CN114317535B

CN114317535B - Gene-deleted CHO cell line and preparation method and application thereof

Info

Publication number: CN114317535B
Application number: CN202111467343.5A
Authority: CN
Inventors: 林祥梅; 冯春燕; 于浩洋; 王彩霞; 吴绍强; 仇松寅; 刘晓飞; 梅琳
Original assignee: Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2024-01-05
Anticipated expiration: 2041-12-02
Also published as: CN114317535A

Abstract

The invention relates to a CHO cell line with deletion of GS gene, anxa2 gene and/or Ctsd gene, a preparation method and application thereof. According to the invention, the CRISPR/Cas9 gene editing technology is utilized to knock out GS genes, anxa2 genes and/or Ctsd genes in CHO cells, and CHO cells with missing GS genes, anxa2 genes and Ctsd genes are screened and identified.

Description

Gene-deleted CHO cell line and preparation method and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and in particular relates to the field of gene editing.

Background

In recent years, gene editing techniques have evolved rapidly, based on the very beginning artificial nuclease gene editing techniques, including zinc finger nucleases (Zinc finger nucleases, ZFNs), transcription activator-like effector nucleases (Transcription activator-like effector nucleases, TALENs) and RNA-mediated CRISPR-Cas nuclease systems. The CRISPR-Cas nuclease system is characterized in that a small-segment RNA-guided nuclease firstly recognizes a target sequence on a gene fragment, double-strand breaks (Double strand breaks, DSB) are generated after DNA targeting cutting, then notch repair process of organisms, namely non-homologous end connection repair or homologous recombination repair is activated, so that the base of a specific site of the gene fragment is deleted, inserted or replaced, and the accurate change of a target gene is realized.

Chinese hamster ovary cells (CHO cells, chinese hamster ovary cells) are important engineering antibodies and recombinant protein expression systems in the development of biological medicines, have the advantages of immortality, can be subjected to subculture for hundreds of generations, belong to fibroblasts, have low endogenous protein expression, are suitable for large-scale stable production of monoclonal antibodies, have use safety in human bodies, and are widely used as host cells of exogenous genes for producing protein medicines. However, there may still be some amount of host cell protein during purification of the protein drug from CHO expression systems, resulting in some risk of immunogenicity of the recombinant therapeutic protein. The Anxa2 gene encodes annexin A2 (also known as annexin II), a member of the calcium-dependent phospholipid binding protein family, and plays a role in regulating cell growth and signal transduction pathways. To date, regardless of the eluent used, A2 was co-purified with monoclonal antibodies on protein a affinity chromatography. The Ctsd gene encodes cathepsin D, a lysosomal aspartic protease, which is often co-purified with monoclonal antibodies by interaction with hydrophobic motifs in the CDR regions of the antibodies.

In CHO cell lines, the DHFR screening system based on dihydrofolate reductase (DHFR) and the GS screening system based on Glutamine Synthetase (GS) are most commonly used. The DHFR screening system was based on CHO DHFR gene deleted strain CHO-DG44 cell line in hypoxanthine and thymidine free medium, in which cells were pressure expanded by increasing the concentration of Methotrexate (MTX) to increase productivity. This step increases the time for cell line generation and is prone to introduce potential instability after removal of the MTX selection pressure. In contrast, fewer copies of the recombinant gene are required per cell in the GS screening system, and high-yield cells can be obtained more quickly. GS gene is important in cell growth, can catalyze free ammonium ion in cell metabolism and glutamate to synthesize glutamine, and can consume NH4 ⁺ In order to reduce the toxicity to cells, the synthesized glutamine is also a nutrient substance required for cell growth, the endogenous GS activity is inhibited by introducing an exogenous GS marker gene and using methionine iminosulfone (methionine sulfoximine, MSX), only CHO cells introduced with the exogenous GS gene can survive in a glutamine-free culture medium, however, the screening rate for high-yield cells in a GS screening system is lower, and a large number of low-yield CHO cells can survive in 5mM MSX, presumably due to the interference of the expression of the endogenous GS gene. Therefore, studies show that the stability of a GS screening system can be greatly improved by knocking out the GS gene, and cell lines with higher expression levels of GS and target proteins can be rapidly screened by the system under the condition of not adding MSX.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provide a CHO cell strain with one or more of GS gene, anxa2 gene and Ctsd gene knocked out. The invention also provides a method for constructing and screening a monoclonal cell strain with high target protein expression by using the CHO cell strain with the gene deletion.

In a first aspect, the invention provides a sgRNA for GS gene knockout in CHO cells, said sgRNA having GS-sgRNA1 shown in SEQ ID NO. 1 and SEQ ID NO. 2 for exon 4 of the GS gene and having GS-sgRNA2 shown in SEQ ID NO. 3 and SEQ ID NO. 4 for exon 5 of the GS gene, preferably said CHO cells are CHO-K1 cells.

In a second aspect, the present invention provides a sgRNA for use in an Anxa2 gene knockout in a CHO cell, said sgRNA having an Anxa2-sgRNA1 directed against exon 5 of the Anxa2 gene as shown in SEQ ID NO. 8 and SEQ ID NO. 9, and an Anxa2-sgRNA2 directed against exon 6 of the Anxa2 gene as shown in SEQ ID NO. 10 and SEQ ID NO. 11, preferably said CHO cell is a CHO-K1 cell.

In a third aspect, the present invention provides an sgRNA for Ctsd gene knockout of CHO cells having Ctsd-sgRNA1 shown in SEQ ID NO:18 and SEQ ID NO:19 for exon 4 of the Ctsd gene and Ctsd-sgRNA2 shown in SEQ ID NO:20 and SEQ ID NO:21 for exon 6 of the Ctsd gene, preferably the CHO cells are CHO-K1 cells.

In a fourth aspect, the present invention provides a primer set for detecting CHO cells knocked out of a GS gene, the primer set having a sequence selected from the group consisting of:

forward primer shown in SEQ ID NO. 5

The reverse primer shown in SEQ ID NO. 6,

the CHO cell knocking out the GS gene is obtained by utilizing the sgRNA of the first aspect through Crispr/Cas9 gene editing,

preferably, the CHO cells are CHO-K1 cells.

In a fifth aspect, the present invention provides a primer set for detecting CHO cell lines knocked out of the Anxa2 gene, the primer set having a sequence selected from the group consisting of:

a first forward primer shown in SEQ ID NO. 12,

a first reverse primer shown in SEQ ID NO. 13,

the probe shown in SEQ ID NO. 14,

a second forward primer shown as SEQ ID NO. 15

A second reverse primer shown as SEQ ID NO. 16,

the CHO cell line knocked out of the Anxa2 gene is obtained by using the sgRNA of the second aspect through Crispr/Cas9 gene editing,

preferably, the CHO cells are CHO-K1 cells.

In a sixth aspect, the invention provides a primer set for detecting CHO cell lines with the Ctsd gene knocked out by the sgRNA of the third aspect, the primer set having a sequence selected from the group consisting of:

a first forward primer shown as SEQ ID NO. 22,

the first reverse primer shown in SEQ ID NO. 23,

the probe shown in SEQ ID NO. 24,

the second forward primer shown in SEQ ID NO. 25

A second reverse primer shown as SEQ ID NO. 26,

the CHO cell line from which the Ctsd gene is knocked out is obtained by utilizing the sgRNA of the third aspect through Crispr/Cas9 gene editing,

preferably, the CHO cells are CHO-K1 cells.

In a seventh aspect, the invention provides a method of preparing a knock-out CHO cell, said method comprising performing a Crispr/Cas9 gene editing with the sgRNA of the first aspect and/or performing a Crispr/Cas9 gene editing with the sgRNA of the second aspect and/or performing a Crispr/Cas9 gene editing with the sgRNA of the third aspect, preferably said CHO cell is a CHO-K1 cell,

preferably, the method comprises performing by Crispr/Cas9 gene editing with the sgRNA of the first aspect, performing by Crispr/Cas9 gene editing with the sgRNA of the second aspect, and performing by Crispr/Cas9 gene editing with the sgRNA of the third aspect, preferably the CHO cell is a CHO-K1 cell.

In an eighth aspect, the present invention provides a knock-out CHO cell prepared by the method of the seventh aspect, preferably, the CHO cell is a CHO-K1 cell.

In a ninth aspect, the invention provides a CHO cell with a gene knockout, said cell having a characteristic sequence selected from the group consisting of:

a sequence shown in SEQ ID NO. 7;

a sequence shown in SEQ ID NO. 17; and/or

The sequence shown in SEQ ID NO. 27,

preferably, the CHO cells are CHO-K1 cells.

In a tenth aspect, the present invention provides the use of a CHO cell prepared by the method of the seventh or eighth aspect, or a CHO cell of the ninth aspect, for the production of a protein of interest, preferably a monoclonal antibody.

Compared with the prior art, the invention has the following advantages and effects:

(1) The screened CHO cell strain has no puromycin resistance, no antibiotics are needed in the screening process, the screening process of the stable cloned cell strain is simplified, the efficiency of obtaining the stable cloned cell strain is improved, the screening period is shortened, convenience is provided for the preparation of subsequent large-scale industrialized fermentation cell seed batches, in addition, the influence of antibiotics, serum proteins and other impurities in the subsequent protein purification process is greatly reduced, and the product quality is ensured;

(2) The CHO cell Anxa2 gene and Ctsd gene are knocked out, so that the pollution of annexin A2 and cathepsin D proteins in the protein purification process is eliminated, and the immunogenicity influence of heterogeneous proteins on the recombinant monoclonal antibody is reduced;

(3) The growth speed of the GS, anxa2 and Ctsd three-gene knockout cells is consistent with that of the wild CHO cells, and the growth speed of the GS, anxa2 and Ctsd three-gene knockout cells in the logarithmic growth phase of the cells is faster than that of the wild CHO cells;

(4) Greatly improves the expression yield of the recombinant expression protein and is beneficial to realizing the industrialized production of the therapeutic monoclonal antibody.

The CHO cell line prepared by the invention can stably grow in passage under the conditions of serum-free and suspension culture, does not express functional glutamine synthetase (glutamine synthetase, GS), annexin A2 (Anxa 2) and cathepsin D (Ctsd), is particularly suitable for recombinant expression of therapeutic monoclonal antibodies, and reduces the influence of heterogeneous proteins and exogenous toxins (such as antibiotics).

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Moreover, the cell culture, molecular genetics, nucleic acid chemistry, immunological laboratory procedures used herein are all conventional procedures widely used in the corresponding field.

Drawings

FIG. 1 is a schematic diagram of construction of GS gene deletion using CRISPR-Cas.

FIG. 2 is a nucleic acid electrophoresis of GS gene knockout monoclonal cells.

FIG. 3 shows the DNA sequencing comparison result of the monoclonal cell strain after the GS gene is knocked out.

FIG. 4 is a diagram showing the state of cells cultured in glutamine (+/-) after the GS gene has been knocked out.

Fig. 5 is a schematic diagram of constructing an Anxa2 gene deletion using CRISPR-Cas.

FIG. 6 is a graph of fluorescent PCR amplification of an Anxa2 knockout monoclonal cell.

FIG. 7 shows the DNA sequencing comparison results of monoclonal cell lines after knockout of Anxa2 and GS.

FIG. 8 is a schematic diagram of the construction of Ctsd gene deletions using CRISPR-Cas.

FIG. 9 is a graph of fluorescence PCR amplification of Ctsd knockout monoclonal cells.

FIG. 10 shows the DNA sequencing comparison results of monoclonal cell lines after the three genes GS, anxa2 and Ctsd are knocked out.

FIG. 11 shows the growth curves of wild CHO cells with three gene knockouts GS, anxa2, ctsd.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings for illustrating the technical means adopted by the present invention, but the embodiments of the present invention are not limited thereto. In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Moreover, the cell culture, molecular genetics, nucleic acid chemistry, immunological laboratory procedures used herein are all conventional procedures widely used in the corresponding field.

EXAMPLE 1 knockout of the GS Gene in CHO cells

1 materials and methods

1.1 materials

CHO-K1 cells were maintained by the animal inspection and quarantine laboratory of the chinese inspection and quarantine science institute. Advanced DMEM medium, fetal calf serum and cell transfection reagent FreeStyle ^TM Puromycin was purchased from Gibico corporation. The PX459 plasmid was purchased from addgene Inc. PCR Green Taq Mix is available from Nanjinouzan Biotech Inc. PCR primers were synthesized by Beijing Optimu Biotechnology Co.

1.2sgRNA target selection, construction and detection primer design

The sgRNA was designed using the CRISPR gRNA Design tool-ATUM site based on the GS gene of the CHO-K1 cell line (GenBank: JH 000342.1) in the database of the national center for information technology (NCBI). Two pairs of sgrnas were designed together, see table 1, and one pair of sgRNA detection primers, see table 2.

The designed GS-sgRNA1 and GS-sgRNA2 are respectively connected to a PX459 carrier containing Cas9 by using CRISPR/Cas9 technology. GS-sgRNA1 was designed on exon 4 of the GS gene, and GS-sgRNA2 was designed on exon 5 of the GS gene, with approximately 443bp between the two sgRNAs, see FIG. 1. And a pair of PCR primers was designed for post-knockout identification at a position approximately 300bp upstream of GS-sgRNA1 and approximately 300bp downstream of GS-sgRNA2, with a spacing of approximately 651bp between the two primers.

TABLE 1 sgRNA sequence for CHO-K1 GS Gene knockout

TABLE 2 amplification of primer sequences for CHO-K1 GS Gene knockout

1.3 determination of screening concentration of puromycin in CHO-K1 cell culture

With medium containing 10% fetal bovine serum and 1% dual-antibody DMEM in CO ₂ CHO-K1 cells were cultured in an incubator at a concentration of 5% and a temperature of 37 ℃. Taking CHO-K1 cells in logarithmic growth phase at 1.2X10 ⁵ Individual cell/well density was plated in 6-well plates at 37 ℃,5% co ₂ Culturing for 12h until the cell density reaches 70% -90%, adding 0 mug/ml, 10 mug/ml, 20 mug/ml, 30 mug/ml, 40 mug/ml and 50 mug/ml of puromycin in concentration gradient into the cells, changing the liquid once every 24h, and determining the lowest concentration of all cell death on the 4 th day as the optimal concentration of puromycin. After 4 days of screening, the following steps are found: when the puromycin concentration is 0 mug/ml, the cells grow normally; when the puromycin concentration is not less than 10 mug/ml, the cells are all dead. That is, the optimal screening concentration of the wild-type CHO-K1 cells is 10. Mu.g/ml.

1.4 screening of CHO-K1 cell transfection and GS Gene knockout monoclonal

CHO-K1 cells were 1.2X10 at 12h prior to transfection ⁵ The individual cells/wells were plated in 6-well plates to achieve a cell density of 70% -90% on the day of transfection. Diluting 1.5ug of recombinant plasmid PX459-GS-sgRNA1 and 1.5ug of recombinant plasmid PX459-GS-sgRNA2 in 100. Mu.L of serum-free and antibiotic-free culture medium; mu.L of transfection reagent fresh ^TM Diluting in 100 μl of serum-free and antibiotic-free culture medium, mixing for 5min, mixing, incubating at room temperature for 20min, adding into cell culture well to be transfected, and culturing for 24 hr; after the supernatant is removed after 24h of transfection of CHO-K1, 2mL of complete culture medium is added again, 10 mug/mL of puromycin is added for screening in a dark place, puromycin is added again after every 24h of culture medium replacement, the cell supernatant is discarded after 4 days, the surviving cells are continuously cultured in 20% FBS DMEM culture medium, clone colonies containing single cells in a 6-well plate are observed by a microscope, and monoclonal cell colonies are picked and cultured in a 96-well plate.

1.5 PCR identification of the knockout monoclonal cells of GS Gene

When cells are in 96-well platesWhen the density reaches 90% -95%, cells are digested by pancreatin, half of cells are reserved for extracting DNA for PCR verification, and the other half of cells are continuously cultured in an expanding mode. The method for simple extraction of genomic DNA in 96-well plates is as follows: after pancreatin digestion of CHO-K1 cells half cells were centrifuged at 1000rpm for 5min, the supernatant was discarded, 11.2 μl of Tris-NaCL (ph=7.5) and 0.8 μl of proteinase K were added, incubated at 62 ℃ for 15min, at 65 ℃ for 15min, and at 95 ℃ for 10min, the resulting solution was used as PCR template for identification. The PCR amplification system is as follows: green Taq Mix 5. Mu.L, forward primer 0.5. Mu.L, reverse primer 0.5. Mu. L, DNA template 1. Mu. L, ddH ₂ O3. Mu.L. The PCR amplification conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 5min. The PCR amplified products were separated and identified by agarose gel electrophoresis at 180V voltage and 1%.

And carrying out PCR identification on the monoclonal cells from which the GS genes are knocked out, wherein the expected fragment size of the wild CHO-K1 DNA fragment amplified by the GS-F1 and the GS-R1 is 1100bp, and the expected fragment size of the DNA fragment amplified by the GS-sgRNA1 and the GS-sgRNA2 from which the GS genes are knocked out by targeting is 651bp. Using the selected 9 monoclonal cells as templates and wild-type CHO-K1 as a control, agarose gel electrophoresis results showed that: 4 is CHO-K1 non-knocked out fragment, 6 clones (1, 2, 3, 8, 9, 10) are biallelic heterozygous fragment deletions, and 5 clones (5, 6, 7, 11, 12) are biallelic deletions (see fig. 2).

1.7 sequencing of the GS Gene knockout monoclonal cells

Amplifying and culturing cell strains without glutamine screening as GS gene deletion, extracting genomic DNA of the cell strains with the GS gene deletion for PCR amplification, carrying out DNA sequencing on PCR amplification products by a company (Beijing qingke biotechnology Co., ltd.) under the same PCR amplification system and PCR amplification conditions as in the step 1.5. Sequencing results were as follows:

ATGGCACTCATTCCATGAGATTTCATAGCTGACTTTAATTATAAAAAGTCTCTCAGCCTTTTCCTGCAAATGTACTATCATTGCTTCTTCACAGTGGTTGGGCCTGAGTAGGTCCAGCCTATGATGACTTCAGCTGTGTAAGAGTTGAGGACACTACTCCTTACAGCATGTTGATGCTTTATTCCTAGAGACCAATTTAAGGCACTCGTGTAAACGGATAATGGACATGGTGAGCAACCAGCACCCCTGGTTTGGAATGGAACAGGAGTATACTCTGATGGGAACAGATGGGCACCCTTTTGGTTGGCCTTCCAATGGCTTTCCTGGGCCCCAAGGTAAGTTCCCCAGGTGAAATAAAAGCTTCCTTGGTGTGGGCGCAGACAAAGCCTATGGCAGGGATATCGTGGAGGCTCACTACCGCGCCTGCTTGTATGCTGGGGTCAAGATTACAGGAACAAATGCTGAGGTCATGCCTGCCCAGGTAAATGGCACTATTCTGTTCCTTTTCCTCCCCTCTGAAGACTTGGCACATGGGGACTTTGGTTAACAAGGGTGATGACTTAAAAGTGGTTCAGGGTAGAGGTAAGTAGAACAAGCTA(SEQ ID NO:7)

compared with the wild CHO-K1 DNA fragment sequence, the DNA fragment after the GS gene is knocked out at the targeting position of GS-sgRNA1-sgRNA2 is in total deleted 437bp, as shown in figure 3, which shows the comparison of the DNA sequencing of the monoclonal cell strain after the GS gene is knocked out, and the result shows that the designed GS-sgRNA1-sgRNA2 can well knock out the GS gene of CHO-K1.

1.8 functional identification of defective knockout of GS Gene

Carrying out GS defect function identification on the expanded monoclonal cell strain: one part of a monoclonal cell is placed in a glutamine-containing medium for culturing, and the other part is placed in a glutamine-free medium for culturing. FIG. 4 shows a state diagram of cells cultured in glutamine (+/-) after the GS gene was knocked out, in which A, C in FIG. 4 is a state diagram of cells cultured in a glutamine-free medium for 4 days, B, D is a state diagram of cells cultured in a glutamine-containing medium for 4 days, and as a result, it was shown that the growth rate of cells in the glutamine-free medium was significantly lower than that of cells in the glutamine-containing medium, and cells gradually shrunken and died. This shows that the present invention screens cell lines that survive in glutamine-containing medium but do not survive in glutamine-free medium, i.e., CHO-K1 cell lines that are defective in GS function.

Example 2 knockout of Anxa2 Gene

2.1 materials

2.2sgRNA target selection, construction and detection primer design

The synthesis of sgRNA was designed based on the Anxa2 gene of the CHO-K1 cell line (GenBank: XM_ 003513661.5) in the database of the national center for information technology (NCBI). Application CRISPR gRNA Design tool-ATUM website design. Two pairs of sgrnas were designed together, see table 3, and two pairs of post-knockout cell identification detection primers were designed using primer design software, see table 4.

TABLE 3 sgRNA sequences for CHO-K1 Anxa2 Gene knockout

TABLE 4CHO-K1 Anxa2 Gene knockout identification primers

And respectively connecting the designed Anxa2-sgRNA1 and the Anxa2-sgRNA2 to PX459 carriers containing Cas9 by using a CRISPR/Cas9 technology. An Anxa2-sgRNA1 was designed on exon 5 of the Anxa2 gene, and an Anxa2-sgRNA2 was designed on exon 6 of the Anxa2 gene, approximately 259bp between the two sgRNAs. A pair of fluorescent PCR primers (Anxa 2-F1/Anxa 2-R1) and probes (Anxa 2-P1) were designed using the sequence between Anxa2-sgRNA1 and Anxa2-sgRNA2 for post-knockout identification, and a pair of common PCR (Anxa 2-F2/Anxa 2-R2) primers were designed upstream and downstream of Anxa2-sgRNA1 and Anxa2-sgRNA2, respectively, for cell sequencing. FIG. 5 shows a schematic diagram of constructing an Anxa2 gene deletion using CRISPR-Cas.

