CN114306317B - Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug - Google Patents
Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug Download PDFInfo
- Publication number
- CN114306317B CN114306317B CN202111607950.7A CN202111607950A CN114306317B CN 114306317 B CN114306317 B CN 114306317B CN 202111607950 A CN202111607950 A CN 202111607950A CN 114306317 B CN114306317 B CN 114306317B
- Authority
- CN
- China
- Prior art keywords
- scutellarin
- novel coronavirus
- methylation
- 3clpro
- derivative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides an application of scutellarin methylation derivative in preparing a novel coronavirus prevention and/or treatment drug, and belongs to the technical field of biological medicines. The scutellarin methylation derivative can inhibit the activity of 3C-like protease (3 CLP) of the novel coronavirus, thereby inhibiting the proliferation of the novel coronavirus, relieving the immune imbalance in infected host cells, and further achieving the effect of preventing and/or treating diseases caused by the novel coronavirus.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to application of scutellarin methylation derivatives in preparation of novel coronavirus prevention and/or treatment medicines.
Background
Viruses are highly infectious pathogens that are serious hazards to human health. Incomplete statistics indicate that about 75% of epidemic infections are caused by viral infections. In recent years, viral genomic variations and the emergence of new viral strains frequently cause pandemic of infectious diseases: such as SARS-CoV in 2003 and H in 2009 1 N 1 MERS-CoV, 2012, H, 2013 7 N 9 And SARS-CoV-2, which has exploded at the end of 2019. At present, the types of antiviral drugs are limited and have certain toxic and side effects, and along with the appearance of novel variant strains and drug-resistant strains, the research of the antiviral drugs with high efficiency, low toxicity and resistance is urgent.
The traditional Chinese medicine and the natural medicine have the characteristics of multicomponent, multi-way and multi-target effect, have unique advantages in the aspect of antivirus, and are not easy to generate drug resistance. The flavone is one of the active ingredients of various traditional Chinese medicines and natural medicines, and has various activities of anti-inflammatory, antibacterial, antivirus, blood sugar reducing, blood fat reducing, antioxidant, immunoregulation and the like. At present, a great deal of researches show that flavonoid compounds have the effect of resisting various viruses, including influenza virus, hepatitis B virus, coxsackie virus and the like, and the effect is remarkable.
Scutellarin (scutellarin) is an active monomer component separated from herba Erigerontis, herba Polygoni Cuspidati, semen Oroxyli, etc. with antiinflammatory and analgesic effects, and has anticancer, neuroprotective and antiinflammatory effects. The scutellarin has been reported in literature to inhibit Src kinase, NF- κB and macrophage activation, and scutellarin can inhibit hypoxia-induced vascular endothelial cell proliferation and vascular endothelial growth factor expression, thereby helping to alleviate diabetic microvascular complications, i.e. diabetic retinopathy.
There is no report in the prior art that scutellarin methylated derivatives are used against novel coronaviruses.
Disclosure of Invention
The invention aims to provide an application of a scutellarin methylation derivative in preparing a medicament for preventing and/or treating novel coronaviruses, wherein the scutellarin methylation derivative can effectively inhibit the activity of 3C-like protease (3 CLP) of the novel coronaviruses, and can be used for preparing the medicament for preventing and/or treating the novel coronaviruses.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides application of scutellarin methylation derivatives in preparation of medicines for preventing and/or treating novel coronaviruses.
The invention provides application of scutellarin methylation derivatives in preparing enzyme inhibitors for preventing and/or treating novel coronaviruses.
The invention provides application of scutellarin methylation derivatives in preparing 3C-like protease inhibitors for preventing and/or treating novel coronaviruses.
Preferably, the chemical structural formula of the scutellarin methylation derivative is shown as formula I:
wherein the R is 1 Selected from hydrogen or methyl;
the R is 2 Selected from hydrogen or methyl;
the R is 3 Selected from hydrogen or methyl;
the R is 4 Selected from hydrogen or methyl.
Preferably, the scutellarin methylation derivative comprises one or more of homoplantain, salicifolicin, 4' -O-methyl scutellarin, 6, 7-dihydroxy-5, 4' -dimethoxy flavone, salvinin and 5,6,7,4' -tetramethoxy flavone.
Preferably, the scutellarin methylated derivatives comprise 4 '-O-methyl scutellarin and/or 6, 7-dihydroxy-5, 4' -dimethoxy flavone.
According to the application of the scutellarin methylation derivative, the scutellarin methylation derivative is used as the only active ingredient and is applied to preparing a medicament for preventing and/or treating novel coronavirus infection; or the combination of the scutellarin methylation derivative and other antiviral drugs is used as an active ingredient to prepare the novel coronavirus infection prevention and/or treatment drug.
In another aspect, the present invention provides a pharmaceutical composition for preventing and/or treating a novel coronavirus infection, comprising a scutellarin methylated derivative; preferably, the scutellarin methylated derivative is as described in formula I.
In the technical scheme of the invention, the pharmaceutical composition also comprises pharmaceutically acceptable auxiliary materials.
In the technical scheme of the invention, the dosage form of the pharmaceutical composition is an oral preparation, a pulmonary inhalation preparation, a mucous membrane administration preparation or an injection; preferably, the dosage form is an oral formulation; more preferably, the oral formulation is selected from the group consisting of granules, powders, pills, tablets, capsules, and oral liquids.
The inventor finds out the new application of the scutellarin methylation derivative through a large number of researches, and the scutellarin methylation derivative can be combined with the 3C-like protease of the novel coronavirus, so that the virus replication can be inhibited.
Compared with the prior art, the invention has the following technical effects:
the scutellarin methylation derivative can obviously inhibit the 3C-like protease activity of the novel coronavirus at the enzyme level, thereby inhibiting the virus replication and further achieving the effect of preventing and/or treating the novel coronavirus infection.
The scumethylation derivative is synthesized by using commercial scutellarin, has a simple preparation method, is easy to obtain reaction raw materials, and is suitable for industrialized/large-scale production.
Drawings
FIG. 1 is a diagram showing the IC of 4' -O-methyl scutellarin against novel coronavirus 3CLPro 50 A value fitting map;
FIG. 2 is a graph showing the IC of 6, 7-dihydroxy-5, 4' -dimethoxyflavone against novel coronavirus 3CLPro 50 A value fitting map;
FIG. 3 shows the IC of scutellarin against novel coronavirus 3CLPro 50 The values fit the graph.
Detailed Description
The invention provides application of scutellarin methylation derivatives in preparation of medicines for preventing and/or treating novel coronaviruses.
The invention also provides application of the scutellarin methylation derivative in preparing a novel coronavirus enzyme inhibitor for preventing and/or treating.
The invention also provides application of the scutellarin methylation derivative in preparing a 3C-like protease inhibitor for preventing and/or treating novel coronaviruses.
In the invention, the chemical structural formula of the scutellarin methylation derivative is preferably shown as a formula I:
wherein the R is 1 Selected from hydrogen or methyl; the R is 2 Selected from hydrogen or methyl; the R is 3 Selected from hydrogen or methyl; the R is 4 Selected from hydrogen or methyl.
In the present invention, the scutellarin methylation derivative comprises one or more of homoplantain, salicifolium, 4' -O-methyl scutellarin, 6, 7-dihydroxy-5, 4' -dimethoxy flavone, carnosol and 5,6,7,4' -tetramethoxy flavone.
Preferably, the scutellarin methylated derivatives comprise 4 '-O-methyl scutellarin and/or 6, 7-dihydroxy-5, 4' -dimethoxy flavone.
Polyproteins (PP) PP1a and PP1b are critical for maintaining the synthesis of coronavirus RNA, whereas maturation of the polyproteins requires a series of cleavage processes to produce a multi-subunit protein complex (known as a "viral replication transcriptase"). The main proteases (Mpro) of the multi-subunit protein complex are 3C-like protease (3C-like protease,3 CLP) and papain-like cysteine protease (papain-like cysteine protease, PLP), 3CLP and PLP are highly coordinated to catalyze the cleavage of polyprotein, and loss of 3CLP and PLP activity can lead to the cessation of coronavirus life-cycle.
The novel coronavirus enters cells by means of spike recognition receptor ACE2, and two key proteases involved in the proteolytic process of the novel coronavirus are 3C-like protease and papain-like protease respectively. Therefore, the small molecule inhibitor aiming at the 3C-like protease as a target spot can be applied to the preparation of medicaments for preventing and/or treating novel coronavirus infection.
In the present invention, the scutellarin methylated derivatives are capable of inhibiting the 3CLP activity of the novel coronavirus, thereby inhibiting the activity and proliferation of the novel coronavirus and alleviating the immune imbalance in infected host cells. In the present invention, the scutellarin methylated derivatives which exert inhibitory activity on 3CLP depend on their flavone parent nucleus.
The technical scheme of the present invention will be clearly and completely described in the following in connection with the embodiments of the present invention. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
1. Synthesis of scutellarin methylated derivatives
The inventor takes commercial scutellarin as a starting material to complete the chemical synthesis of scutellarin methylation derivatives. The chemical synthesis route is as follows:
1.1 Synthesis of scutellarin
200mL of absolute methanol was added to a 500mL round bottom flask, and SOCl was slowly added dropwise under ice bath 2 (7.25 mL,100 mmol) and ice bath were removed after the addition, and stirring was continued for 1h at room temperature. Scutellarin 8 (4.62 g,10 mmol) was then added and stirred at room temperature for 9h, followed by TLC (V) Acetic acid ethyl ester :V Isopropyl alcohol :V Water and its preparation method =4:2:1) reaction was complete. Directly filtering to obtain scutellarin methyl ester 9 (4.67 g, 98%); 1 H-NMR(400MHz,DMSO-d 6 )δ12.85(s,1H),10.39(s,1H),7.93(d,J＝9.0Hz,2H),7.00(s,1H),6.94(d,J＝9.0Hz,2H),6.81(s,1H),5.28(d,J＝7.0Hz,1H),4.20(d,J＝6.0Hz,1H),3.70-3.90(m,3H,),3.68(s,3H)； 13 C-NMR(125MHz,DMSO-d 6 ):δ182.8,169.7,164.5,161.6,151.3,149.4,147.3,130.8,128.9,121.7,116.4,106.3,102.9,100.2,93.9,75.7,75.4,73.1,71.8,52.4。
in a 250mL round bottom flask, compound 9 (4.07 g,8.55 mmol) was suspended in a mixture of 135mL ethanol and 18.8mL water and 18.8mL concentrated sulfuric acid was added dropwise with stirring at room temperature. After completion of the dropwise addition, the mixture was refluxed overnight at 100℃and TLC (V) Dichloromethane (dichloromethane) :V Methanol =20:1) detect the disappearance of starting material. Naturally cooling to room temperature, washing with water, extracting with ethyl acetate (100 mL×3), washing with saturated saline, drying with anhydrous sodium sulfate, concentrating, and recrystallizing with anhydrous ethanol to obtain scutellarin 1 (2.22 g, 91%); 1 H NMR(400MHz,DMSO-d 6 )δ12.79(s,1H),10.56(s,1H),10.38(s,1H),8.76(s,1H),7.91(d,J＝8.6Hz,3H),6.92(d,J＝8.6Hz,3H),6.75(s,1H),6.60(s,1H)。
1.2 Synthesis of homoplantagin
Compound 9 (3.81 g,8.0 mmol) was dissolved in 50mL DMF in a 250mL round bottom flask and anhydrous potassium carbonate (1.66 g,12.0 mmol) was added with stirring at room temperature. Methyl iodide (0.59 mL,8.4 mmol) was added dropwise under nitrogen, stirred overnight at room temperature, TLC (V) Dichloromethane (dichloromethane) :V Methanol =20:1) detect the disappearance of starting material. Pouring the reaction system into 50mL ice water, extracting with ethyl acetate (25 mL×3), washing with saturated saline, drying with anhydrous sodium sulfate, concentrating, and performing dry column chromatography to obtain compound 10 (1.73 g, 44%); 1 H NMR(400MHz,DMSO-d 6 )δ12.98(s,1H),10.42(s,1H),7.95(d,J＝7.8Hz,2H),7.07(s,1H),6.95(d,J＝8.1Hz,2H),6.86(s,1H),5.62(d,J＝3.9Hz,1H),5.52(d,J＝5.3Hz,1H),5.36(d,J＝4.9Hz,2H),4.20(d,J＝9.1Hz,1H),3.76(s,3H),3.66(s,3H)； 13 C-NMR(125MHz,DMSO-d 6 ):δ182.33,169.22,164.38,161.38,155.94,152.68,152.13,132.53,128.59,121.11,116.02,105.92,102.77,99.39,93.91,75.67,75.30,72.81,71.34,60.33,52.03。
in a 250mL round bottom flask, compound 10 (4.19 g,8.55 mmol) was suspended in a mixture of 135mL ethanol and 18.8mL water and 18.8mL concentrated sulfuric acid was added dropwise with stirring at room temperature. Reflux overnight at 100deg.C after the completion of the dropwise addition, TLC (V) Dichloromethane (dichloromethane) :V Methanol =20:1) detect the disappearance of starting material. Naturally cooling to room temperature, washing with water, extracting with ethyl acetate (100 mL×3), washing with saturated saline, drying with anhydrous sodium sulfate, concentrating, and performing column chromatography to obtain homoplantain 2 (2.33 g, 90%); 1 H-NMR(400MHz,DMSO-d 6 )δ13.05(s,1H),10.72(s,1H),10.37(s,1H),7.92(d,J＝8.5Hz,2H),6.92(d,J＝8.5Hz,2H),6.77(s,1H),6.59(s,1H),3.74(s,3H)； 13 C-NMR(125MHz,DMSO-d 6 ):δ182.18,163.86,161.20,157.28,152.81,152.43,131.38,128.51,121.25,116.00,104.12,102.41,94.28,60.00。
1.3 Synthesis of Liuyan flavin
Scutellarin methyl ester 9 (1.61 g,3.38 mmol) was suspended in anhydrous DMF 25mL, anhydrous potassium carbonate (1.40 g,10.14 mmol) was added under nitrogen protection, stirred at room temperature for 10min, and methyl iodide (0.50 mL,8.11 mmol) was injected. Stir overnight at room temperature, TLC (V Dichloromethane (dichloromethane) ∶V Methanol =10: 1) Detection showed complete reaction. The reaction mixture was poured into 50mL of 1M hydrochloric acid, extracted with ethyl acetate (50 mL. Times.2), and the organic phases were combined, washed with 100mL of saturated brine, and dried over anhydrous sodium sulfate. Column chromatography was concentrated under reduced pressure to give 11 (1.43 g, 84%) as a yellow solid. 1 H-NMR(400MHz,DMSO-d 6 )δ12.95(s,1H),8.06(d,J＝8.8Hz,2H),7.15(d,J＝8.8Hz,2H,7.11(s,1H),6.97(s,1H),5.68(d,J＝4.0Hz,1H),5.58(d,J＝5.1Hz,1H),5.45(d,J＝3.5Hz,1H),5.39(d,J＝6.7Hz,1H),4.23(d,J＝9.2Hz,1H),3.87(s,3H),3.77(s,3H),3.67(s,3H),3.48–3.40(m,3H)； 13 C-NMR(150MHz,DMSO-d 6 )δ182.38,169.21,163.92,162.49,156.01,152.64,152.17,132.55,128.40,122.74,114.65,105.97,103.43,99.38,93.97,75.70,75.26,72.82,71.34,60.32,55.63,52.00。
Compound 11 (1.51 g,3.00 mmol) was suspended in a mixed solvent of 60mL ethanol and 10mL water, and 10mL concentrated sulfuric acid was slowly added dropwise with vigorous stirring at room temperature. The reaction was heated at 110℃for 10h after the completion of the dropwise addition, followed by TLC (V) Dichloromethane (dichloromethane) ∶V Methanol =10: 1) Detection showed complete reaction. Stopping heating, naturally cooling to room temperature to precipitate solid, filtration and vacuum drying gave Lirioflavin 3 (0.84 g, 92%). 1 H-NMR(400MHz,DMSO-d 6 )δ13.04(s,1H),10.74(s,1H),8.03(d,J＝8.6Hz,2H),7.10(d,J＝8.6Hz,2H),6.87(s,1H),6.62(s,1H),3.86(s,3H),3.76(s,3H)； 13 C-NMR(150MHz,DMSO-d 6 )δ182.17,163.36,162.30,157.34,152.78,152.43,131.38,128.29,122.86,114.56,104.16,103.06,94.31,59.97,55.55。
1.4 Synthesis of 4' -O-methyl scutellarin
Scutellarin 1 (10.0 g,34.96 mmol) was suspended in 100mL diphenyl ether and dichlorodiphenyl methane (12.5 g,52.45 mmol) was added at 180 ℃. After 1.0h, TLC (V) Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. After cooling to room temperature, 100mL of petroleum ether was added, filtered, and ethyl acetate recrystallized to yield yellow solid 12 (5.15 g, 82%); 1 H NMR(400MHz,DMSO-d 6 )δ13.17(s,1H),10.42(s,1H),7.94(d,J＝8.6Hz,3H),7.61–7.53(m,6H),7.47(d,J＝5.6Hz,8H),7.06(s,1H),6.93(d,J＝8.6Hz,3H),6.87(s,1H)； 13 C NMR(150MHz,DMSO-d 6 )δ182.38,164.07,161.19,152.50,152.32,141.30,138.63,129.56,128.53,128.37,125.67,120.79,118.13,115.82,106.71,102.56,89.86。
compound 12 (1.80 g,4.00 mmol) was suspended in anhydrous DMF 40mL, anhydrous potassium carbonate (0.83 g,6.00 mmol) was added under nitrogen, stirred at room temperature for 10min and methyl iodide (0.30 mL,4.80 mmol) was added. The reaction was stirred at room temperature, TLC (V) Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. The reaction mixture was poured into 100mL of 1M hydrochloric acid, extracted with ethyl acetate (50 mL. Times.2), and the organic phases were combined, washed with 100mL of saturated brine, and dried over anhydrous sodium sulfate. Column chromatography was concentrated under reduced pressure to give yellow solid 13 (1.61 g, 87%).
Compound 13 (719 mg,1.55 mmol) was dissolved in a mixture of methanol 20mL and tetrahydrofuran 20mL, and 15% Pd (OH) was added with stirring at room temperature 2 C0.36 g. After 3 hydrogen substitutions, TLC (V) after 12h at room temperature Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. Naturally cooling, filtering with diatomite, washing filter cake with methanol, and performing organic phase reduced pressure concentration column chromatography to obtain 4' -O-methyl scutellarin 4 (414 mg, 89%); 1 H NMR(400MHz,DMSO-d 6 )δ12.76(s,1H),10.53(s,1H),8.80(s,1H),8.02(d,J＝8.6Hz,2H),7.10(d,J＝8.6Hz,2H),6.84(s,1H),6.60(s,1H),3.85(s,3H)； 13 C NMR(150MHz,DMSO-d 6 )δ181.89,162.89,162.01,153.23,149.54,146.87,129.03,128.04,122.96,114.40,103.89,102.77,93.75,55.38。
1.5 Synthesis of 6, 7-dihydroxy-5, 4' -dimethoxy flavone
Compound 12 (1.80 g,4.00 mmol) was suspended in anhydrous DMF 40mL, anhydrous potassium carbonate (2.76 g,20.00 mmol) was added under nitrogen, stirred at room temperature for 10min and methyl iodide (0.75 mL,12.00 mmol) was added. The reaction was stirred at room temperature, TLC (V) Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. The reaction mixture was poured into 300mL of 1M hydrochloric acid, extracted with ethyl acetate (50 mL. Times.3), and the organic phases were combined, washed with 100mL of saturated brine, and dried over anhydrous sodium sulfate. Column chromatography was concentrated under reduced pressure to give 14 (1.74 g, 91%) as a yellow solid.
Compound 14 (741mg, 1.55 mmol) was dissolved in a mixture of methanol 20mL and tetrahydrofuran 20mL, and 15% Pd (OH) was added with stirring at room temperature 2 C0.36 g. After 3 hydrogen substitutions, TLC (V) after 12h at room temperature Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. Naturally cooling, filtering with diatomite, washing filter cake with methanol, and performing organic phase reduced pressure concentration column chromatography to obtain 6, 7-dihydroxy-5, 4' -dimethoxy flavone 5 (447 mg, 92%); 1 H NMR(400MHz,DMSO-d 6 )δ7.97(d,J＝8.6Hz,2H),7.09(d,J＝8.6Hz,2H),6.84(s,1H),6.63(s,1H),3.85(s,3H),3.76(s,3H)； 13 C NMR(150MHz,DMSO-d 6 )δ175.58,161.48,159.73,151.82,150.61,144.66,136.72,127.49,123.25,114.29,110.81,105.62,99.10,61.11,55.28。
1.6 Synthesis of Salvia officinalis and 5,6,7,4' -tetramethoxyflavone
Scutellarin 1 (1.15 g,4.00 mmol) was suspended in anhydrous DMF 40mL, anhydrous potassium carbonate (4.41 g,32.00 mmol) was added under nitrogen, stirred at room temperature for 10min, and methyl iodide (1.25 mL,20.00 mmol) was added. The reaction was stirred at room temperature, TLC (V) Petroleum ether ∶V Acetic acid ethyl ester =4: 1) Detection showed complete reaction. The reaction mixture was poured into 400mL of 1M hydrochloric acid, extracted with ethyl acetate (50 mL. Times.3), and the organic phases were combined, washed with 100mL of saturated brine, and dried over anhydrous sodium sulfate. Vacuum concentrating column chromatography to obtain Salvia 6 (0.63 g, 48%) and 5,6,7,4' -tetramethoxyflavone 7 (0.49 g, 36%).
Carnosol 6: 1 H NMR(400MHz,DMSO-d 6 )δ12.90(s,1H),8.09(d,J＝8.7Hz,2H),7.13(d,J＝8.7Hz,2H),6.98(s,1H),6.96(s,1H),3.94(s,3H),3.87(s,3H),3.74(s,3H)； 13 C NMR(150MHz,DMSO-d 6 )δ182.12,163.46,162.27,158.53,152.52,151.90,131.75,128.20,122.58,114.45,104.98,103.21,91.50,59.88,56.32,55.44。
5,6,7,4' -tetramethoxyflavone 7: 1 H NMR(400MHz,DMSO-d 6 )δ8.03(d,J＝8.6Hz,2H),7.22(s,1H),7.11(d,J＝8.6Hz,2H),6.73(s,1H),3.95(s,3H),3.86(s,3H),3.80(s,3H),3.77(s,3H)； 13 C NMR(150MHz,DMSO-d 6 )δ175.48,161.72,160.11,157.27,153.77,151.42,139.60,127.64,122.88,114.32,111.88,105.93,97.17,61.70,60.84,56.29,55.35。
2. expression and purification of novel coronavirus 3CLPro protein
2.1 primer design
Gene specific primers (3 CL-F: gtgccgcgcggcagccatatgtcggcagtgctgcaaagcggtttccgtaagatg, SEQ ID NO:1;3CL-R: gtggtggtggtggtgctcgaggggcccttgaaaggtcacaccgctgc, SEQ ID NO: 2) were designed according to the novel coronavirus 3CLPro gene (protein residues 3264-3569 of ORF1ab, genBank accession number: MN 908947.3) as templates, wherein the 3CLPro-F primer sequence carries an NdeI cleavage site and the 3CLPro-R primer sequence carries an XhoI cleavage site. Adding SAVLQ 5 amino acids at the N end of the protein to construct a 3CLPro self-restriction enzyme site; after VTFQ amino acid at the C end of the protein, GP two amino acids are added to construct a expression protease cleavage site, so that fusion expression of a target gene and a His tag is promoted.
2.2 novel coronavirus 3CLPro Gene amplification
First, a novel coronavirus 3CLPro gene having a codon preference for e.coli was synthesized by general biology. The total amplification system was 100. Mu.L using the synthesized gene of novel coronavirus 3CLPro as a template. The PCR reaction system comprises: cDNA templates 1. Mu.L, 3 CL-R4. Mu.L, 3 CL-F4. Mu.L, 2X Phanta Master Mix. Mu.L and ddH2O 41. Mu.L. The reaction procedure is specifically as follows: pre-denaturation at 94℃for 3min, 30 amplification reactions (94℃15s,65℃30s,72℃30 s) and extension at 72℃for 5min. The PCR product was sampled at 9. Mu.L, added to 1. Mu.L of 6X Gel Loading Dye Purple, mixed well and loaded, wherein 2. Mu.L of the Marker was added to the first well for control of the bands separated from the sample (voltage 150V,40 min). The PCR results were observed under UV light and bands of the correct PCR fragments were excised from the gel with a knife, placed in a 1.5mL EP tube, weighed and recorded. The PCR product was recovered using a SanPrep column type DNA gel recovery kit, and the concentration and purity of the recovered target gene were determined using a Nano Drop.
2.3 construction of novel coronavirus 3CLPro expression vectors
pET28a (+) was digested with NdeI and XhoI restriction enzymes, and then the plasmid fragment of interest was recovered by gel for recombinant ligation. The specific connection system comprises: 20. Mu.g of pET28a (+) plasmid fragment, 40. Mu.g of 3CLPro target gene, 5 XCE II Buffer 5. Mu. L, exnase II 2. Mu.L, and 50. Mu.L of water were used.
2.4 Induction of expression of novel coronavirus 3CLPro
The successfully transformed E.coli strain was inoculated at 37℃in 1% (v/v) of an inoculum size into 25mL of LB liquid medium containing kanamycin (50. Mu.g/mL) for preculture overnight, and then the culture was inoculated at 1% (v/v) of an inoculum size into 1L of LB liquid medium containing kanamycin (50. Mu.g/mL) for culture at 37 ℃. When OD600 reached 0.8, 3CLPro protein was expressed by addition of 0.5mM isopropyl-D-thiogalactoside (IPTG) and induction at 25℃for 12 h.
2.5 purification of novel coronavirus 3CLPro
1) 1L of the bacterial liquid was centrifuged at 5000 Xg for 10min, and the supernatant was discarded.
2) The pellet was resuspended in 40mL of Lysis Buffer (pH of all buffers adjusted at 4 ℃) and then lysed by high pressure homogenizer for 3-5 min.
3) The lysate was ultracentrifuged (15000 Xg) at 4℃for 30min using a cryo-centrifuge, and the supernatant was taken and ultracentrifuged (15000 Xg) again for 30min.
4) The Ni-NTA column was equilibrated with Lysis Buffer prior to protein purification using the Ni-NTA column.
5) Adding the supernatant of the lysate which is centrifuged for 2-3 times into a Ni-NTA column for flow-through in batches, adding about 100mL of Lysis Buffer for washing the Ni-NTA column after flow-through is finished, and eluting and collecting 3CLPro by using 25mL of Wash Buffer and 35mL Elution Buffer after washing is finished.
6) mu.L of each of the lysate, the flow-through solution, the washing solution, the Wash Buffer and the Elutation Buffer was collected.
7) mu.L of 5 XSDS-PAGE Protein Loading Buffer was added to each sample, the mixture was stirred and mixed, the protein samples were denatured by heating at 95℃for 10min, 10. Mu.L of each sample was subjected to SDS-PAGE, and 2. Mu. L Prestained Protein Ladder was added to the first well for control of the bands separated from the samples (voltage 220V,45 min).
8) The eluate was concentrated to 2mL according to SDS-PAGE result, and the eluate was replaced 3 times with replacement solution A (20mM HEPES,400mM NaCl,pH 7.5), to finally obtain 4mL of 3CLPro concentrate, and the protein concentration was measured using Nano Drop. To the concentrate was added 13mg/mL of Precision Protease (PPE) 100. Mu.L for overnight cleavage.
9) The gel filtration molecular sieve column (HiLoad 16/600Superdex 200pg) was equilibrated with GFC Buffer (100mM NaCl,20mM HEPES,pH 7.5).
10 4mL of the digested 3CLPro concentrate was aliquoted into 3 1.5mL EP tubes and ultracentrifuged at 4℃for 12000 Xg and 10min.
11 After removal of the precipitate, the protein sample was pushed into a 5mL loading loop using a screw syringe and protein purification was performed by AKTA protein purifier.
12 Concentrating the fraction eluted from the gel filtration molecular sieve column containing high purity 3CLPro, replacing the concentrated solution with replacement solution B (20mM HEPES,200mM NaCl,pH 7.5) and replacement solution C (20mM HEPES,100mM NaCl,pH 7.5) 3 times in sequence, and measuring the protein concentration using Nano Drop. The 3CLPro protein is split-packed according to 50 mu L/tube, and is put into-80 ℃ for preservation after quick freezing by liquid nitrogen.
3. Activity test
In the invention, the chemical structural formulas of homoplantain, salicifolicin, 4' -O-methyl scutellarin, 6, 7-dihydroxy-5, 4' -dimethoxy flavone, salvinin, 5,6,7,4' -tetramethoxy flavone and scutellarin are shown in table 1.
Table 1 formula of scutellarin methylated derivatives
1) The novel coronavirus 3CLPro activity and the inhibitory activity of the compounds in table 1 on the novel coronavirus 3CLPro were determined by Fluorescence Resonance Energy Transfer (FRET). Fluorogenic substrate (Dabcyl-KTSAVLQ ∈SGFRKM-E (Edans) -NH 2) with novel coronavirus 3CLPro cleavage site (arrow) and Tris-HCl buffer (50 mM Tris-HCl,1mM EDTA,pH 7.3) were used in the assay.
2) The compound was dissolved in 100% dmso. The above 10. Mu.L of the compound was incubated with 40. Mu.L of novel coronavirus 3CLPro (final concentration 0.1. Mu.M) in Tris-HCl buffer for 1h, and the reaction was initiated by adding 50. Mu.L of fluorogenic substrate (Dabcyl-KTSAVLQ. Mu.SGFRKM-E (Edans) -NH2, final concentration 20. Mu.M). The Dabcyl fluorescence signal (340 nm (excitation)/490 nm (emission)) generated by cleavage of the substrate by 3CLPro was detected using a radioresonance energy transfer fluorescence spectrophotometer, and whether the compound had inhibitory activity was determined by a change in the fluorescence signal within 3 min.
3) The novel coronavirus 3CLPro kinetic constants were obtained by fitting the data to MichaelisMenten equation. High inhibitory activity compounds (compounds with an inhibition rate of more than 0.9 at a final concentration of 50 μm) were screened out by preliminary screening, shikonin (known high activity inhibitor) was added as a positive control, and the inhibition rate was compared. The screening results are shown in Table 2. The compounds can be seen from table 2: the enzyme inhibition activity of 4' -O-methyl scutellarin, 6, 7-dihydroxy-5, 4' -dimethoxy flavone, 5,6,7,4' -tetramethoxy flavone and scutellarin on the novel coronavirus 3CLPro is superior to that of shikonin as a positive control medicine.
4) IC for high inhibitory Activity Compounds screened by Primary screening 50 Is measured. Compounds were diluted to gradient concentrations (1.5625-100. Mu.M and 0.15625-10. Mu.M) using Tris-HCl buffer and assayed using the novel coronavirus 3CLPro and fluorogenic substrate system at the same final concentrations described above. IC of compound 50 The values were calculated by GraphPad Prism 8.0 software. Three replicates per experiment, the final results are expressed as mean ± Standard Deviation (SD). The measurement results are shown in Table 3. As can be seen from table 3, the compounds: IC of 4' -O-methyl scutellarin on novel coronavirus 3CLPro 50 Values below 1.0 μm show excellent inhibitory activity against the novel coronavirus 3CLPro.
Table 2 inhibition of 50 μm of anti-neocrown activity of scutellarin methylated derivatives
Table 3 results of IC50 determination of anti-New crown Activity of scutellarin methylated derivatives
Note that: "-" means a compound having relatively low activity as initially screened in Table 2The object was not subjected to IC 50 Measuring;
the foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Claims (1)
- Application of 4 '-O-methyl scutellarin or 6, 7-dihydroxy-5, 4' -dimethoxy flavone in preparing medicine for treating coronavirus infection is provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111607950.7A CN114306317B (en) | 2021-12-22 | 2021-12-22 | Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111607950.7A CN114306317B (en) | 2021-12-22 | 2021-12-22 | Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114306317A CN114306317A (en) | 2022-04-12 |
| CN114306317B true CN114306317B (en) | 2023-06-06 |
Family
ID=81012691
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111607950.7A Active CN114306317B (en) | 2021-12-22 | 2021-12-22 | Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114306317B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701245A (en) * | 2009-10-21 | 2010-05-05 | 中国科学院生物物理研究所 | Method for separating SARS coronavirus main proteinase inhibitor from traditional Chinese medicine |
| CN113368241A (en) * | 2021-05-17 | 2021-09-10 | 沈阳药科大学 | Coronavirus main protease 3CLpro inhibitor and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112107574A (en) * | 2020-09-30 | 2020-12-22 | 郑州大学 | Application of pectolinarin in preparation of anti-esophageal cancer drugs |
-
2021
- 2021-12-22 CN CN202111607950.7A patent/CN114306317B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701245A (en) * | 2009-10-21 | 2010-05-05 | 中国科学院生物物理研究所 | Method for separating SARS coronavirus main proteinase inhibitor from traditional Chinese medicine |
| CN113368241A (en) * | 2021-05-17 | 2021-09-10 | 沈阳药科大学 | Coronavirus main protease 3CLpro inhibitor and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114306317A (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102206172B (en) | Substituted diaryl compound and preparation method and antiviral application thereof | |
| CN111803501B (en) | Use of chiral chloroquine hydroxychloroquine for reducing cardiotoxicity | |
| CN105348219B (en) | Curcumin analogue and its preparation and application | |
| CN112645809B (en) | Novel coronavirus 3CL protease inhibitor based on menadione structure | |
| CN111233649A (en) | Naphthoquinone compound for resisting novel coronavirus and medical application thereof | |
| US20100278943A1 (en) | Anti viral composition | |
| CN113855665A (en) | Application of oridonin and/or prodrug thereof in preparation of medicines for inhibiting SARS-CoV-2 | |
| CN114306317B (en) | Application of scutellarin methylation derivative in preparation of novel coronavirus prevention and/or treatment drug | |
| Goudreau et al. | Optimization and determination of the absolute configuration of a series of potent inhibitors of human papillomavirus type-11 E1–E2 protein–protein interaction: a combined medicinal chemistry, NMR and computational chemistry approach | |
| CN113735814B (en) | Myrtle ketone compound and application thereof in preparation of anti-influenza virus drugs | |
| CN114560899B (en) | Preparation method and application of plantain | |
| CN103908447B (en) | The application of shrubby sophora extract and Vexibinol in anti-EV71 virus infection | |
| CN115715778B (en) | Application of oroxylin A | |
| CN103159665B (en) | Isatin-5-amide inhibiting agent with inhibition effect against SARS coronavirus main protease | |
| CN106673984B (en) | (E) -2, 4-dihydroxy-6-propenylbenzaldehyde, preparation method and use thereof | |
| CN104892552B (en) | A kind of purification process of dehydroandrographolide succinate | |
| CN112724156B (en) | Polycyclic pyridone derivative, pharmaceutical composition and application thereof | |
| CN115819391A (en) | Baicalein derivative, preparation method and application thereof | |
| WO2021175123A1 (en) | 1,4-naphthoquinone compound for resisting novel coronavirus and medical use thereof | |
| CN113288907B (en) | Application of iridoid compound in preparing anti-coronavirus medicine | |
| CN111184708A (en) | Application of silver salt of fumaric acid monoethyl ester in resisting novel coronavirus infection | |
| US9629822B2 (en) | Flavonoid based antiviral targets | |
| CN110063960B (en) | Pharmaceutical application of 3-hydrogenated pinolenic acid B cyanomethyl ester | |
| CN115252588B (en) | Application of 1, 4-hydroquinone and/or 1, 4-hydroquinone derivative in preparing anti-novel coronavirus medicine | |
| CN111205196B (en) | Phenol AB ring structure compound and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |