CN114317510A - Maleic acid cis-trans isomerase mutant - Google Patents
Maleic acid cis-trans isomerase mutant Download PDFInfo
- Publication number
- CN114317510A CN114317510A CN202210006581.4A CN202210006581A CN114317510A CN 114317510 A CN114317510 A CN 114317510A CN 202210006581 A CN202210006581 A CN 202210006581A CN 114317510 A CN114317510 A CN 114317510A
- Authority
- CN
- China
- Prior art keywords
- mutant
- maleic acid
- trans isomerase
- enzyme
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a maleic acid cis-trans isomerase mutant, belonging to the technical field of enzyme engineering. The amino acid sequence of the mutant of the maleic acid cis-trans isomerase is shown as SEQ ID No.2, the temperature stability of the mutant enzyme is greatly improved compared with that of a wild enzyme, and meanwhile, the mutant has better pH stability. The constructed maleate cis-trans isomerase mutant and the aspartase AspA are expressed in the escherichia coli in a coupling mode, the maleic acid is used as a substrate to produce the L-aspartic acid, the conversion rate can reach more than 94%, and the method has a wide industrial production application prospect.
Description
Technical Field
The invention relates to a maleic acid cis-trans isomerase mutant, belonging to the technical field of enzyme engineering.
Background
Maleate cis-trans isomerases (EC 5.2.1.1, malia) are isomerases that catalytically convert maleic acid (maleic acid) to fumaric acid (fumaric acid), and are capable of effecting the isomerization of cis-butenedioic acid to trans-butenedioic acid without breaking the carbon-carbon double bond, and belong to the aspartate, glutamate racemase superfamily. Maleic acid cis-trans isomerase is considered as one of the potential biocatalysts for industrial production of fumaric acid due to its broad catalytic reaction pH range, low Km value and high equilibrium constant. Maleic acid cis-trans-isomerase is widely present in some bacteria capable of absorbing and utilizing maleic acid, such as Pseudomonas (Pseudomonas), Alcaligenes (Alcaligenes), Serratia (Serratia), Proteus (Proteus) and Arthrobacter (Arthrobacter), etc. However, the activity of the enzyme in most of the maleic acid metabolism bacteria is low, the thermal stability is poor, and the application of the maleic acid cis-trans isomerase in industrial production is restricted.
The maleic acid cis-trans isomerase from Serratia marcescens has good thermal stability at room temperature, and the enzyme activity is higher than that from other strains. In 2013, Wanya et al connected the maleate cis-trans isomerase coding gene amplified from Serratia marcescens (Serratia marcocens) to pET24a vector and achieved successful expression in Escherichia coli BL21(DE3) (Wanya, trewenjing, Zhouli, et al.
Disclosure of Invention
The first purpose of the invention is to provide a maleic acid cis-trans isomerase mutant, which takes a sequence with an amino acid sequence shown as SEQ ID NO.4 as a parent sequence, and replaces one or two of 96 th position and 100 th position of the parent sequence.
In one embodiment, the nucleotide sequence encoding said parent is as set forth in SEQ ID No. 3.
In one embodiment, the glutamine at position 96 is substituted for glutamic acid and the alanine at position 100 is substituted for methionine.
In one embodiment, the amino acid sequence of the maleate cis-trans isomerase mutant is shown in SEQ ID NO. 2.
The second object of the present invention is to provide a gene encoding the maleate cis-trans isomerase mutant.
In one embodiment, the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
The third purpose of the invention is to provide a vector containing the gene.
In one embodiment, the vector includes, but is not limited to, pET series, Duet series, pGEX series, pHY300PLK, pPIC3K, or pPIC9K series vectors.
Preferably, pET24a (+) is used as a vector.
The fourth purpose of the invention is to provide a microbial cell for expressing the maleic acid cis-trans isomerase mutant or containing the gene.
In one embodiment, Escherichia coli, Bacillus subtilis, and Pichia pastoris are used as host cells.
Preferably, as E.coli BL21 host cells; more preferably, Escherichia coli BL21 in which the fumA and fumC genes are knocked out is used as a host cell.
The fifth purpose of the invention is to provide a method for producing the maleic acid cis-trans isomerase mutant, wherein microbial cells expressing the maleic acid cis-trans isomerase mutant are inoculated in a2 XYT culture medium and cultured to OD at 35-37 DEG C600When the temperature is 0.6-0.8 ℃, adding an inducer IPTG to induce for 14-16h at 37 ℃.
In one embodiment, the method comprises inoculating the genetically engineered bacterium with the genetically engineered bacteriumKanamycin-containing 2 XYT expression medium, shaking-culturing at 37 deg.C and 200r/min to OD600When the concentration is 0.6-0.8, adding inducer IPTG to 0.2mM, inducing for 14-16h at 37 ℃, and expressing the maleate cis-trans isomerase mutant enzyme.
In one embodiment, the cells after induction expression are collected, the cells are disrupted and the supernatant is collected, and the supernatant is membrane-filtered and then separated by a His Trap HP column to obtain a maleate cis-trans isomerase mutant.
It is a sixth object of the present invention to provide a method for producing L-aspartic acid by transforming maleic acid to L-aspartic acid using a microbial cell expressing the mutant cis-trans isomerase and aspartase (AspA).
In one embodiment, the microbial cells are cultured to OD in a culture system6000.6-0.8, adding an inducer for induction for 14-16h, and collecting thalli; adding the thalli into a reaction system using maleic acid as a substrate to react for 4-12 h.
In one embodiment, the microbial cells are cultured to OD in a culture system6000.6-0.8, adding an inducer IPTG (isopropyl thiogalactoside) for induction for 14-16h, and collecting thalli; adding the thalli into a reaction system using maleic acid as a substrate to react for 6-8 h.
In one embodiment, the concentration of the substrate in the reaction system is 3.0-4.0M, and the OD of the strain is600Reacting at pH8 + -1 and 37-45 deg.C under 5 + -0.5.
Preferably, the substrate concentration in the reaction system is 3.2M, strain OD600Reacting for 6-8 h at the temperature of 37 ℃ and the pH value of 5 +/-0.5.
The seventh purpose of the invention is to provide the application of the maleic acid cis-trans isomerase mutant or the microbial cell in the production of products containing L-aspartic acid and/or L-aspartic acid derivatives.
The invention has the beneficial effects that: on the basis of the previously constructed maleic acid cis-trans isomerase mutant maiA-G27A-G171A, the 96 th position and the 100 th position of the mutant are substituted, glutamine at the 96 th position is substituted by glutamic acid, and alanine at the 100 th position is substituted by methionine, so that the mutant has better temperature stability and pH stability. The constructed maleic acid cis-trans isomerase mutant and the aspartic enzyme AspA are subjected to coupled expression to construct a genetic engineering bacterium, the constructed genetic engineering bacterium takes maleic acid as a substrate and reacts for 6-8 hours to produce L-aspartic acid, and the conversion rate can reach more than 94%.
Drawings
FIG. 1 is an SDS-PAGE analysis of wild-type and mutant enzyme protein after purification, wt. maiA-G27A-G171A.
FIG. 2 is a graph showing the enzyme activity curves of wild enzyme and mutant enzyme at different temperatures, wt. being maiA-G27A-G171A.
FIG. 3 shows the enzyme activity curves of wild enzyme and mutant enzyme at different pH values at 40 ℃ and wt% of maiA-G27A-G171A.
FIG. 4 shows the thermostability curves for wild and mutant enzymes after storage at 60 ℃ for wt maiA-G27A-G171A.
FIG. 5 is a bar graph of relative enzyme activities at 45 ℃ for wild enzyme and mutant enzyme, wt. maiA-G27A-G171A.
FIG. 6 shows the wild enzyme and mutant enzyme in the whole cell catalysis of the double-enzyme recombinant bacteria, wt. is maiA-G27A-G171A-aspA.
Detailed Description
Definition of enzyme activity (U): the amount of enzyme required to convert maleic acid to 1mmol/L fumaric acid per minute was defined as 1U.
Specific enzyme activity (U/mg): enzyme activity per mg of MaiA.
Definition of relative (residual) enzyme activity: the wild enzyme and the mutant enzyme were reacted at 40 ℃ for 30 minutes in 50mM potassium sodium phosphate buffer solution at pH 8.0, and the amount of the product produced was determined, and defined as 100% based on the amount produced by the wild enzyme.
LB culture medium: 10g/L of peptone, 5g/L of yeast extract and 10g/L of NaCl.
Maleic acid cis-trans isomerase reaction system: substrate is 500 μ L of 1M maleic acid, 100 μ g pure enzyme is added, 250 μ L200 mM phosphate buffer solution is added, deionized water is added to 1ml, reaction is stopped at 100 ℃ after 10min reaction at a certain temperature, and the precipitate is removed by centrifugation, and the supernatant is taken to pass through a 0.22 μm membrane to be used as a sample for liquid phase determination.
Maleic acid cis-trans isomerase detection: HPLC detection is carried out by adopting Hitachi, and the mobile phase is 25mM potassium dihydrogen phosphate; the detection wavelength is 210nm, and the flow rate is 1 ml/min; the chromatographic column is a C18 column.
Determination of optimum reaction pH: and respectively measuring the enzyme activities of the wild enzyme and the mutant in buffer solutions with different pH values, calculating the relative enzyme activities, and determining the optimal reaction pH value.
Determination of optimum reaction temperature: respectively measuring the activity of the wild enzyme and the mutant enzyme under different temperature conditions, determining the relative enzyme activity and determining the optimal reaction temperature.
Determination of temperature stability: the wild enzyme and the mutant enzyme were incubated at 60 ℃ for 1 hour, 2 hours, 3 hours, and 4 hours in 50mM potassium sodium phosphate buffer (pH 8.0) and the residual enzyme activity was measured, and the temperature stability results were obtained.
Example 1
(1) Construction of mutants Q96E, A100M and Q96E-A100M:
a laboratory prophase modified plasmid pET24a-maiA-G27A-G171A (the specific construction steps of the plasmid pET24a-maiA-G27A-G171A are disclosed in the patent document with the publication number CN 106636052B) is used as a template, PCR is carried out under the conditions shown in Table 2 by using primers P1 and P4 shown in Table 1, and a recombinant plasmid pET24a-maiA-G27A-G171A-Q96E carrying a gene encoding a mutant is obtained after E.coli JM109 is transformed by a PCR product. E.coli BL21 strain was transformed with the recombinant plasmid pET24a-maiA-G27A-G171A-Q96E to obtain recombinant strain BL21/pET24 a-maiA-G27A-G171A-Q96E.
According to the same method, the recombinant plasmid pET24a-maiA-G27A-G171A-A100M is constructed by using the primers P2 and P4 in Table 1, and E.coli BL21 strain is transformed from the recombinant plasmid pET24a-maiA-G27A-G171A-A100M, so that the recombinant strain BL21/pET24a-maiA-G27A-G171A-A100M is obtained.
Coli JM109 was transformed with the PCR product by PCR using primers P3 and P4 shown in Table 1 under the conditions shown in Table 2 to obtain recombinant plasmid pET24a-maiA-G27A-G171A-Q96E-A100M carrying the gene encoding the mutant. E.coli BL21 strain is transformed by the recombinant plasmid pET24a-maiA-G27A-G171A-Q96E-A100M to obtain recombinant strain BL21/pET24 a-maiA-G27A-G171A-Q96E-A100M.
TABLE 1 primers
| P1(Q96E-F) | CACCGCGAATCGGAGGCCCGGCTGG |
| P2(A100M-F) | GGCCCGGCTGATGCAGGTGACGAAAG |
| P3(Q96E--A100M-F) | CACCGCGAATCGGAGGCCCGGCTGATGCAGGTGACGAAAG |
| P4(Q96E-A100M-R) | CGCGGCGGCCTGATTGTCTTTCG |
TABLE 2 Whole plasmid PCR amplification reaction System
| Reagent | Dosage of |
| ddH2O | 22μL |
| P1(10mmol/L)、P2(10mmol/L) | Each 1 mu L |
| pET28a-maiA | 1μL |
| Primer STAR Mas DNA polymerase | 25μL |
| In total | 50μL |
The PCR amplification reaction conditions are as follows:
the PCR product was identified by agarose gel electrophoresis. Then, the PCR product is purified and digested and transferred into competent cells of Escherichia coli BL 21.