2.3CHO-K1 cell transfection and screening of Anxa2 Gene knockout monoclonal

The GS gene CHO-K1 cells were knocked out 1.2X10 at 12h before transfection ⁵ The individual cells/wells were plated in 6-well plates to achieve a cell density of 70% -90% on the day of transfection. Diluting 1.5 μg of recombinant plasmid PX459-Anxa2-sgRNA1 and 1.5 μg of recombinant plasmid PX459-Anxa2-sgRNA2 in 100 μl serum-free and antibiotic-free medium; mu.L of transfection reagent fresh ^TM Diluting in 100 μl of serum-free and antibiotic-free culture medium, mixing for 5min, mixing, incubating at room temperature for 20min, adding into cell culture well to be transfected, and culturing for 24 hr; CHO-K1 waste transfected for 24hAfter 2mL of complete culture medium is added again after the supernatant, 10 mug/mL puromycin is added for screening, the culture medium is replaced every 24 hours, puromycin is added again, the cell supernatant is discarded after 4 days, the surviving cells are continuously cultured in 20% FBS DMEM culture medium, the clone colony containing single cells in a 6-well plate is observed by a microscope, and the monoclonal cell colony is selected and cultured in a 96-well plate.

2.4 fluorescent PCR identification of Anxa2 Gene knockout monoclonal cells

When the cell density in the 96-well plate reaches 90% -95%, the cells are digested by pancreatin, half of the cells are reserved for extracting DNA for PCR verification, and the other half of the cells are continuously subjected to expansion culture. The method for simple extraction of genomic DNA in 96-well plates is as follows: after pancreatin digestion of CHO-K1 cells half cells were centrifuged at 1000rpm for 5min, the supernatant was discarded, 11.2 μl of Tris-Nacl (ph=7.5) and 0.8 μl of proteinase K were added, incubated at 62 ℃ for 15min, at 65 ℃ for 15min, and at 95 ℃ for 10min, the resulting solution was used as a PCR template for identification. The fluorescent PCR amplification system comprises: quantiNova Probe PCRMix 10 mu L, F primer 0.5 mu L, R primer 0.5 mu L, P primer 0.5 mu L, DNA template 5 mu L, ddH ₂ O3.5. Mu.L. The fluorescent PCR amplification conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s and annealing at 60℃for 30s, FAM channel fluorescence was collected for 40 cycles. Meanwhile, DNA of the wild CHO-K1 is taken as a control, and as can be seen from a fluorescent PCR amplification curve (FIG. 6), cells (3, 4 and 5) which are knocked out successfully have no amplification curve, and the wild CHO-K1 (1 and 2) have obvious S-shaped amplification curves.

2.5 determination of sequence of Anxa2 Gene knockout monoclonal cells

Amplifying and culturing cell strains screened as GS and Anxa2 gene deletion, extracting genome DNA of the cell strain with the gene deletion for PCR amplification, wherein a PCR amplification system is as follows: green Taq Mix 5. Mu.L, forward primer 0.5. Mu.L, reverse primer 0.5. Mu. L, DNA template 1. Mu. L, ddH ₂ O3. Mu.L. The PCR amplification conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 5min. The PCR amplified product was sent to the company (Beijing qing Biotechnology Co., ltd.) for DNA sequencing. Sequencing results were as follows:

ATGCGTGGGCCTTTGTGGGCTCTTTGCTAATGTTAGCGCACTCACATGGGTGCGAGGCGTGTCTCCTGTGGATCTCCAGTTCTGACCAGCATGCTCCTGAACACCTGCCTGTCAAAGGAAGGGGATTCTTCTCTCAGGCAAATGACCCAGGAGTGTGTTGCAGCCTAGCCCACTGACACCTCCATGACAGTGACAACTCTGTGGCTCTCTTTGGCGCTCTCGGTGGTCTTGCATTTTACCAGCACACACAGTTTGGGGGAGAAATTAAAGTGGCTTCAGCTTCTCAGGGGTGTAGCTCAGAGAATTCTGAGATGCCTACTCAAGATTGGGCACCTAGGGGGATGGCTGACAATGGTGAGGCATGGTGTACCCACTTCCTTCTCTGATGATCTTGCTCTTCCTTGACCTTGTCTAGATTAACATGAGAAAAACTGTATATGGTGTTTGTTCGGGAACAAAGCTATGCAGCTCACCTGAGTTGGAGAGGAAACACCTCCAGCCTTTAAAGCACAAAGAGCTAGGTCTGACCGTCTTCCTGGTTCTTTTCCTCTAGGGCCGAAGAGCAGAGGATGGTTCGGTCATTGACTACGAACTGATTGACCAGGA(SEQ ID NO:17)

compared with wild CHO-K1 DNA fragment sequences, the DNA fragments obtained after the knockout of the Anxa2 gene at the targeting position of the Anxa2-sgRNA1/Anxa2-sgRNA2 are deleted for 259bp altogether, as shown in FIG. 7, which shows the DNA sequencing comparison of monoclonal cell lines obtained after the knockout of the Anxa2 gene and the GS, and the result shows that the designed Anxa2-sgRNA1/Anxa2-sgRNA2 can well knockout the Anxa2 gene of CHO-K1.

Example 3 knockout of the Ctsd Gene

3.1 materials

CHO-K1 cells, quantiNova Probe PCR Kit from Qiagen, knocked out of the GS, anxa2 gene. The rest materials are the same as 1.1.

3.2sgRNA target selection, construction and detection primer design

The synthesis of sgRNA was designed according to the Ctsd gene (GenBank: NW_ 003614851.1) of CHO-K1 cell lines in the database of the national center for information technology (NCBI). Application CRISPR gRNA Design tool-ATUM website design. Two pairs of sgrnas were designed together, see table 5, and two pairs of post-knockout cell identification detection primers were designed using primer design software, see table 6.

TABLE 5 sgRNA sequence for CHO-K1 Ctsd Gene knockout

TABLE 6 primer sequences for amplifying CHO-K1 Ctsd gene knockouts

And respectively connecting the designed Ctsd-sgRNA1 and Ctsd-sgRNA2 to a PX459 carrier containing Cas9 by using CRISPR/Cas9 technology. Referring to FIG. 8, ctsd-sgRNA1 was designed on exon 4 of the Ctsd gene, and Ctsd-sgRNA2 was designed on exon 5 of the Ctsd gene, with about 643bp between the two sgRNAs. A pair of fluorescent PCR primers (Ctsd-F1/Ctsd-R1) and probes (Ctsd-P1) were designed using the sequence between Ctsd-sgRNA1 and Ctsd-sgRNA2 for post-knockout identification, and a pair of PCR primers (Ctsd-F2/Ctsd-R2) were designed at a position of about 300bp upstream of Ctsd-sgRNA1 and about 350bp downstream of Ctsd-sgRNA2 for sequencing identification of cells after knockout.

3.3 transfection of CHO-K1 cells and screening of Ctsd Gene knockout monoclonal

CHO-K1 cells from which GS and Anxa2 genes were knocked out were 1.2X10 at 12h before transfection ⁵ The individual cells/wells were plated in 6-well plates to achieve a cell density of 70% -90% on the day of transfection. Diluting 1.5 mu g of recombinant plasmid PX459-Ctsd-sgRNA1 and 1.5 mu g of recombinant plasmid PX459-Ctsd-sgRNA2 in 100 mu L of serum-free and antibiotic-free medium; mu.L of transfection reagent fresh ^TM Diluting in 100 μl of serum-free and antibiotic-free culture medium, mixing for 5min, mixing, incubating at room temperature for 20min, adding into cell culture well to be transfected, and culturing for 24 hr; after the supernatant is removed after 24h of transfection of CHO-K1, 2mL of complete culture medium is added again, 10 mug/mL of puromycin is added for screening in a dark place, puromycin is added again after every 24h of culture medium replacement, the cell supernatant is discarded after 4 days, the surviving cells are continuously cultured in 20% FBS DMEM culture medium, clone colonies containing single cells in a 6-well plate are observed by a microscope, and monoclonal cell colonies are picked and cultured in a 96-well plate.

3.4 fluorescent PCR identification of Ctsd Gene knockout monoclonal cells

When the cell density in the 96-well plate reaches 90% -95%, the cells are digested by pancreatin, half of the cells are reserved for extracting DNA for PCR verification, and the other half of the cells are continuously subjected to expansion culture. Simple extraction method of genome DNA in 96-well plateThe following are provided: after pancreatin digestion of CHO-K1 cells half cells were centrifuged at 1000rpm for 5min, the supernatant was discarded, 11.2 μl of Tris-Nacl (ph=7.5) and 0.8 μl of proteinase K were added, incubated at 62 ℃ for 15min, at 65 ℃ for 15min, and at 95 ℃ for 10min, the resulting solution was used as a PCR template for identification. The fluorescent PCR amplification system comprises: quantiNova Probe PCRMix 10 mu L, F primer 0.5 mu L, R primer 0.5 mu L, P primer 0.5 mu L, DNA template 5 mu L, ddH ₂ O3.5. Mu.L. The fluorescent PCR amplification conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s and annealing at 60℃for 30s, FAM channel fluorescence was collected for 40 cycles. Meanwhile, DNA of the wild CHO-K1 is taken as a control, and as can be seen from a fluorescent PCR amplification curve (FIG. 9), cells (3 and 4) which are knocked out successfully have no amplification curve, and the wild CHO-K1 (1 and 2) have obvious S-type amplification curves.

3.5 sequencing of the Ctsd Gene knockout monoclonal cells

Amplifying and culturing cell strains screened as GS, anxa2 and Ctsd three genes, extracting genome DNA of the three gene deleted cell strains for PCR amplification, wherein a PCR amplification system is as follows: green Taq Mix 5. Mu.L, forward primer 0.5. Mu.L, reverse primer 0.5. Mu. L, DNA template 1. Mu. L, ddH ₂ O3. Mu.L. The PCR amplification conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 5min. The PCR amplified product was sent to the company (Beijing qing biosciences Co., ltd.) for DNA sequencing, and the sequencing result was:

ATGAGTGCCCACTTCATGTTGTTTTCAAGCCTGACCCCTAGCTCCTGACTGGGTCACTGGCCCTGTGACAGCCAAGACTCTTCTAGTTTTGTTTTTCCCTATCTATTTTTGTTCCTTGCTCAGCTCTGGGCAAAGTGATTCCCTAGAGGCAGGGCCATGGATGAATGCACAGGGTCCTTAGACCCCTGGGCTCTGTTCCCTAGAATATGGGGTACCTAGAAGTTGGCCAGGCTGGGCTTAGTGGCACATGCCTTTAATCCCCACACTCAAGAGGCAAGGGCAGGAAGATCTGTGACCAAGGATGATGCCTGGCCAGGCATGATGCTCACATCCCCGCCTCTCAGTTTATACTTACGTGGTGATTGTTTAAGAACTTTCGGCATTGTAGCTTCATGCCACACTCCCTGTGTTCTGCTTGAGGGCATTGTGGTGGGCTTTCCCATGAGACTAGAGGTGGGGGAATTGAGAGAAGGGTTTGGAGGAGAAGCTGAGAGGGGTATAGAGCATTCCTAGACAGCATGTGCTACGGCTGTGGATGGAGCCAGCTTAGCCTCTCAGGGCCATGGCTCTGGCTTCCTCCTAGAAGCCAGCTTTCAGTTTTGTCAGGCAGAGAGCATCCTTCAACTCCA(SEQ ID NO：27)

compared with the wild CHO-K1 DNA fragment sequence, the DNA fragment after the Ctsd gene is knocked out at the targeting position of Ctsd-sgRNA1/Ctsd-sgRNA2 is co-deleted 643bp, as shown in FIG. 10, which shows the DNA sequencing comparison result of a monoclonal cell strain after the GS, anxa2 and Ctsd genes are knocked out, and shows that the designed Ctsd-sgRNA1/Ctsd-sgRNA2 can well knocke out the Ctsd gene of CHO-K1.

3.6 comparison of the proliferation Rate of the three Gene knockout cell lines of GS, anxa2 and Ctsd with the wild type CHO-K1 cell line

After the CHO-K1 cells are respectively passaged for 5 generations with GS, anxa2 and Ctsd three-gene deletion CHO cells, selecting cells with better growth state according to the ratio of 1.0X10 ⁴ cell density of cells/mL, 1mL per well was inoculated onto 24-well plates, and placed at 37℃with 5% CO ₂ For each 24h, 3 replicate wells were set for each group of cells, and the average was taken after each count.

3.7 comparison of the effect of transfection of the cell lines knocked out by three genes including GS, anxa2 and Ctsd with the wild type CHO-K1 cell line

CHO-K1 cells were 1.2X10-fold compared to GS, anxa2, ctsd three-gene deleted CHO cells, respectively, 12h before transfection ⁵ The individual cells/wells were plated in 6-well plates to achieve a cell density of 70% -90% on the day of transfection. ASFV-P72 mAb was set up with 5 gradients (3. Mu.g, 4. Mu.g, 5. Mu.g, 6. Mu.g, 8. Mu.g) at a weight to light chain ratio of 3:2 and diluted in 100. Mu.L serum-free antibiotic-free medium, 5. Mu.L transfection reagent fresh ^TM Diluted in 100 μl of serum-free antibiotic-free medium; mixing the above materials after 5min, gently mixing, incubating at room temperature for 20min, adding into cell culture well to be transfected, and setting a well as negative control well; placing the cells into a 37 ℃ incubator for incubation for 4-6 hours, discarding the cell culture solution, adding 1ml of serum-free and antibiotic-free culture medium, and incubating for 24 hours in the 37 ℃ incubator; after 24h Kong Zhongshang clear was aspirated for ELISA detection. ELISA was performed by pipetting Kong Zhongshang clear 24h after transfection, and the OD results showed almost consistent transfection efficiency of the monoclonal antibodies in wild-type CHO and GS-deleted cells.

3.8 growth curves of GS, anxa2, ctsd three-gene knockout cell lines and wild CHO-K1 cell lines

Wild CHO-K1 cells were knocked out with GS, anxa2 and Ctsd three genes at 1.0X10 respectively ⁴ cell density of cells/mL, 1mL per well was inoculated onto 24-well plates, 3 per digestion was counted for 7 days, the growth curve was as shown in fig. 11, the growth rate of wild-type CHO cells was consistent with that of GS, anxa2, ctsd three-gene knockout cells, and the growth rate of GS, anxa2, ctsd three-gene knockout cells was faster than that of wild-type CHO cells in the logarithmic growth phase of cells.

Sequence listing

<110> national institute of inspection and quarantine science

<120> gene deleted CHO cell line and preparation method and application thereof

<130> CP11454JY

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

caccgacagt aagaacttat g 21

<210> 2

<211> 21

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

aaaccataag ttcttactgt c 21

<210> 3

<211> 22

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

caccgtcagg tccgtattac tg 22

<210> 4

<211> 22

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

aaaccagtaa tacggacctg ac 22

<210> 5

<211> 23

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggccagcgtg cagataggat gaa 23

<210> 6

<211> 22

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tgttcaggcc aactcaagct cc 22

<210> 7

<211> 599

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atggcactca ttccatgaga tttcatagct gactttaatt ataaaaagtc tctcagcctt 60

ttcctgcaaa tgtactatca ttgcttcttc acagtggttg ggcctgagta ggtccagcct 120

atgatgactt cagctgtgta agagttgagg acactactcc ttacagcatg ttgatgcttt 180

attcctagag accaatttaa ggcactcgtg taaacggata atggacatgg tgagcaacca 240

gcacccctgg tttggaatgg aacaggagta tactctgatg ggaacagatg ggcacccttt 300

tggttggcct tccaatggct ttcctgggcc ccaaggtaag ttccccaggt gaaataaaag 360

cttccttggt gtgggcgcag acaaagccta tggcagggat atcgtggagg ctcactaccg 420

cgcctgcttg tatgctgggg tcaagattac aggaacaaat gctgaggtca tgcctgccca 480

ggtaaatggc actattctgt tccttttcct cccctctgaa gacttggcac atggggactt 540

tggttaacaa gggtgatgac ttaaaagtgg ttcagggtag aggtaagtag aacaagcta 599

<210> 8

<211> 25

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

caccggtctt catttgcccc tgtgt 25

<210> 9

<211> 24

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaacacacag gggcaaatga agac 24

<210> 10

<211> 25

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

caccggtctg cacagcacat cctca 25

<210> 11

<211> 24

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

aaactgagga tgtgctgtgc agac 24

<210> 12

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

agaatccact tgcatcattt 20

<210> 13

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

cttgcaggtg agtgacacac 20

<210> 14

<211> 24

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gctgcaccct tccagaaagc ccta 24

<210> 15

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gtgtgtgcaa atgtttgcct 20

<210> 16

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

gcttggcaca tacccgggca 20

<210> 17

<211> 606

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

atgcgtgggc ctttgtgggc tctttgctaa tgttagcgca ctcacatggg tgcgaggcgt 60

gtctcctgtg gatctccagt tctgaccagc atgctcctga acacctgcct gtcaaaggaa 120

ggggattctt ctctcaggca aatgacccag gagtgtgttg cagcctagcc cactgacacc 180

tccatgacag tgacaactct gtggctctct ttggcgctct cggtggtctt gcattttacc 240

agcacacaca gtttggggga gaaattaaag tggcttcagc ttctcagggg tgtagctcag 300

agaattctga gatgcctact caagattggg cacctagggg gatggctgac aatggtgagg 360

catggtgtac ccacttcctt ctctgatgat cttgctcttc cttgaccttg tctagattaa 420

catgagaaaa actgtatatg gtgtttgttc gggaacaaag ctatgcagct cacctgagtt 480

ggagaggaaa cacctccagc ctttaaagca caaagagcta ggtctgaccg tcttcctggt 540

tcttttcctc tagggccgaa gagcagagga tggttcggtc attgactacg aactgattga 600

ccagga 606

<210> 18

<211> 25

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

ccacggataa caagctctcc aggac 25

<210> 19

<211> 24

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

aaacgtcctg gagagcttgt tatc 24

<210> 20

<211> 25

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

ccacggcttt aggtgattgt gcccc 25

<210> 21

<211> 24

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

aaacggggca caatcaccta aagc 24

<210> 22

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

gattagggcc tagtggtctt 20

<210> 23

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

tggcagagta agtgccctgg 20

<210> 24

<211> 22

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

gaaaggatgt ggctacagct ta 22

<210> 25

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

tgcctcagca agggtaccct 20

<210> 26

<211> 19

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

gccaaggcta gagtcaggc 19

<210> 27

<211> 629

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

atgagtgccc acttcatgtt gttttcaagc ctgaccccta gctcctgact gggtcactgg 60

ccctgtgaca gccaagactc ttctagtttt gtttttccct atctattttt gttccttgct 120

cagctctggg caaagtgatt ccctagaggc agggccatgg atgaatgcac agggtcctta 180

gacccctggg ctctgttccc tagaatatgg ggtacctaga agttggccag gctgggctta 240

gtggcacatg cctttaatcc ccacactcaa gaggcaaggg caggaagatc tgtgaccaag 300

gatgatgcct ggccaggcat gatgctcaca tccccgcctc tcagtttata cttacgtggt 360

gattgtttaa gaactttcgg cattgtagct tcatgccaca ctccctgtgt tctgcttgag 420

ggcattgtgg tgggctttcc catgagacta gaggtggggg aattgagaga agggtttgga 480

ggagaagctg agaggggtat agagcattcc tagacagcat gtgctacggc tgtggatgga 540

gccagcttag cctctcaggg ccatggctct ggcttcctcc tagaagccag ctttcagttt 600

tgtcaggcag agagcatcct tcaactcca 629

Claims

1. A method of preparing a knock-out CHO cell, the method comprising performing a Crispr/Cas9 gene editing with a sgRNA for CHO cell GS gene knock-out, performing a Crispr/Cas9 gene editing with a sgRNA for CHO cell Anxa2 gene knock-out, and performing a Crispr/Cas9 gene editing with a sgRNA for CHO cell sd gene knock-out, wherein,

the sgRNA for the GS gene knockout of the CHO cells is GS-sgRNA1 aiming at the exon 4 of the GS gene and prepared from the oligonucleotides shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the sgRNA is prepared from the oligonucleotides shown in SEQ ID NO:3 and the oligonucleotide shown in SEQ ID NO. 4, against the GS-sgRNA2 of exon 5 of the GS gene,

the sgRNA for knocking out the Anxa2 gene of the CHO cell is Anxa2-sgRNA1 which is prepared by oligonucleotides shown in SEQ ID NO. 8 and SEQ ID NO. 9 and aims at an Anxa2 gene exon 5, and Anxa2-sgRNA2 which is prepared by oligonucleotides shown in SEQ ID NO. 10 and SEQ ID NO. 11 and aims at an Anxa2 gene exon 6,

the sgRNA for the CHO cell Ctsd gene knockout is Ctsd-sgRNA1 aiming at the exon 4 of the Ctsd gene and prepared by the oligonucleotides shown in SEQ ID NO. 18 and SEQ ID NO. 19, and Ctsd-sgRNA2 aiming at the exon 6 of the Ctsd gene and prepared by the oligonucleotides shown in SEQ ID NO. 20 and SEQ ID NO. 21.

2. The method of claim 1, wherein the CHO cells are CHO-K1 cells.

3. A knockout CHO cell prepared by the method of claim 1 or 2.

4. A CHO cell according to claim 3, wherein the cell has a characteristic sequence selected from the group consisting of:

a sequence shown in SEQ ID NO. 7;

a sequence shown in SEQ ID NO. 17; and

SEQ ID NO. 27.

5. Use of CHO cells prepared by the method of claim 1 or 2, or CHO cells of claim 3 or 4, for the production of a protein of interest.

6. The use according to claim 5, wherein the protein of interest is a monoclonal antibody.