-837A TCR specific for an epitope, wherein the TCR α chain variable region and the TCR β chain variable region comprise the amino acid sequences of the complementarity determining regions:

αCDR1：TSESDYY；

αCDR2：QEAYKQQN；

αCDR3：CAYRSRVSDSGAGSYQLTF；

βCDR1：SGHVS；

βCDR2：FNYEAQ；

βCDR3：CASSLESGSHYEQYF；

alternatively, the first and second electrodes may be,

αCDR1：SSNFYA；

αCDR2：MTLNGDE；

αCDR3：CAFTRGADGLTF；

βCDR1：SEHNR；

βCDR2：FQNEAQ；

βCDR3：CASTSEKGGYTF。

3. a nucleic acid molecule comprising a nucleic acid encoding the novel corona identifying human of any one of claims 1 to 2Lentiviral RdRp_829-837A nucleotide sequence of a TCR specific for the epitope or a complement thereof.

4. The nucleic acid molecule of claim 3, wherein the nucleic acid molecule comprises nucleotide sequences encoding a TCR α chain variable region and a TCR β chain variable region as set forth in SEQ ID NO: 29 and SEQ ID NO: 30 or the nucleic acid molecule comprises the nucleotide sequences encoding the TCR α chain variable region and the TCR β chain variable region of SEQ ID NOs: 31 and SEQ ID NO: 32.

5. a vector comprising the nucleic acid molecule of any one of claims 3 to 4.

6. A cell which transduces the nucleic acid molecule of any one of claims 3 to 4 or the vector of claim 5, wherein said cell recognizes HLA-B51: 01-RdRp_829-837A TCR specific for an antigenic epitope.

7. A pharmaceutical composition comprising the novel human coronavirus RdRp recognized according to any one of claims 1 to 2_829-837A TCR specific for an epitope, the nucleic acid molecule of any one of claims 3-4, the vector of claim 5 or the cell of claim 6 as an active ingredient.

8. The method of any one of claims 1-2 for identifying a novel human coronavirus RdRp_829-837A TCR specific for an epitope, the nucleic acid molecule of any one of claims 3-4, the vector of claim 5, the cell of claim 6 or the pharmaceutical composition of claim 7 for use in the preparation of a medicament for the treatment and prevention of a viral infection.