(2) Recombinant Escherichia coli BL21/pET24a-maiA-G27A-G171A-Q96E, BL21/pET24a-maiA-G27A-G171A-A100M and BL21/pET24a-maiA-G27A-G171A-Q96E-A100M were inoculated in 5mL LB medium (peptone 10G/L, yeast extract 5G/L, NaCl 10G/L) with kanamycin concentration of 100. mu.g/mL, respectively, and cultured overnight with shaking at 37 ℃ and 200 r/min.
The overnight culture was inoculated at 2% (v/v) into 200mL of 2YT expression medium (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L) containing 100. mu.g/mL kanamycin, and cultured at 37 ℃ and 200r/min with shaking until OD is reached600When the concentration is 0.6-0.8, adding inducer IPTG to 0.2mM, inducing at 37 deg.C for 14-16h to obtain thallus, and centrifuging at 6000rpm to collect thallus.
(3) The recombinant cells were dissolved in 20mL of binding buffer (50mmol/L Na)2HPO4、50mmol/L NaH2PO4500mmol/L NaCl, 20mmol/L imidazole), sonicated, centrifuged at 13000rpm for 30min, and the supernatant filtered through a 0.22 μm filter. Equilibrating 1mL His Trap HP column with 10 column volumes of binding buffer, washing off non-specifically adsorbed proteins with 15 column volumes of binding buffer, and eluting proteins linearly with 27 column volumes of 20-500mmol/L imidazole bufferSamples were collected and characterized by SDS-PAGE analysis. Wherein lanes 1, 2, 3 correspond to mutants of maiA-G27A-G171A-Q96E, maiA-G27A-G171A-A100M, and maiA-G27A-G171A-Q96E-A100M, respectively (FIG. 1).
Example 2
Mu.g of the mutant enzyme purified in example 1 was added to a reaction system containing 250. mu. L, pH ═ 8.0 PBS buffer, 500. mu.L of the substrate maleic acid was added, and 1ml of water was added thereto, and the reaction was carried out at 30 ℃ C, 35 ℃ C, 40 ℃ C, 45 ℃ C, 50 ℃ C, and 55 ℃ C for 10min, respectively, to determine the corresponding enzyme activity.
As shown in FIG. 2, the optimum reaction temperature of the mutant enzyme is 45 ℃, the enzyme activity of the mutant enzyme is maintained at more than 80% under the conditions of 40 ℃ and 50 ℃.
Example 3
PBS buffer solutions of different pH were prepared: 1/15mM phosphate buffer, pH 6.5-9.0. Respectively reacting the wild enzyme and the mutant enzyme in buffer solutions with different pH values at 45 ℃ for 10min, and then measuring the enzyme activity.
As shown in fig. 3, the enzyme activity was highest at pH 8.0, defined as 100%, and the mutant enzyme activity was maintained at 90% or higher at pH 7.5 and 8.5.
Example 4
The wild enzyme and the mutant enzyme were separately collected at 100. mu.g in 250. mu.L of PBS buffer (pH 8.0), stored in a metal bath at 60 ℃ for 1h to 5h, sampled, and the residual enzyme activity was measured.
As shown in FIG. 4, it was found that the residual enzyme activity of the mutant enzyme was increased from 48.66% of the wild enzyme to 81.12% after the mutant was treated at 60 ℃ for 4 hours.
Example 5
To 250. mu.L of a reaction system (pH 8.0), 100. mu.g of the mutant enzymes Q96E-A100M, Q96E and A100M purified in example 1 were added, 500. mu.L of a substrate maleic acid (pH 8.0) was added, and 1ml of water was added to the reaction system, followed by reaction at 45 ℃ for 10min and inactivation at 100 ℃ for 10 min.
As shown in FIG. 5, it was found that after 10min of reaction at 45 ℃, the wild-type enzyme activity was: 42.35 +/-0.52U/mg, the specific enzyme activity of the mutant Q96E-A100M is about 99.5 percent of that of the wild type, and the specific enzyme activity of the mutant A100M is about 117.08 percent of that of the wild type.
Example 6
Maleic acid was prepared at substrate concentrations of 3mM, 5mM, 10mM, 20mM, 30mM, 40mM, 50mM, 60mM, 70mM, and 80mM, and the catalytic reaction was conducted to detect the product formation rate, and data fitting was conducted using Prism 8 software to determine KmValue sum KcatThe value is obtained. The kinetic parameters of the wild-type enzyme and the mutant enzyme were analyzed, and as a result, K was found to be shown in Table 3mValue sum KcatThere was no large change in the values.
Table 3 wild enzyme (WT) and mutant kinetic parameters.
Example 7
(1) Construction of recombinant plasmid pRSFDuet-1-RRBS-maiA-G27A-G171A-Q96E-A100M-aspA
Similar to example 1, the construction method of pRSFDuet-1-RRBS-maiA-G27A-G171A-Q96E-A100M-aspA is that pRSFDuet-1-RRBS-maiA-G27A-G171A-aspA constructed in the previous laboratory (the plasmid pRSFDuet-1-RRBS-maiA-G27A-G171A-aspA is the plasmid MA2-4(G27A-G171A) in patent publication No. CN108103120B as a template, and the PCR system is as follows:
(2) construction of recombinant bacterium BL21 delta fumA-fumC/pRSFDuet-1-RRBS-maiA- -G27A-G171A-Q96E-A100M-aspA
The recombinant strain BL21 delta fumA-fumC/pRSFDuet-1-RRBS-maiA-G27A-G171A-Q96E-A100M-aspA is constructed by taking E.coli BL21(DE3) delta fumA delta fumC (disclosed in Oenanthe stolonifera, Zhouyi, Zhouyange. recombinant Escherichia coli whole cell transformation maleic acid to efficiently synthesize fumaric acid [ J ]. 2016,35(12): 1323) 1329 as an initial strain.
(3) The recombinant strain BL21 delta fumA-fumC/pRSFDuet-1-RRBS-maiA-G27A-G171A-Q96E-A100M-aspA is fermented to produce L-aspartic acid.
The recombinant strain BL 21. delta. fumA-fumC/pRSFDuet-1-RRBS-maiA- -G27A-G171A-Q96E-A100M- -aspA was inoculated into 5mL of LB medium (peptone 10G/L, yeast extract 5G/L, NaCl 10G/L) with kanamycin concentration of 100. mu.g/mL, and cultured overnight at 37 ℃ under shaking at 200 r/min.
The overnight culture was inoculated in an amount of 2% (v/v) into 200mL of 2 XYT expression medium (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L) containing 100. mu.g/mL kanamycin, and cultured at 37 ℃ with shaking at 200r/min to OD600When the concentration is 0.6-0.8, adding inducer IPTG to 0.2mM, inducing at 37 deg.C for 14-16h to obtain thallus, and centrifuging at 6000rpm to collect thallus.
(3)50ml reaction system containing 3.2M substrate (maleic acid) and recombinant strain OD600The reaction system pH was 8.0 at 37 ℃ for 12h, samples were taken every 2h, and the L-aspartic acid content of the samples was determined.
The result is shown in FIG. 6, the transformation rate of the recombinant bacterium containing the mutant Q96E-A100M reaches 94.31% in 6 hours, 99.58% in 8 hours, and the content of L-aspartic acid is 423.8 g/L.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a maleate cis-trans isomerase mutant
<130> BAA211602A
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 750
<212> DNA
<213> Artificial sequence
<400> 1
atgagcaacc actaccgcat cggccagatc gtgcccagct ccaacaccac gatggaaacc 60
gagatcccgg cgatgctggc ggcgcgccag ctgatacgcc cggagcgttt cacctttcac 120
tccagccgca tgcgcatgaa acacgtcaat aaagaagaat tggcggcgat ggacgccgag 180
tccgatcgct gcgcgctgga gctgtccgac gcgcgggtcg acgtgctcgg ctacgcctgc 240
ctggtggcca tcatggcgat ggggctgggc taccaccgcg aatcggaggc ccggctgatg 300
caggtgacga aagacaatca ggccgccgcg ccggtcatca gcagcgccgg cgcgctggtc 360
aacggcctga aggtgatcgg cgccaaacgc atcgcgctgg tggcgcccta catgaaaccg 420
ctgacccagc tggtggtgga ctacatccag cacgaaggca tcgaggtcaa ggtatggcgc 480
gcgctggaga tcccggacaa cctcgacgtc gcgcggcacg atccggccag gctgccgggg 540
atcgtcgccg agatggactt acgcgaggtc gatgctatcg tgctgtccgc ctgcgtgcag 600
atgccttcgc tgccggccgt cccgacggtg gaggcccaaa ccggcaaacc ggtgatcacc 660
gccgccatcg ccaccactta cgcgatgctg accgcgctgg agctggaacc gatcgttccc 720
ggcgccggcg ccctgctgtc cggcgcttat 750
<210> 2
<211> 250
<212> PRT
<213> Artificial sequence
<400> 2
Met Ser Asn His Tyr Arg Ile Gly Gln Ile Val Pro Ser Ser Asn Thr
1 5 10 15
Thr Met Glu Thr Glu Ile Pro Ala Met Leu Ala Ala Arg Gln Leu Ile
20 25 30
Arg Pro Glu Arg Phe Thr Phe His Ser Ser Arg Met Arg Met Lys His
35 40 45
Val Asn Lys Glu Glu Leu Ala Ala Met Asp Ala Glu Ser Asp Arg Cys
50 55 60
Ala Leu Glu Leu Ser Asp Ala Arg Val Asp Val Leu Gly Tyr Ala Cys
65 70 75 80
Leu Val Ala Ile Met Ala Met Gly Leu Gly Tyr His Arg Glu Ser Glu
85 90 95
Ala Arg Leu Met Gln Val Thr Lys Asp Asn Gln Ala Ala Ala Pro Val
100 105 110
Ile Ser Ser Ala Gly Ala Leu Val Asn Gly Leu Lys Val Ile Gly Ala
115 120 125
Lys Arg Ile Ala Leu Val Ala Pro Tyr Met Lys Pro Leu Thr Gln Leu
130 135 140
Val Val Asp Tyr Ile Gln His Glu Gly Ile Glu Val Lys Val Trp Arg
145 150 155 160
Ala Leu Glu Ile Pro Asp Asn Leu Asp Val Ala Arg His Asp Pro Ala
165 170 175
Arg Leu Pro Gly Ile Val Ala Glu Met Asp Leu Arg Glu Val Asp Ala
180 185 190
Ile Val Leu Ser Ala Cys Val Gln Met Pro Ser Leu Pro Ala Val Pro
195 200 205
Thr Val Glu Ala Gln Thr Gly Lys Pro Val Ile Thr Ala Ala Ile Ala
210 215 220
Thr Thr Tyr Ala Met Leu Thr Ala Leu Glu Leu Glu Pro Ile Val Pro
225 230 235 240
Gly Ala Gly Ala Leu Leu Ser Gly Ala Tyr
245 250
<210> 3
<211> 750
<212> DNA
<213> Artificial sequence
<400> 3
atgagcaacc actaccgcat cggccagatc gtgcccagct ccaacaccac gatggaaacc 60
gagatcccgg cgatgctggc ggcgcgccag ctgatacgcc cggagcgttt cacctttcac 120
tccagccgca tgcgcatgaa acacgtcaat aaagaagaat tggcggcgat ggacgccgag 180
tccgatcgct gcgcgctgga gctgtccgac gcgcgggtcg acgtgctcgg ctacgcctgc 240
ctggtggcca tcatggcgat ggggctgggc taccaccgcg aatcgcaggc ccggctggcg 300
caggtgacga aagacaatca ggccgccgcg ccggtcatca gcagcgccgg cgcgctggtc 360
aacggcctga aggtgatcgg cgccaaacgc atcgcgctgg tggcgcccta catgaaaccg 420
ctgacccagc tggtggtgga ctacatccag cacgaaggca tcgaggtcaa ggtatggcgc 480
gcgctggaga tcccggacaa cctcgacgtc gcgcggcacg atccggccag gctgccgggg 540
atcgtcgccg agatggactt acgcgaggtc gatgctatcg tgctgtccgc ctgcgtgcag 600
atgccttcgc tgccggccgt cccgacggtg gaggcccaaa ccggcaaacc ggtgatcacc 660
gccgccatcg ccaccactta cgcgatgctg accgcgctgg agctggaacc gatcgttccc 720
ggcgccggcg ccctgctgtc cggcgcttat 750
<210> 4
<211> 250
<212> PRT
<213> Artificial sequence
<400> 4
Met Ser Asn His Tyr Arg Ile Gly Gln Ile Val Pro Ser Ser Asn Thr
1 5 10 15
Thr Met Glu Thr Glu Ile Pro Ala Met Leu Ala Ala Arg Gln Leu Ile
20 25 30
Arg Pro Glu Arg Phe Thr Phe His Ser Ser Arg Met Arg Met Lys His
35 40 45
Val Asn Lys Glu Glu Leu Ala Ala Met Asp Ala Glu Ser Asp Arg Cys
50 55 60
Ala Leu Glu Leu Ser Asp Ala Arg Val Asp Val Leu Gly Tyr Ala Cys
65 70 75 80
Leu Val Ala Ile Met Ala Met Gly Leu Gly Tyr His Arg Glu Ser Gln
85 90 95
Ala Arg Leu Ala Gln Val Thr Lys Asp Asn Gln Ala Ala Ala Pro Val
100 105 110
Ile Ser Ser Ala Gly Ala Leu Val Asn Gly Leu Lys Val Ile Gly Ala
115 120 125
Lys Arg Ile Ala Leu Val Ala Pro Tyr Met Lys Pro Leu Thr Gln Leu
130 135 140
Val Val Asp Tyr Ile Gln His Glu Gly Ile Glu Val Lys Val Trp Arg
145 150 155 160
Ala Leu Glu Ile Pro Asp Asn Leu Asp Val Ala Arg His Asp Pro Ala
165 170 175
Arg Leu Pro Gly Ile Val Ala Glu Met Asp Leu Arg Glu Val Asp Ala
180 185 190
Ile Val Leu Ser Ala Cys Val Gln Met Pro Ser Leu Pro Ala Val Pro
195 200 205
Thr Val Glu Ala Gln Thr Gly Lys Pro Val Ile Thr Ala Ala Ile Ala
210 215 220
Thr Thr Tyr Ala Met Leu Thr Ala Leu Glu Leu Glu Pro Ile Val Pro
225 230 235 240
Gly Ala Gly Ala Leu Leu Ser Gly Ala Tyr
245 250
Claims (10)
1. A maleic acid cis-trans isomerase mutant is characterized in that a sequence with an amino acid sequence shown as SEQ ID NO.4 is used as a parent sequence, and one or two of the 96 th site and the 100 th site of the parent sequence are replaced.
2. The mutant maleate cis-trans isomerase according to claim 1, wherein glutamic acid is substituted for glutamine at position 96 and methionine is substituted for alanine at position 100.
3. A gene encoding the maleate cis-trans isomerase mutant of claim 1 or 2.
4. A vector comprising the gene of claim 3.
5. A microbial cell expressing the maleate cis-trans isomerase mutant of claim 1 or 2 or containing the gene of claim 3.
6. The microbial cell of claim 5, wherein the host cell is Escherichia coli, Bacillus subtilis, or Pichia pastoris.
7. A method for producing L-aspartic acid by converting maleic acid into L-aspartic acid using a microbial cell expressing the mutant of the enzyme of the invention of claim 1 or 2 and the enzyme aspartase AspA.
8. The method according to claim 7, wherein the microbial cells are cultured in a culture system to OD6000.6-0.8, adding an inducer for induction for 14-16h, and collecting thalli; adding the thalli into a reaction system using maleic acid as a substrate to react for 4-12 h.
9. The method according to claim 8, wherein the concentration of the substrate in the reaction system is 3.0-4.0M, and the OD of the strain is600Reacting at 37-45 ℃ and pH of 8 +/-1, wherein the reaction temperature is 5 +/-0.5.
10. Use of the mutant maleate cis-trans isomerase of claim 1 or 2 or the microbial cell of claim 5 for the production of a product containing L-aspartic acid and/or a derivative thereof containing L-aspartic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210006581.4A CN114317510B (en) | 2022-01-05 | 2022-01-05 | Maleic acid cis-trans isomerase mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210006581.4A CN114317510B (en) | 2022-01-05 | 2022-01-05 | Maleic acid cis-trans isomerase mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317510A true CN114317510A (en) | 2022-04-12 |
| CN114317510B CN114317510B (en) | 2023-07-04 |
Family
ID=81024729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210006581.4A Active CN114317510B (en) | 2022-01-05 | 2022-01-05 | Maleic acid cis-trans isomerase mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114317510B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114934038A (en) * | 2022-05-05 | 2022-08-23 | 安徽丰原发酵技术工程研究有限公司 | Aspartase mutant and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636052A (en) * | 2016-12-06 | 2017-05-10 | 江南大学 | Thermostability transformation of maleic acid cis-trans isomerase and application thereof |
| CN108103120A (en) * | 2017-12-19 | 2018-06-01 | 江南大学 | A kind of method of dual-enzyme coupling whole-cell catalytic maleic acid synthesis L-Aspartic acid |
-
2022
- 2022-01-05 CN CN202210006581.4A patent/CN114317510B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636052A (en) * | 2016-12-06 | 2017-05-10 | 江南大学 | Thermostability transformation of maleic acid cis-trans isomerase and application thereof |
| CN108103120A (en) * | 2017-12-19 | 2018-06-01 | 江南大学 | A kind of method of dual-enzyme coupling whole-cell catalytic maleic acid synthesis L-Aspartic acid |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114934038A (en) * | 2022-05-05 | 2022-08-23 | 安徽丰原发酵技术工程研究有限公司 | Aspartase mutant and application thereof |
| CN114934038B (en) * | 2022-05-05 | 2023-09-12 | 安徽丰原发酵技术工程研究有限公司 | Mutant aspartase and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317510B (en) | 2023-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438136B (en) | Beta-glucosidase and mutant gene, amino acid sequence and application thereof | |
| CN111471668B (en) | Nitrilase mutant and application thereof in preparation of 1-cyanocyclohexylacetic acid | |
| CN110938616B (en) | Mutant of nitrile hydratase derived from hot spring thermokalite bacillus | |
| CN108070581B (en) | L-aspartate beta-decarboxylase mutant with improved enzyme activity and application thereof | |
| CN113621600B (en) | High-activity nitrile hydratase mutant and application thereof | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN114317510B (en) | Maleic acid cis-trans isomerase mutant | |
| CN113122526B (en) | Nitrile hydratase lysine mutant HBA-K1, encoding gene and application | |
| WO2020147031A1 (en) | Nitrile hydratase mutant, genetically engineered bacterium containing same, and use thereof | |
| CN115322981B (en) | Nitrile hydratase mutant and application thereof in preparation of amide compounds | |
| CN111808829B (en) | Gamma-glutamyl methylamine synthetase mutant and application thereof | |
| CN109593739B (en) | Recombinant ketoacid reductase mutant, gene, engineering bacterium and application thereof | |
| CN111057686B (en) | Alcohol dehydrogenase mutant and application thereof | |
| CN114807099B (en) | Pullulanase mutant, engineering bacterium and application thereof | |
| CN108004225B (en) | Mutant of phenylalanine aminomutase from Pantoea agglomerans | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN112481320B (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| CN112831532B (en) | Method for enzymatic synthesis of D-leucine | |
| CN112301014B (en) | Esterase mutant with improved thermal stability and application thereof | |
| CN110804602B (en) | L-aspartic acid beta-decarboxylase mutant and application thereof | |
| CN117187274B (en) | 2, 4-diaminobutyric acid acetyltransferase mutant gene and expression protein and application thereof | |
| CN115786296B (en) | Meso-diaminopimelate dehydrogenase mutant and production method thereof | |
| CN109370997B (en) | Phenylalanine aminomutase mutant | |
| CN112680425B (en) | Alcohol dehydrogenase mutant and application thereof | |
| CN112442474B (en) | Preparation method of (-) gamma-lactam |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |