CN114277127B - Primer group, probe and kit for Kawasaki disease detection - Google Patents

Primer group, probe and kit for Kawasaki disease detection Download PDF

Info

Publication number
CN114277127B
CN114277127B CN202210148577.1A CN202210148577A CN114277127B CN 114277127 B CN114277127 B CN 114277127B CN 202210148577 A CN202210148577 A CN 202210148577A CN 114277127 B CN114277127 B CN 114277127B
Authority
CN
China
Prior art keywords
mir
hsa
primer
negative
positive
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210148577.1A
Other languages
Chinese (zh)
Other versions
CN114277127A (en
Inventor
李光
刘佳
丁国徽
黄敏
谢利剑
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Daozhi Precision Medicine Technology Shanghai Co ltd
Original Assignee
Daozhi Precision Medicine Technology Shanghai Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Daozhi Precision Medicine Technology Shanghai Co ltd filed Critical Daozhi Precision Medicine Technology Shanghai Co ltd
Priority to CN202210148577.1A priority Critical patent/CN114277127B/en
Publication of CN114277127A publication Critical patent/CN114277127A/en
Application granted granted Critical
Publication of CN114277127B publication Critical patent/CN114277127B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a primer group, a probe and a kit for Kawasaki disease detection, which belong to the technical field of molecular biology and comprise a reverse transcription primer, an amplification primer and a probe sequence, wherein the nucleic acid sequence combination can effectively and qualitatively/quantitatively detect miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and miR-126 in human blood platelets, wherein miR-126 is used as an internal reference marker. The miRNA in the platelets is collected, and compared with exosomes, the platelets are more easily obtained, are rich in content and are simple in extraction method. The method is more reasonable, the accuracy of the combined analysis of 4 miRNAs is far higher than that of the detection of a single biological standard substance, the occurrence of false positive is reduced, and the situations of Kawasaki disease, common fever and the like are more easily distinguished.

Description

Primer group, probe and kit for Kawasaki disease detection
Technical Field
The invention relates to the technical field of molecular biology, in particular to the technical field of miRNA application, and particularly relates to a primer set, a probe and a kit for Kawasaki disease detection.
Background
Kawasaki Disease (KD) was first reported in 1967 by Kawasaki disease, japanese Kawasaki, and was known as cutaneous mucosal lymph node syndrome (mucocutaneous lymphnode syndrome, MCLS), an acute, self-limiting systemic immune vasculitis of unknown cause. The main onset age is 6 months-4 years, and is characterized by extensive medium-sized and small vasculitis, the damage to the cardiovascular system is most serious, coronary artery is mainly involved, and about 15% -25% of untreated children finally develop into coronary artery damage, so that the coronary artery damage becomes the most common cause of acquired heart disease for children in developed countries. The study proves that the KD acute stage and the recovery stage have long-term vascular endothelial dysfunction and become dangerous factors for adults to easily suffer from coronary atherosclerosis. The american heart disease association of 2004 proposed: vascular endothelial dysfunction after KD recovery is a new risk factor for coronary heart disease.
Kawasaki disease is an acute, self-limiting systemic vasculitis, and is mainly clinically manifested by fever, oral mucosa changes, rash, cervical lymphadenectasis, bulbar conjunctiva congestion, acromegaly and the like. It is characterized by extensive inflammation of medium and small blood vessels, most serious damage to cardiovascular system, and histopathological manifestations include whole blood vessel inflammation, endothelial necrosis, mononuclear cell infiltration, small blood vessels, etc. If the patient is not treated regularly in time, 25 to 30 percent of children patients can have coronary artery lesions; and the incidence rate of coronary artery tumor is reduced to about 3-5% by using intravenous large dose of gamma globulin (IVIG) in early stage. As the most important early symptoms of Kawasaki disease are that the heat range of the patients exceeds 5 days, the patients are easy to be confused with other febrile diseases such as lymphadenitis, scarlet fever, urticaria, septicemia and the like to generate misdiagnosis, and the related literature reports that the early misdiagnosis rate of the Kawasaki disease can reach 26.7%, so that the infants suffering from the misdiagnosis cannot use IVIG for combined treatment in early stage of the Kawasaki disease in time to cause later coronary artery injury.
Platelets, which are the second most abundant cell type in blood, are produced by megakaryocytes in bone marrow hematopoietic tissue. The multifunctional hematopoietic stem cells are directionally differentiated in hematopoietic tissues to form primitive megakaryocytes, and further become mature megakaryocytes. The surface of the mature megakaryocyte membrane forms a plurality of depressions which extend into cytoplasm, and the adjacent depression cell membranes are mutually fused at the deep part of the depressions, so that partial cytoplasm of megakaryocyte is separated from the matrix. Finally, the components which are surrounded by the cell membrane and separated from the megakaryocyte cytoplasm are separated from the megakaryocyte and enter the blood circulation through the blood sinus in the hematopoietic tissue of the bone marrow to become platelets. Platelets present in the peripheral blood circulation play a hemostatic and wound healing role in the body.
In recent years, it has been found that platelets have become central molecules for systemic and local reactions, play an important role in cellular communication and immune reactions, and that since platelets have no nuclei, there is no background interference of rRNA in studying their RNAs. Platelets play a role in signal communication and metastasis in immune reaction, and since Kawasaki disease is a systemic immune disease, research on platelet RNA has theoretical basis and practical significance for early diagnosis of Kawasaki disease, and current research reports on the aspect are very few.
The primer group, the probe and the kit for kawasaki disease detection in the patent CN 106701962A provide a nucleic acid sequence combination for kawasaki disease detection, which comprises a reverse transcription primer, an amplification primer and a probe sequence, and can effectively and qualitatively/quantitatively detect hsa-miR-197, hsa-miR-671, hsa-miR1246 and hsa-miR4436 in human serum. This patent acquires exosome miRNA from the serum sample and detects, and the serum acquisition in the blood need wait for certain time, and exosome itself is difficult to acquire, and exosome miRNA's content is less, and it is complicated to extract exosome miRNA operation, and extraction cost is higher, and the detection degree of difficulty of exosome miRNA is big. The patent does not set reference genes, and there may be individual differences in later experiments.
The patent CN104450901A discloses that hsa-miR-197, hsa-miR-671, hsa-miR-1246 and hsa-miR-4436 can be used as molecular markers of Kawasaki disease, and specifically discloses dye-process fluorescence quantitative PCR primer sequences of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p, and a total of 4 groups of 8 nucleic acid sequences still need to be improved in detection accuracy.
Disclosure of Invention
The invention aims to provide a primer group, a probe and a kit for Kawasaki disease detection, miRNA in platelets is collected, and compared with exosomes, the platelets are easier to obtain and have rich content, and the extraction method is simple. The method is more reasonable because the specific miRNA reference genes are arranged. The selected 4 miRNAs come from the result of the second-generation high-depth sequencing, and are obtained by combining with the comprehensive analysis and scoring of clinical information, the accuracy of the combined analysis of the 4 miRNAs is far greater than that of the detection of a single biological standard, and the occurrence of false positive is reduced. The Kawasaki disease is more easily distinguished from common fever and the like. Has the advantages of convenient material acquisition, low cost, high sensitivity, good stability, easy operation and the like.
The technical scheme of the invention is realized as follows:
the invention provides a nucleic acid sequence combination for Kawasaki disease detection, which comprises a reverse transcription primer, an amplification primer and a probe sequence, wherein the nucleic acid sequence combination can effectively and qualitatively/quantitatively detect miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and miR-126 in human blood platelets, wherein miR-126 is used as an internal reference marker;
wherein, the reverse transcription primer sequence is as follows:
miR-125a-5p-sl：CAGGGCATCAGCCTGAACCCTGAACCCTGAATAACCTG AAACTGATGCCCTGTCACAG；
hsa-miR-3182-sl：ACGGGAAACTGAGTTCAGTTCCCAGCGTCCATATCAGT TCCCAGTTTCCCGTGACTAC；
hsa-miR-3675-5p-sl：CAGGGCATCAGCCTGAACCCTGAACCCTGAATAAC CTGAAACTGATGCCCTGGAAATC；
miR-4433b-5p-sl：CTTGATGGCTGCCCGTCAAGCCAGTCAAGTATCCAGT CAAGTCAGCCATCAAGACAGGA；
miR-126-sl：TTAGGGTCAGGCCTGAACCCTGAACCCTGAATGCGAACTG ACCTGACCCTAACGCATT；
the amplification primer sequences were as follows:
forward primer:
miR-125a-5p-F：CCTGAACCCTGAACCCTGA；
hsa-miR-3182-F：AGTTCAGTTCCCAGCGTCC；
hsa-miR-3675-5p-F：CCTGAACCCTGAACCCTGA；
miR-4433b-5p-F：CCCGTCAAGCCAGTCAAGT；
miR-126-F：CCTGAACCCTGAACCCTGA；
reverse primer:
miR-125a-5p-R：GGTCCCTGAGACCCTTTAAC；
hsa-miR-3182-R：TGCGCGCTTCTGTAGT；
hsa-miR-3675-5p-R：CCTCTATGGGGCTTCTGTAGA；
miR-4433b-5p-R：GATGTCCCACCCCCAC；
miR-126-R：GAGCTCGTACCGTGAGTAAT；
the probe sequence is as follows:
miR-125a-5p-P：AACCTGAAACTGATGCCCTG；
hsa-miR-3182-P：ATCAGTTCCCAGTTTCCCGT；
hsa-miR-3675-5p-P：AACCTGAAACTGATGCCCTG；
miR-4433b-5p-P：CCAGTCAAGTCAGCCATCAAG；
miR-126-P：GCGAACTGACCTGACCCTAA。
the invention further provides a kit for kawasaki disease detection, which comprises a reverse transcription reagent, an amplification reagent and the probe sequence, wherein the 5 'end of the probe nucleotide sequence is marked with a fluorescent reporter group, the 3' end of the probe nucleotide sequence is marked with a fluorescent quenching group, the fluorescent reporter group of the probe nucleotide sequence is at least one of FAM, HEX, VIC, ROX, cy, and the fluorescent quenching group is at least one of BHQ1, BHQ2 and MGB; the reverse transcription primer sequence is the reverse transcription primer; the amplification primers are the forward primer and the reverse primer.
The invention further provides a detection chip or device comprising the reverse transcription primer, the amplification primer and the probe sequence.
The invention further protects the application of the reverse transcription primer, the amplification primer and the probe sequence in preparing a reagent or a tool for predicting and assisting in diagnosing Kawasaki disease.
The invention further protects the application of the nucleic acid sequence combination in preparing reagents for qualitatively and/or quantitatively detecting miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and miR-126.
The invention further provides a method for detecting target genes miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and internal reference genes miR-126, which comprises the following steps:
1) Platelet miRNA is extracted from a sample, and reverse transcription primers miR-125a-5p-sl, hsa-miR-3182-sl, hsa-miR-3675-5p-sl, miR-4433b-5p-sl and miR-126-sl are added for reverse transcription to obtain cDNA;
2) Using cDNA as a template, performing amplification reaction by using a forward primer and a reverse primer, adding a probe sequence while performing amplification reaction, performing RT-qPCR analysis on an amplified product, judging fluorescence quantitative reaction Ct values of miRNAs of a target gene and an internal reference gene, and calculating the expression quantity R of a nucleic acid marker;
the forward primer comprises miR-125a-5p-F, hsa-miR-3182-F, hsa-miR-3675-5p-F, miR-4433b-5p-F, miR-126-F;
the reverse primer comprises miR-125a-5p-R, hsa-miR-3182-R, hsa-miR-3675-5p-R, miR-4433b-5p-R, miR-126-R;
the probe sequence comprises miR-125a-5P-P, hsa-miR-3182-P, hsa-miR-3675-5P-P, miR-4433b-5P-P, miR-126-P;
wherein the reverse transcription primer, amplification primer and probe sequences are as described above.
As a further improvement of the present invention, the amplification reaction system and conditions are as follows:
Premix Ex Taq（Probe qPCR）（2X）：10μl；
primer: F/R is 0.4 μl each;
and (3) probe: 0.8 μl;
cDNA：1μl；
ddH 2 o: make up to 20 μl;
reaction conditions: 95 ℃ for 30s,1 cycle; 95℃for 5s,60℃for 34s,40 cycles.
As a further improvement of the present invention, the reverse transcription includes: a genomic DNA removal step and a cDNA synthesis step; wherein, the reaction system in the genome DNA removal step is as follows:
5x gDNA Wiper Mix：2μl；
Template RNA：50ng；
sterile water without enzyme (RNase-free water): make up to 10 μl.
The reaction conditions were as follows: 42 ℃ for 2min;4 ℃ and infinity;
the reaction system in the cDNA synthesis step is as follows:
reverse transcription primer (10 um): 1 μl;
the mixed solution in the last step: 10 μl;
sterile water without enzyme (RNase-free water): 5 μl;
10x RT Mix：2μl；
HiScript Ⅱ Enzyme Mix：2μl；
the reaction conditions were as follows: 25 ℃ for 5min;50 ℃ for 15min;85 ℃ for 5min;4 ℃ and infinity. The reverse transcription product, cDNA, was obtained.
As a further improvement of the present invention, the expression level R of the nucleic acid marker is the ratio of the Ct value of the target gene to the Ct value of the reference gene.
As a further improvement of the present invention, the kawasaki disease positive can be judged when the expression amount R of the nucleic acid marker satisfies at least three of the following; the expression level R of the nucleic acid marker is determined to be uncertain when the expression level R satisfies the following two conditions; when the expression quantity R of the nucleic acid marker is less than two, judging as negative;
when the target gene is miR-125a-5p, R125a is less than or equal to 1.2;
when the target gene is hsa-miR-3182, R3182 is less than 1;
when the target gene is hsa-miR-3675-5p, R3675 is less than 1.3;
when the target gene is miR-4433b-5p, R4433b is less than or equal to 1.
The invention has the following beneficial effects: platelets are more readily available and have a higher platelet content than platelet exosomes. Platelet miRNA is extracted by collecting platelets in blood, reverse transcription is carried out on the miRNA, ct values of a target gene and an internal reference gene are detected through RT-qPCR, and corresponding results are obtained through calculation. The method can timely and accurately distinguish the Kawasaki disease from other heat-generating diseases (such as measles, hot eruption, gastroenteritis, hand-foot-and-mouth disease, herpes and the like), and improves the detection rate of early diagnosis of the Kawasaki disease. Therefore, the kit has great clinical application value for rapid diagnosis of the Kawasaki disease infant and provides technical support for further developing a rapid diagnosis kit used on the Kawasaki disease infant.
The miRNA in the platelets is collected, and compared with exosomes, the platelets are more easily obtained, are rich in content and are simple in extraction method. The method is more reasonable because the specific miRNA reference genes are arranged. The 4 miRNAs selected by the invention are obtained from the result of the second-generation high-depth sequencing, and are obtained by combining with the comprehensive analysis and scoring of clinical information, and the accuracy of the combined analysis of the 4 miRNAs is far greater than that of the detection of a single biological standard, so that the occurrence of false positive is reduced. The Kawasaki disease is more easily distinguished from common fever and the like. The invention has the advantages of convenient material taking, low cost, high sensitivity, good stability, easy operation and the like.
Drawings
In order to more clearly illustrate the embodiments of the invention or the technical solutions of the prior art, the drawings which are used in the description of the embodiments or the prior art will be briefly described, it being obvious that the drawings in the description below are only some embodiments of the invention, and that other drawings can be obtained according to these drawings without inventive faculty for a person skilled in the art.
FIG. 1 is a ROC curve of an m125a nucleic acid marker;
FIG. 2 is a ROC curve of an m4433b nucleic acid marker;
FIG. 3 is a ROC curve of the m3182 nucleic acid marker;
FIG. 4 is a ROC curve of an m3675 nucleic acid marker;
FIG. 5 is a ROC curve of a combination analysis of four nucleic acid markers.
Detailed Description
The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
miRNA: microRNA is a non-coding single-stranded RNA molecule which is coded by an endogenous gene and has the length of about 20-30 nucleotides, and the non-coding single-stranded RNA molecule participates in the expression regulation of a post-transcriptional gene in animals and plants.
Example 1 nucleic acid sequence combinations for Kawasaki disease detection
Including reverse transcription primers, amplification primers, and probe sequences.
The kawasaki disease detection samples were: human blood platelets.
The kawasaki disease detection markers are: miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and miR-126, wherein miR-126 serves as an internal reference marker.
The reverse transcription primer sequences were as follows:
miR-125a-5p-sl：CAGGGCATCAGCCTGAACCCTGAACCCTGAATAACCTG AAACTGATGCCCTGTCACAG；
hsa-miR-3182-sl：ACGGGAAACTGAGTTCAGTTCCCAGCGTCCATATCAGT TCCCAGTTTCCCGTGACTAC；
hsa-miR-3675-5p-sl：CAGGGCATCAGCCTGAACCCTGAACCCTGAATAAC CTGAAACTGATGCCCTGGAAATC；
miR-4433b-5p-sl：CTTGATGGCTGCCCGTCAAGCCAGTCAAGTATCCAGT CAAGTCAGCCATCAAGACAGGA；
miR-126-sl：TTAGGGTCAGGCCTGAACCCTGAACCCTGAATGCGAACTG ACCTGACCCTAACGCATT；
the amplification primer sequences were as follows:
forward primer:
miR-125a-5p-F：CCTGAACCCTGAACCCTGA；
hsa-miR-3182-F：AGTTCAGTTCCCAGCGTCC；
hsa-miR-3675-5p-F：CCTGAACCCTGAACCCTGA；
miR-4433b-5p-F：CCCGTCAAGCCAGTCAAGT；
miR-126-F：CCTGAACCCTGAACCCTGA；
reverse primer:
miR-125a-5p-R：GGTCCCTGAGACCCTTTAAC；
hsa-miR-3182-R：TGCGCGCTTCTGTAGT；
hsa-miR-3675-5p-R：CCTCTATGGGGCTTCTGTAGA；
miR-4433b-5p-R：GATGTCCCACCCCCAC；
miR-126-R：GAGCTCGTACCGTGAGTAAT；
the probe sequence is as follows:
miR-125a-5p-P：AACCTGAAACTGATGCCCTG；
hsa-miR-3182-P：ATCAGTTCCCAGTTTCCCGT；
hsa-miR-3675-5p-P：AACCTGAAACTGATGCCCTG；
miR-4433b-5p-P：CCAGTCAAGTCAGCCATCAAG；
miR-126-P：GCGAACTGACCTGACCCTAA。
the 5 'end of the probe nucleotide sequence is marked with a fluorescence report group, the 3' end is marked with a fluorescence quenching group, the fluorescence report group of the probe nucleotide sequence is at least one of FAM, HEX, VIC, ROX, cy, preferably FAM and HEX, and the fluorescence quenching group is at least one of BHQ1, BHQ2 and MGB, preferably BHQ1.
Example 2A kit for Kawasaki disease detection
Including reverse transcription reagents, amplification reagents, and probe sequences.
The probe sequence comprises miR-125a-5P-P, hsa-miR-3182-P, hsa-miR-3675-5P-P, miR-4433b-5P-P, miR-126-P; the 5 'end of the probe nucleotide sequence is marked with a fluorescence report group, the 3' end is marked with a fluorescence quenching group, the fluorescence report group of the probe nucleotide sequence is at least one of FAM, HEX, VIC, ROX, cy, and the fluorescence quenching group is at least one of BHQ1, BHQ2 and MGB.
The reverse transcription primer sequence comprises miR-125a-5p-sl, hsa-miR-3182-sl, hsa-miR-3675-5p-sl, miR-4433b-5p-sl and miR-126-sl; the amplification primers are forward primers and reverse primers; the forward primer comprises miR-125a-5p-F, hsa-miR-3182-F, hsa-miR-3675-5p-F, miR-4433b-5p-F, miR-126-F; the reverse primer comprises miR-125a-5p-R, hsa-miR-3182-R, hsa-miR-3675-5p-R, miR-4433b-5p-R, miR-126-R.
Example 3 detection method of Kawasaki disease
(1) The extraction method of the platelet miRNA comprises the following steps: platelet miRNA was extracted using an extraction kit, namely life brand mirVana miRNA Isolation kit (cat# AM 1561). The method comprises the following specific steps:
1) The platelet sample to be extracted was taken out of the-80 ℃ refrigerator, and cells were slowly pipetted into suspension in cold PBS solution using a pipette, and then placed on ice.
2) To the centrifuge tube, 300ul of Lysis/Binding Buffer was added, vortexed for 30s, until no sediment was present, and centrifuged instantaneously.
3) 30ul miRNA Homogenate Additive was added to the centrifuge tube, vortexed, centrifuged briefly, and incubated on ice for 10min.
4) To the centrifuge tube was added 300ul of the phenol-chloroform-isoamyl alcohol mixture (25: 24: 1) Vortex mixing.
5) Centrifuge at 10000 Xg for 5min at 4 ℃.
6) The supernatant was transferred to a new 1.5ml centrifuge tube, 375ul of 100% ethanol was added, mixed upside down and centrifuged instantaneously.
7) The solution was transferred to a centrifuge column, centrifuged at 10000 Xg for 15s, and the liquid in the collection column was discarded.
8) 700ul Wash Solution 1 was added to the column, centrifuged at 10000 Xg for 15s, and the liquid in the column was discarded.
9) 500ul Wash Solution 2/3 was added to the column, centrifuged at 10000 Xg for 15s, and the liquid in the column was discarded.
10 Idling at 10000 Xg for 2min, and air drying at room temperature for 2min.
11 Transfer the collection column to a new 1.5ml centrifuge tube, add 100ul of 95℃solution thereto, incubate for 2min, centrifuge for 2min at 10000 Xg, and obtain platelet miRNA.
(2) Reverse transcription:
adding reverse transcription primers (miR-125 a-5p-sl, hsa-miR-3182-sl, hsa-miR-3675-5p-sl, miR-4433b-5p-sl and miR-126-sl) for reverse transcription to obtain cDNA;
1) Genomic DNA removal:
the reaction system:
5x gDNA Wiper Mix：2μl；
Template RNA：50ng；
sterile water without enzyme (RNase-free water): make up to 10 μl.
Reaction conditions: 42 ℃ for 2min;4 ℃ and infinity.
2) cDNA Synthesis
The reaction system:
reverse transcription primer (10 μm): 1 μl;
the mixed solution in the last step: 10 μl;
sterile water without enzyme (RNase-free water): 5 μl;
10x RT Mix：2μl；
HiScript Ⅱ Enzyme Mix：2μl；
reaction conditions: 25 ℃ for 5min;50 ℃ for 15min;85 ℃ for 5min;4 ℃ and infinity. The reverse transcription product, cDNA, was obtained.
(3) Amplification reaction:
using cDNA as template, forward primer and reverse primer to make PCR amplification reaction, and adding probe sequence at the same time of amplification reaction.
The amplification reaction system is as follows:
Premix Ex Taq（Probe qPCR）（2X）：10μl；
primer: F/R is 0.4 μl each;
and (3) probe: 0.8 μl;
cDNA：1μl；
ddH 2 o: make up to 20 μl;
the amplification reaction conditions were as follows: 95 ℃ for 30s,1 cycle; 95℃for 5s,60℃for 34s,40 cycles.
(4) Analysis of results:
and (3) carrying out RT-qPCR analysis on the amplified product, judging the fluorescence quantitative reaction Ct value of miRNA of the target gene and the reference gene, and calculating the expression quantity R of the nucleic acid marker and the ratio of the Ct value of the target gene to the Ct value of the reference gene.
When the expression quantity R of the nucleic acid marker meets at least three of the following conditions, the positive Kawasaki disease can be judged;
when the expression quantity R of the nucleic acid marker meets the following two conditions, judging that the expression quantity R is uncertain, and retesting after a certain period is needed;
when the expression level R of the nucleic acid marker satisfies less than two of the following conditions, judging as negative;
when the target gene is miR-125a-5p, R125a is less than or equal to 1.2;
when the target gene is hsa-miR-3182, R3182 is less than 1;
when the target gene is hsa-miR-3675-5p, R3675 is less than 1.3;
when the target gene is miR-4433b-5p, R4433b is less than or equal to 1.
Example 4 specificity test
The test takes 6 normal human samples and 17 Kawasaki patient samples. Platelets from kawasaki patients and healthy persons were extracted according to the extraction method in example 3, a miRNA library was constructed, and second generation sequencing was performed for bioinformatics analysis. According to analysis of sequencing results, the expression of miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p and miR-4433b-5p 4 miRNAs in platelets of a Kawasaki patient is far higher than that of platelets of a healthy person (Table 1), and a nucleic acid marker R value of the healthy person and the Kawasaki patient is obtained (Table 2); miR-126 is stably expressed in platelets of Kawasaki patients and healthy people as an internal reference gene.
TABLE 1 comparison of nucleic acid markers R for normal and Kawasaki patients
TABLE 2 nucleic acid marker R values for normal and Kawasaki patients
Doctor diagnosis miR-125a-5p and internal reference substance Ratio (R125 a) miR-4433b-5p to internal reference value （R4433b） hsa-miR-3182 to internal reference value （R3182） hsa-miR-3675-5p and internal reference value （R3675）
Case 1 Kawasaki negative 1.2122 1.3261 0.9306 1.2775
Case 2 Kawasaki negative 1.2969 0.9289 1.0663 1.3256
Case 3 Kawasaki negative 1.4192 1.0145 1.0062 1.3790
Case 4 Kawasaki negative 1.3910 0.8874 0.9807 1.3487
Case 5 Kawasaki negative 1.4518 0.9267 0.9407 1.3558
Case 6 Kawasaki negative 1.7104 0.9948 1.0597 1.2801
Case 7 Kawasaki positive 1.0139 0.9582 0.8033 1.1251
Case 8 Kawasaki positive 1.2692 0.8083 0.8542 0.6376
Case 9 Kawasaki positive 1.6996 0.9730 1.0403 0.6816
Case 10 Kawasaki positive 0.9573 0.9330 0.7727 1.0434
Case 11 Kawasaki positive 0.9832 0.9358 0.7682 1.0367
Case 12 Kawasaki positive 1.0249 0.9543 0.7881 1.1045
Case 13 Kawasaki positive 0.9578 0.9512 1.1445 1.2076
Case 14 Kawasaki positive 0.9298 0.9169 1.0788 1.1656
Case 15 Kawasaki positive 1.3355 0.9932 0.9796 1.4960
Case 16 Kawasaki positive 1.2967 0.9499 0.9691 0.4306
Case 17 Kawasaki positive 1.3076 0.8465 0.9079 1.2913
Case 18 Kawasaki positive 1.3822 0.8440 0.7756 1.1684
Case 19 Kawasaki positive 1.3902 0.8227 0.8865 1.1466
Case 20 Kawasaki positive 1.0392 0.9691 1.1036 1.2097
Case 21 Kawasaki positive 1.0130 1.0135 1.2283 1.2757
Case 22 Kawasaki positive 0.9143 0.9103 1.0710 1.1583
Case 23 Kawasaki positive 1.4259 0.8180 0.8243 1.1314
TABLE 3 determination results of normal person and Kawasaki patient
Doctor diagnosis miR-125a-5p and internal reference Value (R) miR-4433b-5p to internal reference value （R） hsa-miR-3182 to internal reference value （R） hsa-miR-3675-5p and internal reference value （R） Kit judging knot Fruit set
Case 1 Kawasaki negative Negative of Negative of Positive and negative Positive and negative Uncertainty of
Case 2 Kawasaki negative Negative of Positive and negative Negative of Negative of Negative of
Case 3 Kawasaki negative Negative of Negative of Negative of Negative of Negative of
Case 4 Kawasaki negative Negative of Positive and negative Positive and negative Negative of Uncertainty of
Case 5 Kawasaki negative Negative of Positive and negative Positive and negative Negative of Uncertainty of
Case 6 Kawasaki negative Negative of Positive and negative Negative of Positive and negative Uncertainty of
Case 7 Kawasaki positive Positive and negative Positive and negative Positive and negative Positive and negative Positive and negative
Case 8 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
Case 9 Kawasaki positive Negative of Positive and negative Negative of Positive and negative Uncertainty of
Case 10 Kawasaki positive Positive and negative Positive and negative Positive and negative Positive and negative Positive and negative
Case 11 Kawasaki positive Positive and negative Positive and negative Positive and negative Positive and negative Positive and negative
Case 12 Kawasaki positive Positive and negative Positive and negative Positive and negative Positive and negative Positive and negative
Case 13 Kawasaki positive Positive and negative Positive and negative Negative of Positive and negative Positive and negative
Case 14 Kawasaki positive Positive and negative Positive and negative Negative of Positive and negative Positive and negative
Case 15 Kawasaki positive Negative of Positive and negative Positive and negative Negative of Uncertainty of
Case 16 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
Case 17 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
Case 18 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
Case 19 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
Case 20 Kawasaki positive Positive and negative Positive and negative Negative of Positive and negative Positive and negative
Case 21 Kawasaki positive Positive and negative Negative of Negative of Positive and negative Uncertainty of
Case 22 Kawasaki positive Positive and negative Positive and negative Negative of Positive and negative Positive and negative
Case 23 Kawasaki positive Negative of Positive and negative Positive and negative Positive and negative Positive and negative
23 ROC curve analysis results:
the sensitivity and the specificity are obtained by taking the m125a, m4433b, m3182 and m3675 nucleic acid markers as judgment standards and counting true positives, false positives, true negatives and false negatives. The results are shown in Table 4. In the ROC curves (fig. 1 to 5), the areas under the ROC curves are 0.8137,0.6764,0.6274,0.9215,0.9411, respectively, indicating good determination results. ROC curve is the subject working characteristic curve, ordinate (sensitivity) is true positive rate, and abscissa (1-specificity) is false positive rate. AUC values for ROC curves represent the area under the curve, typically between 0.5 and 1, with larger values representing better classification of the curve. AUC (area under the curve) for the four RNA combination assays was 0.9411, indicating good classification effect for healthy and kawasaki patients. In a combination analysis of four nucleic acid markers, when three or more nucleic acid markers have R values meeting the criterion, the sample is highly likely to be considered positive for Kawasaki disease. The results show that the sensitivity, the specificity and the accuracy of the detection of the four nucleic acid markers are 100.00%,66.67% and 86.96%, which indicates that the detection method has good detection capability.
TABLE 4 sensitivity and specificity of nucleic acid markers
Nucleic acid markers m125a m4433b m3182 m3675 Four marker combination analysis
Sensitivity of 100.00% 80.00% 82.35% 90.00% 100.00%
Specificity of the sample 42.86% 66.67% 25.00% 44.44% 66.67%
Accuracy of 65.22% 78.26% 73.91% 95.65% 86.96%
Compared with the prior art, the platelet is easier to obtain compared with the platelet exosome, and the platelet content is high. Platelet miRNA is extracted by collecting platelets in blood, reverse transcription is carried out on the miRNA, ct values of a target gene and an internal reference gene are detected through RT-qPCR, and corresponding results are obtained through calculation. The method can timely and accurately distinguish the Kawasaki disease from other heat-generating diseases (such as measles, hot eruption, gastroenteritis, hand-foot-and-mouth disease, herpes and the like), and improves the detection rate of early diagnosis of the Kawasaki disease. Therefore, the kit has great clinical application value for rapid diagnosis of the Kawasaki disease infant and provides technical support for further developing a rapid diagnosis kit used on the Kawasaki disease infant.
The miRNA in the platelets is collected, and compared with exosomes, the platelets are more easily obtained, are rich in content and are simple in extraction method. The method is more reasonable because the specific miRNA reference genes are arranged. The 4 miRNAs selected by the invention are obtained from the result of the second-generation high-depth sequencing, and are obtained by combining with the comprehensive analysis and scoring of clinical information, and the accuracy of the combined analysis of the 4 miRNAs is far greater than that of the detection of a single biological standard, so that the occurrence of false positive is reduced. The Kawasaki disease is more easily distinguished from common fever and the like. The invention has the advantages of convenient material taking, low cost, high sensitivity, good stability, easy operation and the like.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.
Sequence listing
<110> Sunday, inc. of precision medical science and technology (Shanghai)
<120> primer set, probe and kit for Kawasaki disease detection
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 58
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 1
cagggcatca gcctgaaccc tgaaccctga ataacctgaa actgatgccc tgtcacag 58
<210> 2
<211> 58
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 2
acgggaaact gagttcagtt cccagcgtcc atatcagttc ccagtttccc gtgactac 58
<210> 3
<211> 58
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 3
cagggcatca gcctgaaccc tgaaccctga ataacctgaa actgatgccc tggaaatc 58
<210> 4
<211> 59
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 4
cttgatggct gcccgtcaag ccagtcaagt atccagtcaa gtcagccatc aagacagga 59
<210> 5
<211> 58
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 5
ttagggtcag gcctgaaccc tgaaccctga atgcgaactg acctgaccct aacgcatt 58
<210> 6
<211> 19
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 6
cctgaaccct gaaccctga 19
<210> 7
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 7
ggtccctgag accctttaac 20
<210> 8
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 8
aacctgaaac tgatgccctg 20
<210> 9
<211> 19
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 9
agttcagttc ccagcgtcc 19
<210> 10
<211> 16
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 10
tgcgcgcttc tgtagt 16
<210> 11
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 11
atcagttccc agtttcccgt 20
<210> 12
<211> 19
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 12
cctgaaccct gaaccctga 19
<210> 13
<211> 21
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 13
cctctatggg gcttctgtag a 21
<210> 14
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 14
aacctgaaac tgatgccctg 20
<210> 15
<211> 19
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 15
cccgtcaagc cagtcaagt 19
<210> 16
<211> 16
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 16
gatgtcccac ccccac 16
<210> 17
<211> 21
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 17
ccagtcaagt cagccatcaa g 21
<210> 18
<211> 19
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 18
cctgaaccct gaaccctga 19
<210> 19
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 19
gagctcgtac cgtgagtaat 20
<210> 20
<211> 20
<212> DNA
<213> Homo sapiens (Homo sapiens)
<400> 20
gcgaactgac ctgaccctaa 20

Claims (5)

1. A nucleic acid sequence combination for kawasaki disease detection comprising a reverse transcription primer, an amplification primer and a probe sequence, characterized in that the nucleic acid sequence combination is capable of effective qualitative/quantitative detection of miR-125a-5p, hsa-miR-3182, hsa-miR-3675-5p, miR-4433b-5p and miR-126 in human blood platelets, wherein miR-126 is used as an internal reference marker;
wherein, the reverse transcription primer sequence is as follows:
miR-125a-5p-sl：
CAGGGCATCAGCCTGAACCCTGAACCCTGAATAACCT GAAACTGATGCCCTGTCACAG；
hsa-miR-3182-sl：
ACGGGAAACTGAGTTCAGTTCCCAGCGTCCATATCAG TTCCCAGTTTCCCGTGACTAC；
hsa-miR-3675-5p-sl：
CAGGGCATCAGCCTGAACCCTGAACCCTGAATAAC
CTGAAACTGATGCCCTGGAAATC；
miR-4433b-5p-sl：
CTTGATGGCTGCCCGTCAAGCCAGTCAAGTATCCAGT CAAGTCAGCCATCAAGACAGGA；
miR-126-sl：
TTAGGGTCAGGCCTGAACCCTGAACCCTGAATGCGAACTG ACCTGACCCTAACGCATT；
the amplification primer sequences were as follows:
forward primer:
miR-125a-5p-F：CCTGAACCCTGAACCCTGA；
hsa-miR-3182-F：AGTTCAGTTCCCAGCGTCC；
hsa-miR-3675-5p-F：CCTGAACCCTGAACCCTGA；
miR-4433b-5p-F：CCCGTCAAGCCAGTCAAGT；
miR-126-F：CCTGAACCCTGAACCCTGA；
reverse primer:
miR-125a-5p-R：GGTCCCTGAGACCCTTTAAC；
hsa-miR-3182-R：TGCGCGCTTCTGTAGT；
hsa-miR-3675-5p-R：CCTCTATGGGGCTTCTGTAGA；
miR-4433b-5p-R：GATGTCCCACCCCCAC；
miR-126-R：GAGCTCGTACCGTGAGTAAT；
the probe sequence is as follows:
miR-125a-5p-P：AACCTGAAACTGATGCCCTG；
hsa-miR-3182-P：ATCAGTTCCCAGTTTCCCGT；
hsa-miR-3675-5p-P：AACCTGAAACTGATGCCCTG；
miR-4433b-5p-P：CCAGTCAAGTCAGCCATCAAG；
miR-126-P：GCGAACTGACCTGACCCTAA。
2. a kit for kawasaki disease detection, comprising a reverse transcription reagent, an amplification reagent and the probe sequence of claim 1, wherein the 5 'end of the probe nucleotide sequence is marked with a fluorescent reporter group, the 3' end of the probe nucleotide sequence is marked with a fluorescent quenching group, the fluorescent reporter group of the probe nucleotide sequence is at least one of FAM, HEX, VIC, ROX, cy5, and the fluorescent quenching group is at least one of BHQ1, BHQ2 and MGB; the reverse transcription primer sequence is the reverse transcription primer of claim 1; the amplification primers are the forward primer and the reverse primer of claim 1.
3. A detection chip or device comprising the reverse transcription primer, amplification primer and probe sequence of claim 1.
4. Use of the reverse transcription primer, amplification primer and probe sequence of claim 1 for preparing a reagent for predicting and assisting in diagnosing kawasaki disease.
5. The use according to claim 4, wherein the kawasaki disease is judged positive when the expression level R of the nucleic acid marker satisfies at least three of the following; the expression level R of the nucleic acid marker is determined to be uncertain when the expression level R satisfies the following two conditions; when the expression level R of the nucleic acid marker satisfies less than two of the following conditions, judging as negative;
when the target gene is miR-125a-5p, R125a is less than or equal to 1.2;
when the target gene is hsa-miR-3182, R3182 is less than 1;
when the target gene is hsa-miR-3675-5p, R3675 is less than 1.3;
when the target gene is miR-4433b-5p, R4433b is less than or equal to 1.
CN202210148577.1A 2022-02-18 2022-02-18 Primer group, probe and kit for Kawasaki disease detection Active CN114277127B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210148577.1A CN114277127B (en) 2022-02-18 2022-02-18 Primer group, probe and kit for Kawasaki disease detection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210148577.1A CN114277127B (en) 2022-02-18 2022-02-18 Primer group, probe and kit for Kawasaki disease detection

Publications (2)

Publication Number Publication Date
CN114277127A CN114277127A (en) 2022-04-05
CN114277127B true CN114277127B (en) 2023-12-05

Family

ID=80881973

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210148577.1A Active CN114277127B (en) 2022-02-18 2022-02-18 Primer group, probe and kit for Kawasaki disease detection

Country Status (1)

Country Link
CN (1) CN114277127B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104450901A (en) * 2014-11-27 2015-03-25 广州赛哲生物科技有限公司 Nucleic acid marker for rapidly diagnosing kawasaki disease and kit of nucleic acid marker
CN105821119A (en) * 2016-01-29 2016-08-03 苏州大学附属儿童医院 Nucleic acid label and kit for auxiliary diagnosis of Kawasaki disease
CN106701962A (en) * 2016-12-28 2017-05-24 广州赛哲生物科技股份有限公司 Primer group, probe and kit for kawasaki disease detection
CN107502664A (en) * 2017-09-18 2017-12-22 苏州贝斯派生物科技有限公司 A kind of biomarker and kit and purposes for being used to diagnose Kawasaki disease
CN110205377A (en) * 2019-06-28 2019-09-06 上海千贝医疗科技有限公司 The assessment in advance of Kawasaki disease risk

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104450901A (en) * 2014-11-27 2015-03-25 广州赛哲生物科技有限公司 Nucleic acid marker for rapidly diagnosing kawasaki disease and kit of nucleic acid marker
CN105821119A (en) * 2016-01-29 2016-08-03 苏州大学附属儿童医院 Nucleic acid label and kit for auxiliary diagnosis of Kawasaki disease
CN106701962A (en) * 2016-12-28 2017-05-24 广州赛哲生物科技股份有限公司 Primer group, probe and kit for kawasaki disease detection
WO2018120484A1 (en) * 2016-12-28 2018-07-05 广州赛哲生物科技股份有限公司 Primer set, probe, and kit for kawasaki disease detection
CN107502664A (en) * 2017-09-18 2017-12-22 苏州贝斯派生物科技有限公司 A kind of biomarker and kit and purposes for being used to diagnose Kawasaki disease
CN110205377A (en) * 2019-06-28 2019-09-06 上海千贝医疗科技有限公司 The assessment in advance of Kawasaki disease risk

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
A plasma mir-125a-5p as a novel biomarker for Kawasaki disease and induces apoptosis in HUVECs;Zhuoying Li等;PLOS ONE;1-15 *
MiR-125a-5p 靶向胰岛素样生长因子1 受体调节川崎病中 内皮细胞的增殖和迁移;吕爱婷等;临床与病理杂志;211-220 *
MiR-155、miR-208和miR-499在川崎病患儿中的表达检测与分析;叶佳云;陈雪贞;廖雄宇;梁欢欣;钟奕;覃丽君;;岭南现代临床外科(06);63-67 *

Also Published As

Publication number Publication date
CN114277127A (en) 2022-04-05

Similar Documents

Publication Publication Date Title
CN107365852B (en) Application of lung cancer related microRNA molecular marker in serum exosome and detection kit thereof
JP6092655B2 (en) Classification of test body fluid samples
CN113637778B (en) Kit and method for detecting brucella
CN104328164A (en) Kit for detecting human EGFR gene mutation by using fluorescence probe hybridization method
CN109609630B (en) Molecular marker for early gastric cancer diagnosis and application thereof
CN111187828B (en) Composition, kit and method for detecting polymorphism of human folic acid metabolism gene
CN114277127B (en) Primer group, probe and kit for Kawasaki disease detection
EP4253557A1 (en) Primer/probe design method, detection composition and kit for mirna detection
CN112609002B (en) Peripheral blood miRNA colon cancer diagnosis marker combination and detection kit thereof
CN114410795A (en) Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker
CN108998528B (en) Lung cancer diagnosis molecular marker lncRNA LINC00516, kit and application thereof
CN111172282A (en) Application of exosome miRNA in preparation of lung cancer early diagnosis kit and lung cancer early diagnosis detection kit
US11021756B2 (en) MiRNA markers for the diagnosis of osteosarcoma
CN116121245B (en) Small molecule RNA and application thereof in early diagnosis of endometriosis
CN116732171B (en) Primer probe combination for screening colorectal cancer methylation double sites and kit thereof
CN110241219B (en) Application of MYOM3 in melanoma metastasis
CN113817818B (en) Tool for diagnosing allergic airway inflammation
WO2024036785A1 (en) Dna methylation marker combination for early screening of gastric cancer and kit
CN117448448B (en) IL-1B gene detection primer probe combination, kit and application thereof
CN113337608B (en) Combined marker for early diagnosis of liver cancer and application thereof
CN113774123B (en) MicroRNA molecular marker combination for predicting immune response level of HIV infected person and application thereof
CN106048050A (en) Method for determining colorectal cancer suffering possibility of individuals in vitro and kit
CN109880898B (en) Application of hsa-miR-23b-5p as acute altitude reaction susceptible molecular marker and kit
CN109880899B (en) Application of hsa-miR-134-3p as acute altitude reaction susceptible molecular marker and kit
CN109943632B (en) Application of hsa-miR-1183 as acute altitude stress susceptible molecular marker and kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
OL01 Intention to license declared
OL01 Intention to license declared
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20220405

Assignee: Shanghai Haoen Medical Technology Co.,Ltd.

Assignor: Daozhi precision medicine technology (Shanghai) Co.,Ltd.

Contract record no.: X2024980005551

Denomination of invention: Primer sets, probes, and test kits for detecting Kawasaki disease

Granted publication date: 20231205

License type: Open License

Record date: 20240510