CN114292880A - Application of zebra fish vps28 gene in preparation of neurovascular unit vascular disorder model - Google Patents

Abstract

The application discloses an application of zebra fish vps28 (vacular protein organizing-associated protein 28 homolog) gene in preparation of a neurovascular unit angiogenesis disorder model, wherein the vps28 gene has NCBI accession number: NM _200590, its modeling method is: knocking zebra fish vps28 gene out in a targeted manner by using a CRISPR/Cas9 technology, selfing after G0 generation is obtained, screening to obtain vps28 mutation carrying F1 generation individuals, screening F2 generation vps28 homozygotes after F1 generation selfing, and when the vps28 mutation develops to 54hpf, central arteries (CtAs) of a brain cannot be normally formed, namely a neurovascular unit angiogenesis disorder model based on zebra fish vps28 gene deletion is obtained, and the model can be used for screening drugs for promoting head angiogenesis; the relevance of the zebra fish vps28 gene and angiogenesis is found for the first time, the gene is applied to preparing the animal model with the cerebrovascular unit angiogenesis disorder, the modeling method is simple to operate, no exogenous inhibitory drug is required to be added in the embryo development period, the repeatability is high, and the effect of promoting angiogenesis by the drug can be evaluated in vivo by directly observing angiogenesis.

Description

Application of zebra fish vps28 gene in preparation of neurovascular unit vascular disorder model

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of zebra fish vps28 gene in preparation of a zebra fish model with neurovascular unit angiogenesis disorder, and screening of angiogenesis promoting drugs by using the model.

Background

The cerebral apoplexy refers to the brain function damage caused by the abnormal blood circulation of the brain, the incidence rate of the cerebral apoplexy is high in China, and the cerebral apoplexy is the most main lethal disabling disease of adults in China. 80% of cerebral apoplexy people are ischemic cerebral apoplexy, and the Chinese diagnosis and treatment guide of ischemic cerebral apoplexy clearly indicates that the improvement of blood perfusion in an ischemic area is the key for treating the ischemic cerebral apoplexy, and the establishment of effective collateral circulation is an important treatment means for improving the ischemic cerebral apoplexy.

Collateral circulation is established by angiogenesis, which is the budding or other formation of blood vessels on preexisting vessels involving biological processes such as cell proliferation, migration, differentiation, tube formation and regulation of angiogenic factors. The formation of new blood vessels is mainly through the generation of blood vessel budding, where avascular tissue secretes induction growth factors such as: vascular Endothelial Growth Factor (VEGF) or Bone Morphogenetic Protein (BMP) to induce sprouting of blood vessels. At present, effective medicines for promoting collateral circulation establishment after ischemic stroke are lacked. Therefore, there is a need for developing a biological sample for establishing a therapeutic method for ischemic stroke in collateral circulation, and an appropriate animal model is also needed.

Zebrafish, the third model animal of scientific research, has significant advantages in large-scale drug screening due to its numerous advantages, such as in vitro development, clear embryos, and low feeding cost. It has been reported previously that angiogenesis disorder models of zebrafish can be induced by using inhibitors of the vascular growth factor receptor (e.g. patent CN201110327420) or by using simvastatin (e.g. patent CN 201910752649). Because the regulation and control mechanisms of the zebra fish head angiogenesis and the trunk internode angiogenesis are not completely consistent, aiming at screening drugs for promoting cerebral apoplexy angiogenesis, the zebra fish with the head angiogenesis disorder is closer to clinical requirements, but the angiogenesis disorder model shows that the zebra fish trunk internode angiogenesis is inhibited, and the brain angiogenesis disorder condition is not determined, so that the two zebra fish models for screening the drugs for promoting cerebral angiogenesis are not applicable; secondly, the reported models of the angiogenesis disorders are all generated by treating embryos with different concentrations of drugs, and the embryo tolerance degree to the drugs is different, so the degree of angiogenesis inhibition of the model is different, for example, simvastatin (patent CN201910752649) induces zebrafish angiogenesis disorder model, and the zebrafish angiogenesis inhibition rate of 0.15 mu M simvastatin is only 43.40 +/-11.98%. Based on the above problems, it is important to establish a specific and stable neurovascular unit angiogenesis disorder model for screening drugs for promoting the establishment of cerebral collateral circulation.

Disclosure of Invention

Aiming at the defects of the prior art, the relevance of the zebra fish vps28 gene and angiogenesis is found for the first time, the gene is applied to preparing the animal model of the cerebral neurovascular unit angiogenesis disorder, the modeling method is simple to operate and high in repeatability, the method for screening the angiogenesis promoting drug by utilizing the zebra fish cerebral angiogenesis disorder model is provided, and the angiogenesis promoting effect of the drug can be evaluated in vivo by directly observing angiogenesis.

In order to achieve the above purpose, the invention is realized by the following technical scheme:

firstly, the application provides an application of zebra fish vps28 gene in preparation of a neurovascular unit angiogenesis disorder model. Zebrafish vps28 gene coding sequence (NCBI accession No.: NM-200590), the application relates to mutant zebrafish with the nucleotide sequence from 355 to 376 deleted from the gene coding sequence.

Further, the specific application steps are as follows:

1) the method comprises the steps of utilizing CRISPR/Cas9 genome editing technology to knock out a vps28 gene in a targeted mode, collecting fertilized eggs of the conventional zebra fish, injecting vps28 sgRNA (SEQ ID NO.1) and CRISPR Cas9 protein together in an embryo 1-cell stage, and feeding the injected embryos to sexual maturity (feeding conditions are as follows: room temperature 27.5 ℃, light for 14 hours, dark for 10 hours) to obtain G0 generation zebra fish;

2) freely mating G0 zebra fish to obtain vps28 mutant carrying F1 individuals; and (3) taking part of tail fins of the F1 generation individuals to perform genotype identification, and screening vps28 frameshift mutation carriers (namely individuals with deletion of nucleotide sequences from 355 to 376 of the vps28 gene coding sequence), namely vps28 frameshift mutation F1 generation individuals. Wherein the probability of screening the vps28 frameshift mutation F1 generation individuals is about 40%.

3) Mating individual female and male of sexual maturity vps28 frame shift mutation F1 generation, screening homozygous mutation embryo (homozygote) of vps28 generation F2 generation, namely vps28 mutant zebra fish, wherein nucleotide sequence from 355 to 376 of the vps28 gene coding sequence of the mutant zebra fish is deleted, and the 119 th amino acid isoleucine in the vps28 gene vps28 superfamily structural domain is replaced by a stop codon.

When the embryos of the F2 generation develop to 54 hours (54hpf, namely 54 hours after the fertilized eggs of the F2 generation are formed), the central arteries (CtAs) of the brains of the vps28 homozygous mutant can not be normally formed by observing and analyzing the embryos through a fluorescence microscope, namely the CtAs at the hindbrain of the vps28 mutant zebra fish form obstacle, namely a neurovascular unit angiogenesis obstacle model based on the deletion of the vps28 gene of the zebra fish is obtained.

The neurovascular unit angiogenesis disorder is caused by loss of function of the vps28 gene, namely cerebrovascular neogenesis disorder caused by the vps28 gene frameshift mutation, and the symptom of the cerebrovascular neogenesis disorder is cerebral parenchymal central artery formation disorder.

Preferably, the fertilized egg of the zebra fish is a fertilized egg of a green fluorescent transgenic zebra fish marked by Tg (Kdrl: EGFP) vascular endothelial cells (a transgenic zebra fish strain in which green fluorescent protein is specifically expressed in blood vessels and purchased from the national zebra fish resource center (s843Tg, Tg (Kdrl: EGFP)).

Preferably, the "genotyping" method of step 2 above is as follows: cutting a small amount of zebra fish tail fins by using 75% ethanol sterilized ophthalmic forceps; the DNA of F1-generation zebra fish is extracted by using a genome extraction kit, and the extraction method comprises the following steps: putting the tail fin of the zebra fish into 10 mul of DNA extracting solution, obtaining the zebra fish DNA to be identified in F1 generation after the DNA extracting solution is processed by 30min at 65 ℃, 5min at 95 ℃ and 1min at 16 ℃, and storing at-20 ℃; then, the F1 generation zebra fish DNA to be identified is used as a template for PCR amplification.

And (3) PCR reaction system: mu.l of 2 × MasterMix, 1. mu.l of vps 28F 1 forward primer (5. mu.M), 1. mu.l of vps 28F 1 reverse primer (5. mu.M), 1. mu. l F1 zebrafish DNA to be identified (concentration 100 ng/. mu.l), 7. mu.l of ultrapure water (autoclaved); the nucleotide sequence of the vps 28F 1 generation forward primer is shown as SEQ ID NO.2 (5'-ATTTAGCTGGACTGTCCGCT-3'), and the nucleotide sequence of the vps 28F 1 generation reverse primer is shown as SEQ ID NO.3 (5'-ATTCATTCTAGGCTACACG-3');

the PCR amplification steps are as follows: 94 ℃ for 5min, 35 cycles (94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 30sec), 72 ℃ for 7 min. Carrying out electrophoresis on the PCR product, carrying out DNA sequencing on the PCR product, and screening to obtain a vps28 frameshift mutation F1 generation individual; the electrophoresis band size of the PCR product corresponding to the vps28 frameshift mutant F1 generation individual is 557 bp.

Preferably, the screening of F2 generation vps28 homozygous mutant embryo refers to: extracting F2 zebra fish genomes from the F2 embryos by using a genome extraction kit (by the method for identifying the genotypes) to obtain F2 zebra fish genomes to be identified; then, the F2 generation zebra fish DNA to be identified is used as a template for PCR amplification.

The following PCR amplification system was configured: mu.l of 2 × MasterMix, 1. mu.l of vps 28F 2 forward primer (5. mu.M), 1. mu.l of vps 28F 2 reverse primer (5. mu.M), 1. mu. l F2 th zebrafish genome to be identified (concentration 100 ng/. mu.l), 7. mu.l of ultrapure water (autoclaved); the nucleotide sequence of the vps 28F 2 generation forward primer is shown as SEQ ID NO.4 (5'-ATTTAGCTGGACTGTCCGCT-3'), and the nucleotide sequence of the vps 28F 2 generation reverse primer is shown as SEQ ID NO.5 (5'-ATTCATTCTAGGCTACACG-3').

The PCR amplification steps are as follows: 94 ℃ for 5min, 35 cycles (94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 10sec), 72 ℃ for 7 min. Carrying out electrophoresis on the PCR product, wherein the size of the PCR product of the homozygous mutant is 137 bp; the sizes of PCR products of the hybrid mutant are 137bp and 159 bp; the size of the wild-type PCR product was 159 bp.

Secondly, the application also provides the application of the neurovascular unit angiogenesis disorder model in screening of drugs for promoting head angiogenesis, namely, when juvenile fish of the homozygous mutant of the F2 generation develops to 30hpf (namely 30 hours after fertilized eggs of the F2 generation), VEGF protein for promoting angiogenesis is injected into a blood circulation system through CCV, and a new tubular structure blood vessel can be formed at the brain central artery deletion part of the vps28 homozygous mutant, namely, a zebra fish model for screening drugs for promoting head angiogenesis.

In the application, the CRISPR/Cas9 genome editing technology is used as a conventional zebra fish genome editing technology, the method is as disclosed in "S μ n, y., Zhang, b.,. L μ o, L.,. Shi, d.l.,. Wang, H.,. C μ i, Z.,. H μ ang, H.,. Cao, y.,. Sh μ, x.,. Zhang, w.,. Zho μ, j.,. Li, y.,. D μ, j.,. Zhao, q.,. Chen, j.,. Zhong, H.,. Zhong, t.p., Li, L.,. Xiong, j.w., pen, j.,. Xiao, w.,. Zhang, j., yo, Yin, Z.,. Mo, x.,. pen, g.,. zhu., j., Chen, y.,. Zho μ, y.,. Li μ, D.,. Pan, w.,. Zhang, y., H.,. H., zu, Z.,. 3, C, R.,. H. (R.,. g., zu., crispe, Z.,. 9. gene, e, Z. (R.). 1 μ.

Preferably, the CCV injection of VEGF described in this patent is a conventional CCV injection method for zebra fish;

preferably, the concentration of VEGFA protein injected is 10 mug/ul, and the injection amount is 1 nl/embryo;

compared with the prior art, the invention has the following beneficial effects:

the invention discovers that the vps28 mutant can be used for a head blood vessel formation disorder model for the first time, the modeling method is simple to operate and high in repeatability, no exogenous inhibitory drug is required to be added in the embryo development, and the success rate is high; the model is verified to be capable of being directly used for screening the medicine capable of promoting the angiogenesis of the brain, and the medicine can be observed in vivo to promote the angiogenesis, so that the model has good screening applicability of the medicine capable of promoting the angiogenesis.

Drawings

FIG. 1 is a (partial) schematic diagram of the sequencing peak of the vps28(-22bp) mutant.

FIG. 2 is a schematic diagram of the structure of the truncated protein of mutant vps28(-22 bp).

FIG. 3 is a microscope image of a conventional body type fluorescence microscope of zebrafish of example F2 generation.

FIG. 4 is the electrophoresis diagram of PCR products for identifying the mutant zebra fish with vps28 in the F2 generation.

FIG. 5 is the confocal microscope image of F2 zebra fish after VEGF protein injection.

Detailed Description

The experimental methods in the examples are all conventional methods unless otherwise specified.

The Tg (Kdrl: EGFP) transgenic zebrafish used in the examples were purchased from the national zebrafish resource center (s843Tg, Tg (Kdrl: EGFP).

The CRISPR Cas9 protein was purchased from seiry biotechnology ltd, tokyo, as a conventional commercial protein.

The genome extraction kit was purchased from Nanjing Yao Shunyuan biotechnology, Inc.

MasterMix was purchased from Biotech Inc. of Nanjing Novozam.

VEGF proteins were purchased from Nanjing Kinsrui Biotechnology Ltd.

The gene sequences referred to in the examples:

SEQ ID NO.1:GGACCGACCGATCACCATTAAGG；

SEQ ID NO.2(vps28-e7F):5’-ACCATTAACTAATGCTGCAAGCT-3’；

SEQ ID NO.3(vps28-e7R):5’-GCTCCAGCATGACAAAGTACAC-3’；

SEQ ID NO.4:5’-ATTTAGCTGGACTGTCCGCT-3’；

SEQ ID NO.5:5’-ATTCATTCTAGGCTACACG-3’。

example 1 construction of zebrafish vsp28 mutant

1. Tg (Kdrl: EGFP) transgenic zebrafish fertilized eggs were harvested according to a conventional method.

Vortexing and uniformly mixing sgRNA (the final concentration is 70 ng/mu l) with a nucleotide sequence shown as SEQ ID NO.1 and CRISPR Cas9 protein (the final concentration is 200 ng/mu l) to obtain a mixture; injecting into fertilized eggs of zebra fish by microinjection (the microinjection amount of the mixture per embryo is 1nl), and culturing to prepare vps28 gene knockout founder (G0 generation), wherein the culture conditions are as follows: room temperature 27.5 ℃, light 14 hours, dark 10 hours.

2. The G0 generation was bred to sexual maturity by a conventional method, and allowed to mate freely to obtain F1 generation embryos.

Feeding the F1 generation embryo to sexual maturity according to a conventional method, extracting genome from tail fin as template DNA, carrying out genotype identification after PCR amplification, and screening F1 generation frameshift mutant. The screening steps are as follows:

2.1 extraction of the genome

Cutting a small amount of zebra fish tail fins by using 75% ethanol sterilized ophthalmic forceps; the extraction method for extracting the zebra fish genome by using the genome extraction kit comprises the following steps: putting the tail fin of the zebra fish into 10 mul of genome extracting solution, obtaining the zebra fish genome to be identified in the F1 generation after 30min at 65 ℃, 5min at 95 ℃ and 1min at 16 ℃, and storing at-20 ℃.

2.2 genotype identification of mutants

And amplifying a genome sequence containing 557bp upstream and downstream of the sgRNA action site by using a PCR (polymerase chain reaction) method, performing DNA sequencing, and identifying the genotype of the F1 generation.

PCR amplification System: mu.l of 2 MasterMix, 1. mu.l of vps 28F 1 forward primer (5. mu.M, nucleotide sequence of which is shown in SEQ ID NO. 2), 1. mu.l of vps 28F 1 reverse primer (5. mu.M, nucleotide sequence of which is shown in SEQ ID NO. 3), 1. mu.l of zebrafish genome to be identified (concentration of 100 ng/. mu.l), 7. mu.l of ultrapure water (autoclaved);

a PCR amplification step: 5min at 94 ℃, 35 cycles (94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 30sec), 7min at 72 ℃; obtaining PCR amplification products.

The obtained PCR amplification product is sent to Nanjing Kingsrey Biotech Limited for DNA sequencing, and the mutant (namely the individual with deletion of nucleotide sequence from 355 to 376 of the vps28 gene coding sequence) vps28(-22bp) with the genotype of vps28 CDS region reduced by 22bp is screened, namely the F1 generation vps28(-22bp) heterozygote mutant, and the electrophoresis band size of the PCR amplification product corresponding to the mutant is about 557 bp.

The sequencing peak map (part) of the vps28(-22bp) variant obtained in this example is shown in FIG. 1, which shows that the vps28 mutant subjected to genotype identification is heterozygote, and the genotype is vps28(-22 bp).

FIG. 2 is a schematic diagram of the basic information for the construction of the vps28 mutant.

Example 2 establishment of a model of head angiogenesis disorders by Vps28(-22bp) homozygous mutant

The F1 generation vps28(-22bp) heterozygote mutant obtained by screening in example 1 was subjected to free mating, and was allowed to produce F2 generation individuals.

Individual F2 embryos were routinely cultured up to 54 hours post-fertilization (54hpf) and observed under a normal body-mounted fluorescence microscope, with one-quarter embryos showing abnormalities in central artery formation as shown in FIG. 3. In FIG. 3, A, B shows the CtAs phenotype, normal (CtAs forming normal), in a lateral and dorsal view, respectively, of wild-type or heterozygous (i.e., one allele is mutated and the other allele is not mutated) vps 28; C. d shows the phenotype of the vps28 mutant in side and back view (no formation of CtAs), and the 4 young fish photographed were genotyped.

Placing the F2 juvenile fish in a 200-microliter PCR tube, extracting genome as template DNA for PCR amplification, wherein the genome extraction method is the same as 2.1 in example 1;

PCR amplification System: mu.l of 2 MasterMix, 1. mu.l of vps 28F 2 forward primer (5. mu.M, nucleotide sequence of which is shown in SEQ ID NO. 4), 1. mu.l of vps 28F 2 reverse primer (5. mu.M, nucleotide sequence of which is shown in SEQ ID NO. 5), 1. mu.l of zebrafish genome to be identified (concentration of 100 ng/. mu.l), 7. mu.l of ultrapure water (autoclaved);

a PCR amplification step: 94 ℃ for 5min, 35 cycles (94 ℃ 30sec, 58 ℃ 30sec, 72 ℃ 10sec), 72 ℃ for 7 min.

The electrophoretogram of the amplification product is shown in FIG. 4. The PCR product of the homozygous mutant is 137 bp; the sizes of PCR products of the hybrid mutant are 137bp and 159 bp; the PCR product size of the wild type mutant is 159 bp; in FIG. 4, lanes 1, 3, 6 and 9 are vps28 homozygotes, lanes 2 and 5 are vps28 wild-type, and lanes 4, 7,8, 10, 11, 12, 13 and 14 are vps28 heterozygotes. Consistent with the microscopic examination results of FIG. 3. Wherein, the F2 generation zebra fish (homozygote) carrying vps28 homozygous frameshift mutation is the head angiogenesis disorder model.

Example 3 vps28 homozygous frameshift mutants can be used as screening models for pro-angiogenic drugs

VEGF protein (protein concentration 10. mu.g/. mu.l, injection amount 1 nl/embryo) was injected into the vps28 homozygous frameshift mutated F2 juvenile fish 30 hours after fertilization (i.e., head angiogenesis disorder model) of example 2 by CCV, and it was found that 54hpf of VEGF protein-injected group promoted partial central artery formation compared to the non-injected group, as shown in FIG. 5. The above-mentioned CCV injection method is a method conventional in the art, such as the method disclosed in "Xu, B., Zhang, Y., Du, X.F., Li, J., Zi, H.X., Bu, J.W., Yan, Y., Han, H.and Du, J.L. (2017) neurones section miR-132-conjugation exosomes to regulation brain vessel vacuum integration. cell Res 27, 882-897".

In FIG. 5, A is a cross-sectional view of the CtAs of vps28 heterozygote or wild type zebra fish (shown in a white dotted square), B is a diagram of the formation of the CtAs in the vps28 homozygous mutant, C is a view of VEGF promoting angiogenesis of the CtAs, and D-F is a partial enlarged view of the dotted square in the A-C diagram.

This example demonstrates that the model of head angiogenesis disorder (vps28 mutant) obtained in example 2 can be applied to screening drugs for promoting neurovascular unit angiogenesis.

Claims (8)

1. An application of zebra fish vps28 gene in preparing neurovascular unit angiogenesis disorder models.

2. The use according to claim 1, wherein said use is: collecting fertilized eggs of the zebra fish, injecting vps28 sgRNA and CRISPR Cas9 protein together at the embryo 1-cell stage, feeding the injected embryos to sexual maturity to obtain G0 generation zebra fish; the nucleotide sequence of vps28 sgRNA is shown in SEQ ID NO. 1.

2) Freely mating G0 zebra fish to obtain F1 individuals, identifying the genotype and screening individuals with deletion of nucleotide sequences from 355 to 376 bits of a vps28 gene coding sequence, namely vps28 frameshift mutation F1 individuals;

the vps28 frame-shift mutation F1 generation individual has nucleotide sequence deletion from 355 to 376 of the vps28 gene coding sequence;

3) culturing the vps28 frameshift mutant F1 generation individuals obtained in the step 2) until sexual maturity, and selecting females and males to mate to obtain F2 generation individuals; screening a vps28 homozygous mutant in an F2 individual and culturing to 54hpf to obtain a zebra fish neurovascular unit angiogenesis disorder model;

the nucleotide sequence from 355 to 376 of the vps28 gene coding sequence of the vps28 homozygous mutant is deleted.

3. The use of claim 2, wherein the fertilized zebrafish egg is a Tg (Kdrl: EGFP) transgenic fertilized zebrafish egg.

4. The use according to claim 2, wherein said genotyping in step 2) is performed by: extracting F1 generation individual DNA as a template to carry out PCR amplification to obtain a PCR amplification product; then DNA sequencing is carried out on the PCR amplification product, and the vps28 frameshift mutation F1 generation individual is obtained through screening.

5. The use of claim 2, wherein the vps28 homozygous mutant selected from the F2 individuals in the step 3) is the vps28 homozygous mutant obtained by extracting DNA of the F2 individuals as a template to perform PCR amplification, performing electrophoresis on an amplification product, and obtaining the F2 individuals with an electrophoretic band size of 137 bp.

6. The use according to claim 4, wherein the PCR amplification is:

PCR amplification System: 10 μ l2 MasterMix, 1 μ l of vps 28F 1 forward primer at a concentration of 5 μ M, 1 μ l of vps 28F 1 reverse primer at a concentration of 5 μ M, 1 μ l of F1 individual DNA at a concentration of 100ng/μ l, and 7 μ l of ultrapure water; the nucleotide sequence of the vps 28F 1 generation forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the vps 28F 1 generation reverse primer is shown as SEQ ID NO. 3;

a PCR amplification step: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 30sec, 58 ℃ for 30sec, and 72 ℃ for 30 sec; extension at 72 ℃ for 7 min.

7. The use according to claim 4, wherein the PCR amplification is: PCR amplification System: 10 μ l2 MasterMix, 1 μ l F2 forward primer at 5 μ M concentration, 1 μ l F2 reverse primer at 5 μ M concentration, 1 μ l F2 individual DNA at 100ng/μ l concentration, 7 μ l ultrapure water; the nucleotide sequence of the F1 generation positive 2 primer is shown as SEQ ID NO.4, and the nucleotide sequence of the F2 generation reverse primer is shown as SEQ ID NO. 5;

a PCR amplification step: pre-denaturation at 94 ℃ for 5 min; 35 cycles of 94 ℃ for 30sec, 58 ℃ for 30sec, and 72 ℃ for 30 sec; extension at 72 ℃ for 7 min.

8. A method for screening a medicine for promoting head angiogenesis based on the zebra fish neurovascular unit angiogenesis disorder model of claim 2 is characterized by comprising the following specific steps: when the vps28 homozygous mutant is cultured to 30hpf, VEGF protein is injected into the blood circulation system of zebra fish through a Common Central Vein (CCV), and the method can be applied to screening of drugs for promoting head angiogenesis.

Images