CN114315939A - Light-operated fluorescent probe and preparation method and application thereof - Google Patents
Light-operated fluorescent probe and preparation method and application thereof Download PDFInfo
- Publication number
- CN114315939A CN114315939A CN202111603704.4A CN202111603704A CN114315939A CN 114315939 A CN114315939 A CN 114315939A CN 202111603704 A CN202111603704 A CN 202111603704A CN 114315939 A CN114315939 A CN 114315939A
- Authority
- CN
- China
- Prior art keywords
- chain
- fluorescent probe
- temperature
- bases
- photo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention belongs to the technical field of nucleic acid/nano particle/fluorescent probe, and particularly discloses a light-operated fluorescent probe and a preparation method and application thereof. The fluorescent probe is formed by combining a DNA double strand and noble metal nano particles; the fluorescent probe is based on double-labeled DNA and nanogold, has high sensitivity and good biocompatibility, and realizes efficient and sensitive monitoring on the temperature in cells.
Description
Technical Field
The invention belongs to the technical field of nucleic acid/nano particle/fluorescent probe, and relates to a light-operated fluorescent probe, a preparation method thereof and application thereof in cell temperature imaging.
Background
Temperature is a fundamental physical constant that allows monitoring of physiological activity within a cell, which in turn is closely related to the function of the cell, whether it is produced endogenously or exogenously to a specific site within the cell (e.g., organelles). Thus, the temperature distribution within a living cell may reflect the thermodynamic properties and functions of the intracellular components. Meanwhile, medical research shows that cytopathic effect of diseases can be represented by abnormal heat generation, so that monitoring of temperature distribution in living cells can promote better understanding of intracellular activities and establishment of a new diagnosis and treatment method.
The fluorescent signal is easy to collect and quantify and is widely applied to temperature probes. DNA has great application in the development of intracellular temperature probes because it folds and stretches temperature-dependent, while being stable and easy to program. The nano-gold has good biocompatibility and the characteristic of protecting nucleic acid loaded on the nano-gold from enzyme digestion, and is a good nucleic acid carrier. However, although nanogold has a protective effect on nucleic acid chains, the sensitivity of the nanogold can be interfered, and in addition, the temperature probe mainly takes single fluorescence as a main component, which is easy to generate false signals and interferes with the acquisition of the real temperature distribution condition of cells, so that a new temperature probe needs to be designed to monitor the temperature in the cells.
Disclosure of Invention
The invention aims to overcome the prior defects, and firstly, in order to overcome the interference of nanogold on sensitivity, a photoswitch is added to realize illumination after nanogold-loaded nucleic acid enters cells, so that a temperature probe is released, the temperature probe is prevented from being influenced by the nanogold, and the sensitivity is improved; and secondly, in order to overcome the generation of false signals, double fluorescence labels are adopted, and temperature is imaged through the ratio of two kinds of fluorescence so as to obtain more accurate information. Based on the design, the fluorescent probe based on the double-labeled DNA and the nanogold is high in sensitivity and good in biocompatibility, and the temperature in the cell can be efficiently and sensitively monitored.
A light-operated fluorescent probe is formed by combining a DNA double-chain and noble metal nano-particles, wherein the 5' end of one single-chain of the DNA double-chain is modified with sulfydryl, and the middle of the DNA double-chain is modified with a light-operated switch which is marked as an A chain; the other single chain is modified with a fluorescent acceptor group at the 5 'end and a fluorescent donor group at the 3' end, and is marked as a B chain; the chain A can be stably combined with the chain B at the temperature of 35-50 ℃; after the ultraviolet irradiation is broken, the material can be quickly separated from the B chain; the B chain is divided into three parts: a, b, a'; the chain B can form a hair clip structure, wherein a and a' are the stem part of the hair clip, and B is the ring part of the hair clip; the B chain changes between the hairpin structure and the expansion structure with the temperature within 35-50 ℃, the temperature is increased, the proportion of the hairpin structure is reduced, and the fluorescence FRET value is reduced.
The thiol group modified at the 5' end of the A chain is used for binding the noble metal nanoparticles, and can be connected by a conventional method, such as preferably: the thiol group is bound to the 5' end of the A chain by 10T bases.
The A chain needs to satisfy: can be stably combined with the B chain at the physiological temperature of 35-50 ℃, therefore, the Tm value of the AB chain needs to meet the Tm of more than 50 ℃.
Meanwhile, the A chain can be rapidly separated from the B chain after being broken by ultraviolet irradiation, and the Tm value of each part and the B chain after being broken needs to meet the requirement that the Tm is less than 15 ℃. .
The B chain needs to satisfy the Tm value in the range of 30-50 ℃ (in the temperature range, the proportion has large variation amplitude with the temperature, and further the sensitivity is high), and the temperature is set according to a and a' as the stem melting temperature of the hairpin.
The chain A of the light-operated fluorescent probe is preferably 20-23 bases, the chain B of the light-operated fluorescent probe is preferably 21-29 bases, wherein a and a' are preferably 5-7 bases, and B is preferably 11-15 bases.
The light-operated fluorescent probe is provided with at least two light-operated switches, preferably the first modification is between any two bases in the middle of 6 th to 9 th bases of an A chain, and the second modification is between any two bases in the middle of 13 th to 16 th bases of the A chain.
The light-operated fluorescent probe comprises a FRET donor: cy3 or FAM; fluorescent acceptors include FRET acceptors: cy5 or TAMRA.
The light-operated fluorescent probe is characterized in that the noble metal nanoparticles are gold nanoparticles.
The diameter of the gold nanoparticle of the light-operated fluorescent probe is 12-15 nm.
Preferably, the synthesis of the gold nanoparticles of the present invention comprises the following steps:
firstly, preparing 1% sodium citrate solution;
1.14g of trisodium citrate was taken out by a balance, dissolved in a beaker, transferred to a 100mL volumetric flask and trimmed with ultrapure water.
Step (2), preparing 0.01% HAuCl4；
99mL of ultrapure water was measured out using a measuring cylinder, placed in a 100mL Erlenmeyer flask, and 1mL 1% HAuCl was pipetted out using a pipette4Adding into the above mixture, and mixing.
Step (3), synthesizing nano gold;
100ml of 0.01 percent HAuCl4Heating to boiling (while stirring magnetically, 1030rpm), 3mL of a freshly prepared 1% trisodium citrate solution (added dropwise) are added, and after the solution has changed from deep blue to red, heating is continued for 15-20 minutes, the power is turned off and the solution is cooled to room temperature.
Step (4), purifying and quantifying the nanogold;
the solution was filtered through a 0.22 micron filter. Then, the resulting solution was centrifuged (13500rpm, 30 minutes, 4 ℃ C.), the supernatant was removed, and the resulting solution was redissolved in ultrapure water, and the absorption spectrum was measured by an ultraviolet-visible spectrophotometer, and the absorbance at 530nM was divided by 0.2176 to obtain the nanogold concentration (nM) in the solution, which was stored at 4 ℃ C.
The light-operated fluorescent probe and the light-operated switch comprise at least one of a PClinker, DMNPE and Bhc.
The second purpose of the invention is to provide a preparation method of the light-operated fluorescent probe.
The molar concentration ratio is 200-300: 1 DNA double strand: and mixing the nano-gold solution into the PBS solution, freezing until the solution is completely converted into a solid state, taking out, thawing, re-melting, centrifuging, repeating for 1-2 times, and finally re-dissolving.
The method comprises the following steps of unfreezing at room temperature, and centrifuging: 10000-.
According to the method, when the DNA double strand is prepared, the A strand and the B strand are mixed in PBS solution in equal proportion, heated for 2-5 minutes at 85-95 ℃, and then slowly cooled to room temperature to form the double strand.
The third purpose of the invention is to provide the application of the light-operated fluorescent probe, which is used for imaging the temperature in the cell.
Preferably: 80-120 μ L of 0.8-1.2nM nanogold-AB solution in DMEM medium was added to each well adsorbed with cells and incubated for at least 3 hours.
Further preferably: to each well, 100. mu.L of 1nM nanogold-AB solution in DMEM medium (filtered through a 0.22 μm filter before use) was added and incubated for 4 hours.
The invention has the beneficial effects
1. The invention provides a novel design of a fluorescence temperature probe, which has higher sensitivity.
2. The invention images cells through the designed fluorescence temperature probe and can realize light control.
Drawings
FIG. 1 is a TEM image of nanogold;
FIG. 2 shows the UV absorption spectra of nanogold and nanogold-AB chains;
FIG. 3 is a graph showing the relationship between FRET values and temperatures for fluorescent probes B1, B2, and B3;
FIG. 4 is a graph of absolute sensitivity versus temperature for fluorescent probes B1, B2, and B3;
FIG. 5 is a graph of relative sensitivity versus temperature for fluorescent probes B1, B2, and B3;
FIG. 6 is the FRET values of double-stranded and nano-gold-AB chains before and after illumination with temperature;
FIG. 7 shows the cell viability of various concentrations of nanogold-AB chain incubation;
FIG. 8 is a graph of fluorescence images of nanogold-AB chains incubated with cells for different periods of time;
FIG. 9 is a graph of fluorescence images of nanogold-AB chains at different temperatures after incubation with cells and comparison with nanogold-single chain images.
Detailed Description
The following examples are intended to illustrate the invention without further limiting it.
Example 1
Preparation and characterization of nanogold
100mL of 0.01% HAuCl4Heating to boiling (while stirring magnetically, 1030rpm), 3mL of a freshly prepared 1% trisodium citrate solution (added dropwise) are added, and after the solution has changed from deep blue to red, heating is continued for 15-20 minutes, the power is turned off and the solution is cooled to room temperature.
The solution was filtered through a 0.22 micron filter. After centrifugation (13500rpm, 30 minutes, 4 ℃), the supernatant was removed, redissolved in ultrapure water, the absorption spectrum was measured by an ultraviolet-visible spectrophotometer (FIG. 2), and the absorbance at 530nM was divided by 0.2176 to obtain the nanogold concentration (nM) in the solution, which was stored at 4 ℃ until use. The average particle size of the gold nanoparticles was determined to be 12.31 ± 0.58nm by TEM (fig. 1).
Example 2
Design and Performance determination of hairpin chain B
As the hairpin strand B is finally used in a physiological environment, it is necessary that the Tm value of the hairpin strand B is about 37 ℃, three strands are selected according to the principle, the Tm values obtained by simulation on the DINAmelt website are 31.8 (B1: CTATGTTGACTTCACGTTCATAG, see SEQ ID NO.2), 41 (B2: CGATGTTGACTTCACGTTCATCG, see SEQ ID NO.3), 43.4 (B3: CGTATGTTGACTTCACGTTCATACG, see SEQ ID NO.4), respectively, the three strands are characterized in that the loop sequences are consistent, the Tm value is reduced by reducing the base length of the hairpin stem and reducing the GC base ratio, and cy3 is modified at the 3 'end, cy5 is modified at the 5' end, and then the three strands are purchased from Biotechnology (Shanghai) limited.
There are theoretical and practical errors, so three candidate chains are also tested, with the test conditions: 100 mu L of 200nM fluorescence chain dissolved in PBS is placed in a fluorescence cuvette, the temperature of the fluorescence chain is controlled by a constant temperature groove, the detection is carried out once every 5 ℃ from 10 ℃ to 75 ℃, each detection temperature is stabilized for 5 minutes after reaching, finally, the fluorescence ratio at 665nM and 560nM is taken to draw a curve with the temperature, and the response range and the sensitivity of the curve are determined. The absolute sensitivities of B1, B2 and B3 were 0.22-0.29, 0.05-0.20 and 0.25-0.57, respectively, at 30-60 ℃. Since the sensitivity of B3 was the best of the three strands, B3 was determined for subsequent experiments (fig. 3, 4, 5).
Example 3
Design and stability testing of complementary strand A
The first design was to place a PClinker in the middle of the A chain, and the Tm of the intact AB chain was modeled to be 45.2 ℃ and the Tm of the cleaved two portions and the B chain was 21.8 ℃ and 19 ℃ respectively, which was labeled A1. First two strands are synthesized into one strand: 10 μ L of a solution containing 10 μ M A1 and 10 μ M B was prepared and dissolved in PBS, then placed in a metal bath and heated to 95 ℃ for 5 minutes, allowed to slowly cool to room temperature, and left to stand at 4 ℃ until needed.
The stability of the duplex was then tested under the following conditions: 100 mu L of a 200nM fluorescence chain dissolved in PBS is placed in a fluorescence cuvette, the temperature of the fluorescence chain is controlled by a constant temperature bath, the temperature is measured once every 5 ℃ from 10 ℃ to 75 ℃, the measurement is carried out after each measurement temperature is stable for 5 minutes, and finally the fluorescence ratio at 665nM and 560nM is taken to draw a curve with the temperature. Finally, the A1B chain is not stable enough before 37 ℃, partial dissociation occurs and can not meet the requirement, so two PClinkers are designed in the middle of the A chain, the Tm value of the complete AB chain obtained by simulation is 57.4 ℃, the Tm values of the three parts after the fragmentation and the B chain are 4.1 ℃, 6.8 ℃ and 12.1 ℃ respectively, the chain is marked as A2(CGTATGA ACGTGAA GTCAACA, see SEQ ID NO.1), and 10T are added to the 5' end of the chain for connecting sulfhydryl.
First two strands are synthesized into one strand: 10 μ L of a solution containing 10 μ M A2 and 10 μ M B was prepared and dissolved in PBS, then placed in a metal bath and heated to 95 ℃ for 5 minutes, allowed to slowly cool to room temperature, and left to stand at 4 ℃ until needed. The stability of the duplex was then tested under the following conditions: 100 μ L of a 200nM fluorescent chain dissolved in PBS was placed in a fluorescent cuvette and the temperature was controlled by a thermostatic bath starting at 10 ℃ and ending at 75 ℃ and measured every 5 ℃ and stabilizing for 5 minutes after each measurement temperature was reached, and finally the ratio of fluorescence at 665nM and 560nM was plotted against temperature (fig. 6). As can be seen from the graph, the FRET value remains below 0.5 below 50 ℃ before light irradiation, indicating that both strands are stably bound below 50 ℃.
Example 4
Determination of AB double-chain performance after ultraviolet irradiation
100 μ L of 200nM AB chain placed in a cuvette was irradiated under an ultraviolet lamp for 10 minutes and then placed on a fluorescent disc, and similarly, the temperature was controlled by a thermostatic bath starting at 10 ℃ and ending at 75 ℃ and measuring every 5 ℃ and stabilizing 5 minutes after each measurement temperature was reached, and finally the ratio of fluorescence at 665nM and 560nM was plotted against temperature (fig. 6). It can be seen from the figure that the FRET value becomes high after illumination, indicating that the B chain is separated from the cleaved a chain after illumination, and forms a hairpin structure by itself, thereby monitoring the temperature.
Example 5
Nanogold-AB duplex stability test
60 mu L of 50 mu M AB double strand and 1mL of 10nM nano gold are mixed, placed in a refrigerator at-20 ℃, taken out after 2 hours, placed at normal temperature for thawing, then centrifuged (13500rpm, 30 minutes, 4 ℃), supernatant removed, re-dissolved with 0.3M PBS (300mM NaCl in PBS), then centrifuged twice, re-dissolved with PBS and stored at 4 ℃ for later use. The ultraviolet absorption spectrum was measured.
Testing the stability of the nanogold-AB chain: 100 mu L of 1nM nanogold-AB solution dissolved in PBS is placed in a fluorescence cuvette, the temperature is controlled by a constant temperature bath, the temperature is measured from 10 ℃ to 75 ℃ once every 5 ℃, the measurement is performed after each measurement temperature is stabilized for 5 minutes, and finally the ratio of fluorescence at 665nM and 560nM is taken to draw a curve with the temperature (figure 6). As can be seen, below 50 ℃ both have lower FRET values, similar to the results before double strand illumination, indicating very stable binding of the two strands.
Example 6
Nano gold-AB double-chain performance measurement after illumination
100 μ L of 1nM nanogold-AB solution placed in a cuvette was irradiated under an ultraviolet lamp for 10 minutes, and then placed in a fluorescent disc, and similarly, the temperature was controlled by a constant temperature bath, starting from 10 ℃ and ending at 75 ℃, and measured every 5 ℃ and stabilized for 5 minutes after each measured temperature was reached, and finally the fluorescence ratio at 665nM and 560nM was plotted against the temperature (fig. 6). As can be seen from the figure, the FRET value is increased after illumination, which indicates that the B chain is separated from the A chain, and the B chain and the A chain form a hairpin, thereby monitoring the temperature.
Example 7
Nanogold-AB chain cell biocompatibility test
The synthesized nanogold-AB was tested for cytotoxicity using the CCK-8 method. 1. mu.L of 8000 MCF-7 cell suspensions were added to 15 wells of a 96-well plate, and the plate was incubated in an incubator for 24 hours (37 ℃, 5% CO)2). 2. To the wells of the plate, 10. mu.L of PBS, 10. mu.L of 1nM nanogold-AB solution, 10. mu.L of 2nM nanogold-AB solution, 10. mu.L of 5nM nanogold-A2B solution, and 10. mu.L of 10nM nanogold-AB solution were added, respectively. Incubate in incubator for 24 h. 3. To each well was added 10. mu.L of CCK-8 solution and incubated for 4 hours in an incubator. 4. The absorbance at 450nm was measured by a microplate reader to calculate the cell survival rate.
Cell survival rate ═ (OD experimental group-OD negative control group)/(OD blank group-OD negative control group).
The results show (figure 7), under the condition of 24 hours of co-incubation, the survival rate of MCF-7 cells is kept above 90% by adding the nanogold-AB solution with different concentrations, which shows that the nanogold-AB has good biocompatibility and can be used for cell incubation.
Example 8
Determination of optimal time for incubation of Nanogold-AB chains with cells
Cells were incubated with 1nM nanogold-AB solution and the optimal time for incubation with cells was first determined. 1. And (3) a plate. The digested cells were shaken up, the number of cells was determined using a cell counting plate, the cell suspension was diluted so that about 8000 cells were contained per 100. mu.L of the suspension, and then 100. mu.L of the suspension was added to a 96-well plate, and the plate was left in an incubator for 24 hours. 2. And (4) co-incubation. The wells were first washed twice with PBS, after which 100. mu.L of 1nM nanogold-AB solution in DMEM medium was added to the wells (filtered through 0.22 μm filter before use) and incubated for 0, 0.5, 1, 2, 4, 8 hours, respectively. 3. High content imaging. The wells were first washed twice with PBS, after which 100 μ L PBS solution was added to each well and high content imaging was performed on each well. According to the imaging results (fig. 8), after 4 hours of co-incubation, the fluorescence did not increase any more, so the optimal incubation time was determined to be 4 hours.
Example 9
Intracellular performance determination of nanogold-AB chain
And testing the imaging condition of the nanogold-AB at different temperatures in the cell. 1. And (3) a plate. The digested cells were shaken up, the number of cells was determined using a cell counting plate, the cell suspension was diluted so that about 8000 cells were contained per 100. mu.L of the suspension, and then 100. mu.L of the suspension was added to a 96-well plate, and the plate was left in an incubator for 24 hours. 2. And (4) co-incubation. The wells were first washed twice with PBS, after which 100. mu.L of 1nM nanogold-AB solution in DMEM medium (filtered through a 0.22 μm filter before use) was added and incubated for 4 hours. 3. High content imaging. The wells were first washed twice with PBS, then 100. mu.L of PBS solution was added to each well, and the temperature was adjusted stepwise to 25, 37, 39 and 41 ℃ for high content imaging of the wells. As can be seen from FIG. 9, the fluorescence in the cell changes with the change of the external temperature, which indicates that the probe (overlap) designed by the present invention can monitor the temperature change of the cell. Compared with a nanogold + single chain (the B chain is connected to the nanogold through a 5 'end sulfydryl and 10T, and the 3' end is modified with cy3 shown in SEQ ID NO.5), the invention has higher sensitivity.
The individual strand sequences used in the examples of the invention are as follows:
in conclusion, the invention designs a light-controllable ratiometric fluorescent probe based on nanogold and nucleic acid, which is used for intracellular imaging. Firstly, designing an A chain and a B chain, determining the stability and the light control activity of the A chain and the B chain, then testing the stability and the light control activity of the nanogold-AB, then testing the biocompatibility of the compound to cells, determining the optimal incubation time, and finally checking that the probe has a better imaging effect by adjusting the external temperature.
The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.
Sequence listing
<110> university of south-middle school
<120> light-operated fluorescent probe and preparation method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgtatgaacg tgaagtcaac a 21
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctatgttgac ttcacgttca tag 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgatgttgac ttcacgttca tcg 23
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgtatgttga cttcacgttc atacg 25
<210> 5
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tttttttttt cgtatgttga cttcacgttc atacg 35
Claims (11)
1. A light-operated fluorescent probe is characterized in that the fluorescent probe is formed by combining a DNA double-chain and noble metal nano-particles, wherein the 5' end of one single-chain of the DNA double-chain is modified with sulfydryl, and the middle of the DNA double-chain is modified with a light-operated switch which is marked as an A chain; the other single chain is modified with a fluorescent acceptor group at the 5 'end and a fluorescent donor group at the 3' end, and is marked as a B chain; the chain A can be stably combined with the chain B at the temperature of 35-50 ℃; after the ultraviolet irradiation is broken, the material can be quickly separated from the B chain; the B chain is divided into three parts: a, b, a'; the chain B can form a hair clip structure, wherein a and a' are the stem part of the hair clip, and B is the ring part of the hair clip; the B chain changes between the hairpin structure and the expansion structure with the temperature within 35-50 ℃, the temperature is increased, the proportion of the hairpin structure is reduced, and the fluorescence FRET value is reduced.
2. The photo-controlled fluorescent probe according to claim 1, wherein the A chain is preferably 20 to 23 bases, the B chain is preferably 21 to 29 bases, wherein a and a' are preferably 5 to 7 bases, and B is preferably 11 to 15 bases.
3. The photo-controlled fluorescent probe according to claim 1, wherein the photo-controlled switch is provided with at least two, preferably the first modification is between any two bases in the 6 th to 9 th bases of the A chain, and the second modification is between any two bases in the 13 th to 16 th bases of the A chain.
4. The photo-controlled fluorescent probe of claim 1, wherein the fluorescent donor comprises a FRET donor: cy3 or FAM; fluorescent acceptors include FRET acceptors: cy5 or TAMRA.
5. The optically controlled fluorescent probe of claim 1, wherein the noble metal nanoparticles are gold nanoparticles.
6. The optically controlled fluorescent probe of claim 5, wherein the gold nanoparticles have a diameter of 12-15 nm.
7. The photo-controlled fluorescent probe of claim 1, wherein the photo-controlled switch comprises at least one of a PClinker, DMNPE, Bhc.
8. The method for preparing a light-operated fluorescent probe as set forth in any one of claims 1 to 7,
the molar concentration ratio is 200-300: 1 DNA double strand: and mixing the nano-gold solution into the PBS solution, freezing until the solution is completely converted into a solid state, taking out, thawing, re-melting, centrifuging, repeating for 1-2 times, and finally re-dissolving.
9. The method of claim 8, wherein thawing is performed at room temperature, and the centrifugation conditions are: 10000-.
10. The method of claim 8, wherein the double strand DNA is prepared by mixing the A and B strands in equal proportion in PBS, heating at 85-95 deg.C for 2-5 min, and slowly cooling to room temperature to form double strands.
11. Use of the photo-controlled fluorescent probe according to any of claims 1 to 7 for imaging intracellular temperature.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111603704.4A CN114315939B (en) | 2021-12-24 | 2021-12-24 | Light-operated fluorescent probe and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111603704.4A CN114315939B (en) | 2021-12-24 | 2021-12-24 | Light-operated fluorescent probe and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114315939A true CN114315939A (en) | 2022-04-12 |
| CN114315939B CN114315939B (en) | 2023-09-15 |
Family
ID=81012499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111603704.4A Active CN114315939B (en) | 2021-12-24 | 2021-12-24 | Light-operated fluorescent probe and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114315939B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6730478B1 (en) * | 1998-09-07 | 2004-05-04 | The Secretary Of State For Defence In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland | Method of monitoring the temperature of a biochemical reaction |
| JP2009014369A (en) * | 2007-07-02 | 2009-01-22 | Kyushu Univ | Fluorescence reagent for labeling biomolecule |
| CN107881218A (en) * | 2017-11-23 | 2018-04-06 | 中国科学院合肥物质科学研究院 | A kind of spherical nucleic acid fluorescent probe for telomerase activation detection and its production and use |
| CN112301106A (en) * | 2020-10-30 | 2021-02-02 | 南京师范大学 | DNA-AuNP probe of DNA modified gold nanoparticles with photo-thermal response and preparation method and application thereof |
-
2021
- 2021-12-24 CN CN202111603704.4A patent/CN114315939B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6730478B1 (en) * | 1998-09-07 | 2004-05-04 | The Secretary Of State For Defence In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland | Method of monitoring the temperature of a biochemical reaction |
| JP2009014369A (en) * | 2007-07-02 | 2009-01-22 | Kyushu Univ | Fluorescence reagent for labeling biomolecule |
| CN107881218A (en) * | 2017-11-23 | 2018-04-06 | 中国科学院合肥物质科学研究院 | A kind of spherical nucleic acid fluorescent probe for telomerase activation detection and its production and use |
| CN112301106A (en) * | 2020-10-30 | 2021-02-02 | 南京师范大学 | DNA-AuNP probe of DNA modified gold nanoparticles with photo-thermal response and preparation method and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| DAVID A. HASTMAN, 等: "Femtosecond Laser Pulse Excitation of DNA-Labeled Gold Nanoparticles: Establishing a Quantitative Local Nanothermometer for Biological Applications", ACS NANO 2020, vol. 14, no. 07, pages 8570 * |
| ZHIWEI DENG，等: "A light-controlled DNA nanothermometer for temperature sensing in the cellular membrane microenvironment", BIOSENSORS AND BIOELECTRONICS, vol. 216, pages 114627 * |
| 杨艳婧: "基于金纳米颗粒的荧光核酸探针用于细胞内传感", 中国博士学位论文全文数据库 (工程科技Ⅰ辑), no. 06, pages 014 - 223 * |
| 柯国梁: "DNA纳米材料的设计及其在生物传感和蛋白质机器中的应用", 厦门大学博士学位论文, pages 1 - 135 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114315939B (en) | 2023-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peng et al. | Development of a highly selective, sensitive, and fast response upconversion luminescent platform for hydrogen sulfide detection | |
| Pallaoro et al. | Mapping local pH in live cells using encapsulated fluorescent SERS nanotags | |
| Yu et al. | Saccharomyces-derived carbon dots for biosensing pH and vitamin B 12 | |
| Qin et al. | Bright and photostable organic fluorescent dots with aggregation‐induced emission characteristics for noninvasive long‐term cell imaging | |
| Tao et al. | In vivo NIR fluorescence imaging, biodistribution, and toxicology of photoluminescent carbon dots produced from carbon nanotubes and graphite | |
| Gao et al. | Copper (II)-mediated fluorescence of lanthanide coordination polymers doped with carbon dots for ratiometric detection of hydrogen sulfide | |
| Ju et al. | Proton-controlled synthesis of red-emitting carbon dots and application for hematin detection in human erythrocytes | |
| Li et al. | Luminescence ratiometric nanothermometry regulated by tailoring annihilators of triplet–triplet annihilation upconversion nanomicelles | |
| CN107033886A (en) | With being catalyzed and indicate difunctional fluorescent carbon point and its preparation method and application | |
| CN113135969B (en) | Two-photon fluorescent probe for detecting pH by taking chitosan as skeleton and preparation method and application thereof | |
| Li et al. | Toxicity assessment and long-term three-photon fluorescence imaging of bright aggregation-induced emission nanodots in zebrafish | |
| CN106085420A (en) | A kind of peptide modified gold nanoclusters and preparation method thereof | |
| Anees et al. | A protein–dye hybrid system as a narrow range tunable intracellular pH sensor | |
| Lu et al. | A novel dual response ratiometric fluorescent probe for the determination of H 2 O 2 and glucose via etching of silver nanoparticles | |
| Wang et al. | A fluorometric sensing method for sensitive detection of trypsin and its inhibitor based on gold nanoclusters and gold nanoparticles | |
| Khattab et al. | Green metallochromic cellulose dipstick for Fe (III) using chitosan nanoparticles and cyanidin-based natural anthocyanins red-cabbage extract | |
| Zheng et al. | Probing pH variation in living cells and assaying hemoglobin in blood with nitrogen enriched carbon dots | |
| Pichardo-Molina et al. | Fluorescent carbon nanoparticles synthesized from bovine serum albumin nanoparticles | |
| Lu et al. | Colorimetric and turn-on fluorescence determination of mercury (II) by using carbon dots and gold nanoparticles | |
| CN114540022A (en) | Preparation of cellulose-based carbon quantum dot and application of cellulose-based carbon quantum dot in uric acid detection | |
| CN114315939A (en) | Light-operated fluorescent probe and preparation method and application thereof | |
| Cao et al. | Construction of multicolor fluorescence hydrogels based on the dual-emission CDs@ SiO2/AuNCs for alternative visual recognition of copper ions and glutathione | |
| Meng et al. | Strategy to synthesize long-wavelength emission carbon dots and their multifunctional application for pH variation and arginine sensing and bioimaging | |
| Chen et al. | Natural biomass carbon Dots-Based fluorescence sensor for high precision detection of vitamin B12 in serum | |
| Tang et al. | Liquid core fluorescent organic nanoprobes: Long-term stability and highly selective lipid droplets bio-imaging |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |