CN114277101A - Oligonucleotide system for detecting nucleic acid sample variation, application and detection method based on system - Google Patents
Oligonucleotide system for detecting nucleic acid sample variation, application and detection method based on system Download PDFInfo
- Publication number
- CN114277101A CN114277101A CN202111519899.4A CN202111519899A CN114277101A CN 114277101 A CN114277101 A CN 114277101A CN 202111519899 A CN202111519899 A CN 202111519899A CN 114277101 A CN114277101 A CN 114277101A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide
- sequence
- target template
- strand
- free energy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an oligonucleotide system for detecting nucleic acid sample variation, application and a detection method based on the system, and relates to the technical field of gene detection. The oligonucleotide system provided by the invention is based on the competition mechanism of a plurality of oligonucleotide chains, the amplification of a non-target template is suppressed while the amplification efficiency of the target template is ensured, non-specific signals caused by the non-target template can be further reduced, and the specificity of ultra-low frequency variation information is ensured. The oligonucleotide system can detect variation information of as low as one-thirty-one ten-thousandth in a nucleic acid sample, simultaneously ensure enough specificity, and can reach the MR4.5 level or even the MR5.0 level when detecting the residual of a tiny lesion.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to an oligonucleotide system for detecting nucleic acid sample variation, application and a detection method based on the system.
Background
With the deep understanding of Disease mechanisms, the development of DNA molecular diagnostic technology towards higher and higher sensitivity and specificity is urgently required, in the technical field of Next Generation Sequencing (Next Generation Sequencing), together with molecular tagging technology, when the DNA input amount is enough, the Sequencing depth is enough, and the cost input is enough, people can detect variation information below ten thousandth or even below ten thousandth, the technologies can be used in an important application field of Minimal Residual Disease (MRD), the MRD phenomenon refers to a phenomenon that malignant tumor cells still remain in a body of a malignant Disease patient, such as a cancer patient, during or after treatment, and the residue can cause relapse or other poor prognosis.
For example, in the treatment of leukemia with targeted drugs, a molecular response (abbreviated as MR) is required to reflect the efficacy of the treatment regimen. MR is an order of magnitude concept, identified by numbers, such as MR3.0 (this level is also called the major molecular response, MMR), representing a 3 log reduction of leukemic cells, with a residual of 0.1%; MR4.5, namely the leukemia cells are reduced by 4.5 log levels, and the residual quantity is 0.0032%; MR5, a 5 log reduction in leukemic cells, with a residual population of 0.001%. Therefore, it can be seen that MR is an index indicating how far leukemia cells are cleared, and plays a role in indicating the medication effect and the treatment regimen, and from the therapeutic effect, if the patient turns negative, which means that the leukemia cells are reduced to a degree approved by a doctor, the degree as low as possible depends entirely on the laboratory detection sensitivity, in other words, if the detection sensitivity of a certain detection method can only reach the level of MR3.0 and is approved by the doctor, the negative can only reach the residual quantity of leukemia cells below 0.1%, if the detection sensitivity can reach MR4.5, the negative can mean that the residual quantity of leukemia cells is below 0.0032%, which means that the possibility of relapse is less than MR3.0, and thus, the smaller the MR value, the greater the possibility of patient recovery, and the less easy relapse, and the detection sensitivity of most of the domestic laboratories can only reach the level of MR3.0(MMR), from a doctor-approved perspective, the technology of MR4.5 level, even MR5.0 level, is in fact clinically very demanding.
The existing guidelines and expert consensus define the clinical need for monitoring MRD residual cells, and the current technologies that can meet the MRD monitoring needs mainly include: (1) multiparameter Flow Cytometry (MFC), a relatively rapid, quantitative method for identifying cancer cells, can detect circulating tumor cells in blood with a peak sensitivity of 0.01%, i.e., 1 cancer cell out of 1 ten thousand normal cells, and 6-color (or more) flow cytometry analysis is the most common method for detecting abnormal MRD immunophenotypes; (2) the next generation sequencing NGS is a very sensitive DNA sequencing method, and the peak sensitivity is 0.0001 percent by matching with the molecular tag technology, namely 1 cancer cell in 100 ten thousand normal cells. NGS can detect the clonal rearrangement of B/T cell antigen receptor gene, and has been approved and recommended by experts at home and abroad as a novel MRD detection method. The international clinical practice guideline (NCCN) of 2017 edition and the Chinese multiple myeloma diagnosis and treatment guideline of 2017 edition both recommend the NGS as the MRD detection method. Although the NGS technology is extremely sensitive to MRD detection, in order to ensure that the detection result has good specificity, the sequencing depth is required to be very high, so that the detection cost is high, the time consumption is long, and the detection is required to be selected in different application fields; (3) the third technical scheme is a polymerase chain reaction technology which is divided into qPCR or RT-qPCR, the sensitivity of the polymerase chain reaction technology is 0.1 percent per thousand, the technical platform has the advantages of simple operation, large installation amount in hospitals, wide application range, low cost and the like, but the sensitivity and the specificity of the polymerase chain reaction technology are inferior to those of the former two technical schemes, so that the development of the technology with high sensitivity and good specificity on the PCR technical platform can be more beneficial to popularization and better accords with the situation of China. Therefore, the present invention is directed to a method for detecting an ultra-low frequency variation of a nucleic acid sample based on PCR technology.
Disclosure of Invention
In order to solve the technical problems, the invention provides an oligonucleotide system for detecting the variation of a nucleic acid sample, which is arranged based on a multiple competition mechanism, can detect the ultra-low frequency variation information of more than 4 target template molecules in a part, namely more than one thirty-one in a sample, and simultaneously provides a PCR technology for detecting the ultra-low frequency variation of the nucleic acid sample based on a PCR technology platform, and has great potential in the aspect of detecting the residual of a tiny focus.
The invention provides an oligonucleotide system for detecting nucleic acid sample variation, which at least comprises three oligonucleotide chains:
the first oligonucleotide chain is provided with a first sequence and a second sequence which are connected, the first sequence is complementary with a non-target template base, has one or a plurality of base differences with the complementary sequence of the target template and is competitively combined with the target template with the second oligonucleotide chain;
the second oligonucleotide strand is complementary to the target template base, differs from the complementary sequence of the non-target template by one or more bases, and competitively binds to the non-target template with the first oligonucleotide strand, without binding to, or overlapping with, the third oligonucleotide strand;
the third oligonucleotide chain is provided with a third sequence and a fourth sequence which are connected, the third sequence is the same as the base sequence of the second sequence and is competitively combined with the target template and the non-target template, and the fourth sequence is complementary with the upstream sequence base of the difference sequence of the target template and the non-target template;
the target template has at least one base variation relative to the non-target template, and the variation site of the target template and the site corresponding to the variation site in the non-target template are located within the range covered by the first sequence or the second oligonucleotide strand.
The oligonucleotide system of the invention is schematically shown in FIG. 1. The oligonucleotide strand FP (corresponding to the third oligonucleotide strand) is divided into two parts, FP1 (corresponding to the fourth sequence) and FP2 (corresponding to the third sequence) in the direction from the 5 'end to the 3' end; the oligonucleotide strand PB (corresponding to the first oligonucleotide strand) is divided into two parts, PB2 (corresponding to the second sequence) and PB1 (corresponding to the first sequence) from the 5 'to the 3' end; oligonucleotide strand CB (corresponding to the second oligonucleotide strand) has only a portion CB 1; tm represents the target template, tf represents the non-target template, and both contain two sequences com1 and com2, com1 represents fp2 and pb2 competitive binding moieties, and com2 represents cb1 and pb1 competitive binding moieties. In this diagram, taking the mutation of a site as an example, tf and tm are different in the information at the triangle marks of mut and ref, and the variation of the nucleic acid sample to be detected in the present invention refers to the mut region on tm, which is located in the range covered by the oligonucleotide PB or CB. Wherein the oligonucleotide strands FP, PB and CB are complementary to the corresponding regions of the non-target template tf and the target template tm in the sample, and there is no competition in the non-overlapping portions of the oligonucleotide strands FP and CB.
For the sake of understanding, the oligonucleotide system of the present invention has multiple competition mechanisms, and is described by way of example in FIG. 1: (1) the first re-competition relationship is the competition of fp2 with pb 2. FP2 and PB2 have the same base sequence and are complementary to the com1 region at tf and tm, so that when oligonucleotide strands PB and FP are to bind to both non-target template tf and target template tm, FP2 and PB2 form a competitive relationship, i.e., competitively bind to the com1 region; (2) the second competition relationship is the competition of cb1 with pb1 for the non-target template tf. The base sequences in the cb1 and pb1 regions are overlapped, pb1 is complementary to the non-target template tf, and the cb1 sequence, although different from the non-target template tf by one or a plurality of bases, competes with the pb1 region to form a selective difference by jointly competing with the non-target template tf, so that the high-specificity binding of cb1 to the target template tm is promoted; (3) the third competition relationship is the competition of cb1 with pb1 for the target template tm. The base sequences in the pb1 and cb1 regions are overlapped, cb1 is complementary to the target template tm, and the pb1 sequence is different from the target template tm by one or a plurality of bases, but pb1 competes with the cb1 region and competes with the target template tm together, which is favorable for forming high-specificity binding of cb1 and the target template tm.
Further, for the target template, the gibbs free energy of the third oligonucleotide strand is less than the gibbs free energy of the first oligonucleotide strand, and the gibbs free energy of the first sequence is greater than the gibbs free energy of the second oligonucleotide strand; then, at the same temperature, the second and third oligonucleotide strands bind more spontaneously to the target template;
for non-target templates, the gibbs free energy of the third oligonucleotide strand is greater than the gibbs free energy of the first oligonucleotide strand, and the gibbs free energy of the first sequence is less than the gibbs free energy of the third oligonucleotide strand; then, at the same temperature, the first oligonucleotide strand binds more spontaneously to the non-target template.
Further, 1M Na was added at 45 ℃+Under the condition of concentration, the water-soluble organic acid,
the Gibbs free energy of the first oligonucleotide strand, the Gibbs free energy of the second oligonucleotide strand, or the Gibbs free energy of the third oligonucleotide strand satisfies-57.96 kcal/mol.ltoreq.G.ltoreq.14.81 kcal/mol;
the gibbs free energy of the second or third sequence satisfies-1.27 kcal/mol ≤ ag ≤ 16.96 kcal/mol;
the difference between the Gibbs free energy of the first oligonucleotide strand and the Gibbs free energy of the second oligonucleotide strand satisfies 0.42kcal/mol ≦ Δ G ≦ 14.64 kcal/mol; the difference between the Gibbs free energy of the first oligonucleotide strand and the Gibbs free energy of the third oligonucleotide strand satisfies 8.36kcal/mol ≦ Δ G ≦ 15.91 kcal/mol.
Further, the oligonucleotide system comprises two or more first oligonucleotide strands, wherein the two or more first oligonucleotide strands are specifically combined with different non-target templates respectively, the sequence of each first oligonucleotide strand differs by a plurality of bases, but can be matched with a corresponding certain non-target template, and the function is to prevent the second oligonucleotide strand and the third oligonucleotide strand from being combined with the non-target template. In other words, there may be multiple forms of non-target templates tf in the sample to be tested, denoted as tf (m1), where m1> -1, and for each non-target template tf, a corresponding oligonucleotide chain PB needs to be designed, denoted as PB (m2), where m2> -1; for example, when m1 is m2 is 3, PB (1) and tf (1), PB (2) and tf (2), and PB (3) and tf (3) are correspondingly matched, and PB (1) can competitively interfere with the binding of PB (2) and tf (2) and PB (3) and tf (3), in order to improve the specificity of the binding of PB (2) and tf (2) and PB (3) and tf (3), and similarly, PB (2) has similar effects on PB (1) and tf (1), PB (3) and tf (3), and PB (3) has similar effects on PB (1) and tf (1), PB (2) and tf (2).
Further, the number of types of non-target templates is equal to or greater than the number of types of first oligonucleotide strands.
Furthermore, the oligonucleotide system comprises two or more second oligonucleotide chains, the two or more second oligonucleotide chains are respectively and specifically combined with different target templates, and the sequence of each second oligonucleotide chain differs by a plurality of bases and can be matched with a corresponding certain target template. In other words, there may be multiple forms in the target template tm of the sample to be tested, which is denoted as tm (n1), where n1 >. 1, and for each tm template, it is necessary to design the corresponding oligonucleotide chain CB, which is denoted as CB (n2), where n2 >. 1; for example, when n1 is n2 is 3, CB (1) and tm (1), CB (2) and tm (2), and CB (3) and tm (3) are correspondingly matched, and CB (1) can competitively interfere with the binding of CB (2) and tm (2) and CB (3) and tm (3), in order to improve the binding specificity of CB (2) and tm (2) and CB (3) and tm (3), similarly, CB (2) has similar effects on CB (1) and tm (1), CB (3) and tm (3), and CB (3) also has similar effects on CB (1) and tm (1), CB (2) and tm (2).
Further, the number of types of the target template is equal to or greater than the number of types of the second oligonucleotide strand.
Further, the ratio of the number of molecules of the third oligonucleotide chain to the number of molecules of the first oligonucleotide chain is 1:1 to 1: 100.
Further, the 3' end of the first oligonucleotide strand or the second oligonucleotide strand is modified with a structure or group that prevents extension, such as 4 or more bases different from the corresponding template, C3 spacer, amino group, phosphate group, and the like.
Further, the second oligonucleotide chain is modified with groups for identification or capture, for example, both ends are modified with a fluorescent group and a fluorescence quenching group respectively, no fluorescence is generated in the system under normal conditions, after PCR amplification, the oligonucleotide chain is hydrolyzed by PCR enzyme, the fluorescence quenching group is separated from the fluorescent group to release fluorescence, and a fluorescence signal indicates the existence of a certain target template specifically combined with the second oligonucleotide chain. If different types of target templates are to be distinguished, the second oligonucleotide chains can be respectively modified with fluorophores with different colors or excitation wavelengths, and the second oligonucleotide chains can be distinguished according to the fluorescence conditions.
A method for detecting the variation of a nucleic acid sample by adopting the oligonucleotide system comprises the following steps: and adding the oligonucleotide system into a sample to be detected, performing qPCR amplification, and identifying a nucleic acid variation sample according to the intensity of a fluorescence signal.
Further, the amplification system includes DNA polymerase and other components necessary for PCR amplification, such as an oligonucleotide chain (corresponding to the oligonucleotide chain RP in the example) that is necessary for PCR amplification and is coordinated with the third oligonucleotide chain. Wherein the DNA polymerase is required to have 5 '-3' exo-activity.
When the method is used for detecting the nucleic acid variation sample, the first oligonucleotide strand is specifically combined with the non-target template, and the combination difference of the first oligonucleotide strand and the target template causes weaker combination, so that the non-specific amplification of the non-target template is prevented on the basis of not influencing the amplification of the target template; the second oligonucleotide chain and the third oligonucleotide chain are specifically combined with the target template, but the combination difference of the second oligonucleotide chain and the third oligonucleotide chain and the combination of the third oligonucleotide chain and the non-target template results in weaker combination, the dual specificity guarantees that the specific amplification of the target template is promoted, and the detection of the ultra-low frequency variation is realized.
The oligonucleotide system provided by the invention can detect low-abundance variation of a nucleic acid sample (the low-abundance variation refers to the variation of the target template with the absolute number of 4-10 and the target template with the amount of one thirteen thousandth in the sample), and based on the application, the system can be used for preparing a reagent for detecting residual of a micro focus. In practical application, the mutation of a specific site is detected to quantify disease positive cells, and the sensitivity can reach the MR4.5 level, even the MR5.0 level.
By the scheme, the invention at least has the following advantages:
the invention discloses a PCR technology for detecting ultralow frequency variation of a nucleic acid sample through a triple complex competitive relationship, which can ensure sufficient specificity while detecting variation information of as low as one-thirteen-thousandth (0.0033%) in the nucleic acid sample. Based on the Gibbs free energy competition mechanism of a plurality of oligonucleotide chains, the amplification of a non-target template is suppressed while the amplification efficiency of the target template is ensured, non-specific signals caused by the non-target template can be further reduced, the specificity of ultra-low frequency variation information is ensured, a method with excellent sensitivity and specificity is provided for clinical detection, and a rapid and low-cost MRD monitoring means is also provided for clinical patients.
The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following description is made with reference to the preferred embodiments of the present invention and the accompanying detailed drawings.
Drawings
In order that the present disclosure may be more readily and clearly understood, reference will now be made in detail to the present disclosure, examples of which are illustrated in the accompanying drawings.
FIG. 1 is a schematic diagram of the oligonucleotide system of the present invention;
FIG. 2 is a schematic diagram showing the arrangement of oligonucleotide chain species in different experimental groups according to the present invention;
FIG. 3 is a graph of the results of the effect panel qPCR in example 1;
FIG. 4 is a graph of the qPCR results for comparative group one in example 1;
FIG. 5 is a graph of the qPCR results for comparative group two in example 1;
FIG. 6 is the qPCR results for comparative group three in example 1;
FIG. 7 is a graph of qPCR results for the effect panel in example 2;
FIG. 8 is a graph of the qPCR results for comparative group four in example 2
FIG. 9 is a graph of the qPCR results for comparative group five in example 2;
FIG. 10 is a graph of qPCR results for comparative group six of example 2;
FIG. 11 is a graph of qPCR results for the effect panel in example 3;
FIG. 12 is a graph of the qPCR results for comparative group seven in example 3;
FIG. 13 is a graph of the qPCR results for comparative group eight in example 3;
FIG. 14 is a graph of the qPCR results for comparative set nine in example 3;
FIG. 15 is a graph of qPCR results for the effect panel of example 4;
FIG. 16 is a graph of the results of the control panel decaqPCR of example 4;
FIG. 17 is a graph of the results of the comparative set of eleven qPCR of example 4;
FIG. 18 is a graph of twelve qPCR results for the control group of example 4;
FIG. 19 shows the CHEK2 exon14 qPCR results;
FIG. 20 shows a comparison of different PCR products of CHEK2 exon 14;
FIG. 21 is a graph of fifteen qPCR results for the comparative example 6 panel;
FIG. 22 is a graph of sixteen qPCR results for the effect group of example 6;
FIG. 23 is a graph showing the results of seventeen qPCR in the effect set of example 6.
Detailed Description
The present invention is further described below in conjunction with the following figures and specific examples so that those skilled in the art may better understand the present invention and practice it, but the examples are not intended to limit the present invention.
Example 1
Acute Myelogenous Leukemia (AML) is a cancer caused by hyperproliferation of myeloid blood cells. Mutations in the genes FLT3, NPM and KIT are specific gene mutations that are currently used to confirm the presence of leukemia cells. In recent years, studies of Matsuno N, et al (2005), diployyez N, et al (2016), and papamemanuil E, et al (2016), etc. have demonstrated that activating mutations of FLT3 play a very important pathological role in the development of AML and the progression of disease. In this embodiment, FLT3 is used as a target gene, and c.2523c > a mutation is used as a target mutation, in order to demonstrate the detection effect of the technical solution of this patent when the absolute number of target variant molecules is 1-10, which accounts for 0.1% of the total ratio. The difference between the Ct value of 0.1% and the Ct value of 0.00% of the judgment standard of 0.1% can be detected to be more than 4.
The purpose of this example 1 is to demonstrate the technical effect of the target variant molecules when the absolute number of the target variant molecules is 1-10, accounting for 0.1% of the total ratio.
1.1 Effect group: setting a triple competition system;
1.2 alignment group:
1.2.1 comparative group one: the components only comprise an oligonucleotide chain FP, an oligonucleotide chain RP and a Taqman probe in the middle of a PCR product, and the oligonucleotide chain PB and the oligonucleotide chain CB are not added; the ordinary Taqman probe is used for replacing the oligonucleotide CB with a fluorescent function, and shows whether a detection effect of 0.1 percent can be obtained or not when no competitive action of the oligonucleotide PB and the oligonucleotide CB exists;
1.2.2 comparative group two: the components are only oligonucleotide chain FP, oligonucleotide chain RP and oligonucleotide chain CB, which shows whether 0.1 percent of detection effect can be obtained when no competitive action occurs between oligonucleotide chain PB and oligonucleotide chain CB;
1.2.3 comparative group three: the components of the kit are only oligonucleotide chain FP, oligonucleotide chain RP, oligonucleotide chain PB and a Taqman probe, and whether a detection effect of 0.1 percent can be obtained when only oligonucleotide chain FP competes with oligonucleotide chain PB but no oligonucleotide chain CB competes with oligonucleotide chain PB;
the relative positions of oligonucleotide strand FP, oligonucleotide strand RP, oligonucleotide strand PB, oligonucleotide strand CB and Taqman probe in each set are shown in FIG. 2.
1.3 the sequences and settings of the four groups of oligonucleotide strands are as follows:
2 detailed description of the preferred embodiment
2.1 standards and reagents to be prepared
The standard substance is prepared by mixing and diluting positive plasmids and genomic DNA (gDNA) in a gradient manner. Both positive plasmids and gDNA were quantified by digital PCR and diluted to 1000 copies. Mixing the diluted and quantified positive plasmid with gDNA according to the proportion of 1:1 to obtain a standard substance with variant molecules accounting for 50.00 percent of the total proportion; and mixing the standard substance with the variant molecules accounting for 50.00 percent of the total proportion with gDNA according to the proportion of 1:1 to obtain the standard substance with the variant molecules accounting for 25.00 percent of the total proportion. According to the preparation method, diluting the obtained new standard substance and gDNA according to the proportion of 1:1 until the standard substance with the variant molecules accounting for 0.10 percent of the total proportion is obtained; gDNA is a standard substance with variant molecules accounting for 0.00 percent of the total proportion.
The dry powder of oligonucleotide strand FP, oligonucleotide strand RP, oligonucleotide strand PB, oligonucleotide strand CB and Taqman probe is first dissolved in TE Buffer, diluted to 100. mu.M as mother solution according to the factory mark, and then subjected to NanoDropTMPerforming secondary quantification by using a Lite Spectrophotometer, and diluting the mother liquor of the oligonucleotide chain FP and the oligonucleotide chain RP to 10 mu.M by using TE Buffer according to the secondary quantification result; the stock solutions of oligonucleotide strand CB and Taqman probe were diluted to 20. mu.M with TE Buffer.
The other reagents also include
Hot Start 2 × Master Mix with Standard Buffer and Nuclear Free Water.
2.2 configuring the reaction System
2.2.1 taking standard products with different concentration gradients as samples to be detected, and configuring a qPCR reaction system in a sterilized 96-hole qPCR tube according to the following system; the 30 μ L qPCR reaction system was as follows:
wherein, for the first comparative group, the nucleotide chain PB is replaced by nucleic Free Water; the use of Taqman probes to replace the oligonucleotide strand CB; for comparative group two, nucleic Free Water was used instead of oligonucleotide strand PB; for control three, Taqman probe was used instead of oligonucleotide strand CB. The standard substance adopts 25.00%, 3.13%, 1.56%, 0.78%, 0.39%, 0.20%, 0.10% and 0.00% of variant molecules in the total proportion. The absolute number of target variant molecules for each standard variety is as follows:
| standard article | Absolute number of target variant molecules |
| 25.00％ | 1250.0 |
| 3.13％ | 156.5 |
| 1.56％ | 78.0 |
| 0.78％ | 39.0 |
| 0.39％ | 19.5 |
| 0.20％ | 10.0 |
| 0.10％ | 5.0 |
| 0.00％ | 0.0 |
2.2.2 Place the 96-well qPCR tubes with the added sample on the Applied
7500 the real-time fluorescence quantitative PCR instrument is equipped with the following amplification program and starts qPCR reaction, the qPCR program is as follows:
2.3qPCR results were as follows:
figure 3 is the qPCR results for the effect panel. Due to the presence of a triple competition relationship, i.e., the oligonucleotide chain PB is more prone to bind to the non-target template (carrying the wild-type information on gDNA, which may also be referred to as the wild-type template), an inhibitory effect on the amplification of the non-target template is exerted; meanwhile, the oligonucleotide chain CB with the fluorescent group and the fluorescence quenching group is more prone to be specifically combined with a target template (positive plasmid) containing variant DNA molecules, the mutual competition of the oligonucleotide chain CB and the oligonucleotide chain PB further reduces the non-specific information possibly generated by the oligonucleotide chain CB and a non-target template (wild-type template), and a more specific fluorescent signal is obtained, for example, in 0.00% of samples, the fluorescence value is hardly increased after 55 cycles, and is in sharp contrast with 0.10% of standard products, the cycle difference is not needed to be used for judging the negativity and the positivity, so that the effect group has the visual technical effect of detecting 0.1%.
Fig. 4 shows qPCR results for comparative group one. Since there is no inhibitory effect of the oligonucleotide PB on the non-target template, and no oligonucleotide CB provides a more specific fluorescent signal, all the standards exhibit fluorescent signals with the same Ct value, so the first comparison scheme cannot have the technical effect of detecting 0.1%. In fact, the comparison group is a conventional Taqman technology setting mode, a Taqman probe is not designed aiming at a target site, and variation information cannot be distinguished necessarily.
FIG. 5 shows the qPCR results for comparative group two. Since the target template (containing mutation information) is not enriched because the oligonucleotide chain PB does not suppress the amplification of the wild-type template, although the oligonucleotide chain CB can specifically recognize the mutation signal, only the fluorescence signal of the standard (25.00%) with a high proportion of variant molecules in the whole population can be detected, but the standard with a low proportion and the standard with 0.00% cannot be distinguished, so that the scheme of the second comparison group cannot have the technical effect of detecting 0.1%. In fact, the arrangement mode of the group of probes is also a conventional Taqman technology arrangement mode, namely the Taqman probes are arranged at variation information, but the arrangement has limited capability of distinguishing wild type information from variation information, and only about 25% of variation information can be distinguished in the experiment, so that the Taqman probes are not enough for detection in the MRD field.
FIG. 6 shows the qPCR results for comparative group three. The existence of the oligonucleotide chain PB introduces a competitive relationship with the oligonucleotide chain FP, the non-target template is inhibited, which is different from the comparison group I, although the same Taqman probe is used, the standard products with different gradients can be distinguished, the Ct values of the standard products also present a one-to-one correspondence relationship based on the difference of the total proportion of the variant molecules, however, because the oligonucleotide chain CB does not exist in the comparison group III, further specificity can not be provided, the standard product with the total proportion of the variant molecules of 0.00 percent also generates a more obvious signal, in the detection process of the actual sample, the risk of judging the sample as false positive exists, the arrangement mode of the comparison group III is the same as that of the comparison group Liuhe comparison group nine of the embodiment 2 and the embodiment 3, the defect of low specificity of 0.00 percent gradually becomes obvious in the application scene needing to detect the variation with lower abundance, thus, we believe that the protocol of control group three has the possibility of detecting a 0.1% technical effect, but not as well as the effect group, and the need for improved specificity is clearly seen.
In conclusion, the present example shows that the conventional scheme setup using the same oligo comparison group I and comparison group II can not detect 0.1% of the technical effect; a similar technical solution is possible for comparison group three, although with a technical capacity of detecting 0.1%, the specificity needs to be improved; therefore, the oligonucleotide FP, PB and CB have triple interaction and are designed rigorously, so that the detection sensitivity of 0.1% and better specificity can be ensured.
Example 2
In this embodiment, FLT3 is used as the target gene, and the c.2523c > a mutation is used as the target mutation, so as to demonstrate the technical effect when the absolute number of target variant molecules is 4-10, which accounts for 0.01% of the total ratio, and it can be detected that the difference between the Ct value of 0.01% and the Ct value of 0.00% is greater than 4 for the judgment criterion of 0.01%.
3 this example is intended to demonstrate the technical effect of the total ratio of 4-10 target variant molecules, which is 0.01%.
3.1 Effect group: setting of triple competition system
3.2 alignment group:
3.2.1 comparative group four: the components only comprise an oligonucleotide chain FP, an oligonucleotide chain RP and a Taqman probe in the middle of a PCR product, and the oligonucleotide chain PB and the oligonucleotide chain CB are not added; the ordinary Taqman probe is used for replacing the oligonucleotide CB with a fluorescent function, and shows whether a detection effect of 0.01 percent can be obtained or not when no competitive action of the oligonucleotide PB and the oligonucleotide CB exists;
3.2.2 comparative group five: the components are only oligonucleotide chain FP, oligonucleotide chain RP and oligonucleotide chain CB, which shows whether 0.01 percent of detection effect can be obtained when no competitive action occurs between oligonucleotide chain PB and oligonucleotide chain CB;
3.2.3 comparative group six: the components of the kit are only oligonucleotide chain FP, oligonucleotide chain RP, oligonucleotide chain PB and a Taqman probe, and whether a detection effect of 0.01 percent can be obtained when only oligonucleotide chain FP competes with oligonucleotide chain PB but no oligonucleotide chain CB competes with oligonucleotide chain PB;
3.2.4 the relative positions of oligonucleotide strand FP, oligonucleotide strand RP, oligonucleotide strand PB, oligonucleotide strand CB and Taqman probe in each set are shown in FIG. 2.
The sequences and settings of the four sets of oligonucleotide strands are as follows:
4 detailed description of the preferred embodiment
4.1 standards and reagents to be prepared
This example uses the same reagents as example 1, but the standards were reconfigured to meet the requirement of 0.01% of the total ratio: the standard substance is prepared by mixing and diluting positive plasmids and genomic DNA (gDNA) in a gradient manner. Both positive plasmid and gDNA were quantified by digital PCR and diluted to 7000 copies. Mixing the diluted and quantified positive plasmid with gDNA according to the proportion of 1:1 to obtain a standard substance with variant molecules accounting for 50.00 percent of the total proportion; mixing the standard substance with the variant molecules accounting for 50.00 percent of the total proportion with gDNA according to the proportion of 1:1 to obtain the standard substance with the variant molecules accounting for 25.00 percent of the total proportion; according to the preparation method, diluting the obtained new standard substance and gDNA according to the proportion of 1:1 until the standard substance with the variant molecules accounting for 0.01 percent of the total proportion is obtained; gDNA is a standard substance with variant molecules accounting for 0.00 percent of the total proportion.
4.2 configuring the reaction System
4.2.1 the standard products with different concentration gradients are samples to be detected, and a qPCR reaction system is configured in a sterilized 96-hole qPCR tube according to the following system. The 30 μ L qPCR reaction system was as follows:
wherein, for comparative group four, the nucleotide chain PB is replaced by nucleic Free Water; the use of Taqman probes to replace the oligonucleotide strand CB; for comparative group five, nucleic Free Water was used instead of oligonucleotide strand PB. For comparative group six, Taqman probes were used instead of oligonucleotide strands CB. The standard substance is 6.25%, 0.39%, 0.20%, 0.10%, 0.05%, 0.02%, 0.01% and 0.00% of variant molecules. The absolute number of target variant molecules for each standard variety is as follows:
| standard article | Absolute number of target variant molecules |
| 6.25％ | 2625.0 |
| 0.39％ | 163.8 |
| 0.20％ | 84.0 |
| 0.10％ | 42.0 |
| 0.05％ | 21.0 |
| 0.02％ | 8.4 |
| 0.01％ | 4.2 |
| 0.00％ | 0.0 |
4.2.2 sample-spiked 96-well qPCR tubesIs placed on an Applied
On 7500 real-time fluorescence quantitative PCR instrument, the following amplification program was set up and qPCR reaction was started. qPCR procedure:
4.3qPCR results were as follows:
figure 7 qPCR results for effect panel. The oligonucleotide chain PB and the oligonucleotide chain CB exist simultaneously, so that the amplification efficiency of the non-target template can be inhibited, the interaction of the oligonucleotide chain CB and the oligonucleotide chain PB can reduce the non-specific signal of the non-target template, and meanwhile, the oligonucleotide chain CB is specifically combined with the target template (positive plasmid) to generate a specific fluorescent signal. As can be seen from the results, when the amplification reaction was performed for 55 cycles, the standard with the target template content of 0.00% still had no fluorescence signal, and the standard with the target template molecule accounting for 0.01% of the total ratio produced a fluorescence signal clearly different from that of the 0.00% standard. We can see from the figure that when Rn is 25000, Ct value of 0.01% is about 42.5, thus demonstrating that the effect group has the technical effect of detecting 0.01%.
FIG. 8 shows the qPCR results for comparative group four. Since there is no inhibitory effect of the oligonucleotide chain PB on the non-target template and no specific fluorescent signal provided by the oligonucleotide chain CB, all the standards show the same Ct value of fluorescent signal, so the scheme of the comparison group IV cannot have the technical effect of detecting 0.01%.
FIG. 9 shows the qPCR results for comparative group five. The oligonucleotide CB has a certain specificity of a recognition site, but since the non-target template (wild type) is not suppressed by the oligonucleotide PB, the signal from the target template is not enough to support the discrimination of 6.25% -0.00% of the standard, so that the scheme of the comparison group five cannot have the technical effect of detecting 0.01%. In fact, the arrangement mode of the group of probes is also a conventional Taqman technology arrangement mode, namely the Taqman probes are arranged at variation information, but the arrangement mode has limited capability of distinguishing wild type information from variation information, in the experiment, 6.25% of variation information cannot be distinguished, and the arrangement mode is similar to the second result of the comparison group in the embodiment 1, and therefore the arrangement mode is not enough to support detection in the MRD field.
FIG. 10 shows the qPCR results for comparative group six. In the present group, competition between the oligonucleotide PB and the oligonucleotide FP exists, which is different from the fourth and fifth comparison groups, and this competition relationship can obtain a certain resolution performance, and based on the difference in the total proportion of variant molecules, the Ct values of the variant molecules also present a one-to-one correspondence relationship, but since the oligonucleotide CB does not exist, the signal specificity cannot be further provided, and in the case of a relatively large difference in the concentration ratio, the difference in the Ct values of qPCR is large, for example, the difference in the Ct values between 6.25% and 0.39% is large, for example, the difference in the Ct values between 0.39% and 0% is large, but the present embodiment aims to hopefully distinguish between 0.01% and 0.00%, and as can be seen from the results, the difference in the Ct values of the variant molecules is small, and a great difference cannot be obtained as in the effect group of the present embodiment, so the scheme of the sixth comparison group cannot have the technical effect of detecting 0.01%.
In conclusion, the fourth comparison group is a conventional Taqman scheme in the industry, and it can be seen that the technical effect of detecting 0.01% is not achieved; the comparison of groups five and six is a possible solution to be foreseen, again without the detection of a technical effect of 0.01%; therefore, the interaction between oligonucleotide strand FP and oligonucleotide strand PB and oligonucleotide strand CB can only be guaranteed to be 0.01% through rigorous design.
Example 3
Minimal Residual Disease (MRD) refers to a small number of cancer cells remaining in the body during or after treatment (with no symptoms or signs of Disease), which is a major cause of recurrence of cancer, particularly leukemia. Typically the minimum requirement for sensitivity of MRD is that of a total of 100,000 samples, 3.3 positive samples can be tested, i.e. one in thirty-one-thousandths. But at present, a detection mode which can achieve rapidness, accuracy and high sensitivity is not achieved at the same time. In this example, FLT3 was used as the target gene, and c.2523c > a mutation was used as the target mutation to show the technical effect of the target variant molecules when the absolute number of the target variant molecules was 4-10, which accounted for one thirteen of the total ratio.
5, the purpose of this embodiment is to demonstrate the technical effect of the target variant molecules when the absolute number of the target variant molecules is 4-10, which accounts for one thirteen ten thousandth of the total proportion;
5.1 Effect group: setting of triple competition system
5.2 alignment group:
5.2.1 comparative group seven: the components only comprise an oligonucleotide chain FP, an oligonucleotide chain RP and a Taqman probe in the middle of a PCR product, and the oligonucleotide chain PB and the oligonucleotide chain CB are not added; the ordinary Taqman probe is used for replacing the oligonucleotide CB with a fluorescent function, and shows whether the detection effect of 0.0033 percent can be obtained when the competitive action of the oligonucleotide PB and the oligonucleotide CB does not exist;
5.2.2 comparative group eight: the components only comprise the oligonucleotide chain FP, the oligonucleotide chain RP and the oligonucleotide chain CB, and show whether the detection effect of 0.0033 percent can be obtained when no competitive action is generated between the oligonucleotide chain PB and the oligonucleotide chain CB;
5.2.3 comparative group nine: the components only comprise the oligonucleotide chain FP, the oligonucleotide chain RP, the oligonucleotide chain PB and the Taqman probe, and whether a detection effect of 0.0033 percent can be obtained when only the oligonucleotide chain FP and the oligonucleotide chain PB compete and no oligonucleotide chain CB competes with the oligonucleotide chain PB is shown;
5.2.4 the relative positions of oligonucleotide strand FP, oligonucleotide strand RP, oligonucleotide strand PB, oligonucleotide strand CB and Taqman probe are shown in FIG. 2.
5.3 the sequences and settings of the four groups of oligonucleotide strands are as follows:
6 standards and reagents to be prepared
The same reagents as those used in examples 1 and 2 were used in the present example, but the standard substance was a substance satisfying one-thirteen-ten-thousandth of the total proportion, and part of the standard substance was added: the standard substance with the variant molecule accounting for 0.01 percent of the total proportion in example 2 and gDNA are mixed according to the proportion of 1:1 to obtain the standard substance with the variant molecule accounting for 0.005 percent of the total proportion. Mixing the standard substance with the variant molecule accounting for 0.1 percent of the total proportion and 580 mu L of gDNA in example 2 to obtain the standard substance with the variant molecule accounting for 0.0033 percent of the total proportion, namely the standard substance with the variant molecule accounting for one thirty-one percent of the total proportion; the 20. mu.L of the standard substance in which the variant molecules accounted for 0.1% of the total proportion in example 2 was mixed with 980. mu.L of gDNA to obtain a standard substance in which the variant molecules accounted for 0.002% of the total proportion, i.e., a standard substance in which the variant molecules accounted for one fifths of the total proportion. The standards with the total ratio of variant molecules in example 2 of 3.13%, 0.39%, 0.10%, 0.01% and 0.00% were used in this example 3.
6.1 taking standard products with different concentration gradients as samples to be detected, configuring a qPCR reaction system in a sterilized 96-hole qPCR tube according to the following system, wherein the molecular number ratio of oligonucleotide chains FP, PB and CB is 1:10:0.25, and the 50 mu L qPCR reaction system is as follows:
wherein, for comparative group seven, nucleic Free Water was used instead of oligonucleotide chain PB; the use of Taqman probes to replace the oligonucleotide strand CB; for comparative group eight, nucleic Free Water was used instead of oligonucleotide strand PB. For comparative set nine, a TaqMan probe was used instead of oligonucleotide strand CB. The standard substance comprises 3.13%, 0.39%, 0.10%, 0.01%, 0.005%, 0.0033%, 0.002% and 0.000% of variant molecules. The absolute number of target variant molecules for each standard variety is as follows:
6.2 Place the 96-well qPCR tubes with the sample Applied to the Applied
On 7500 real-time fluorescence quantitative PCR instrument, the following amplification program was set up and qPCR reaction was started. qPCR procedure:
6.3qPCR results were as follows:
figure 11 is qPCR results for effect groups. Due to the existence of triple competition relationship, namely, the oligonucleotide chain PB can generate inhibition effect on amplification of a non-target template, and meanwhile, the oligonucleotide chain CB can perform specificity result with a PCR product containing variant molecules of the target template, so as to generate a fluorescence signal. After 55 cycles of amplification reaction, the standard substance with 0.00% of variant molecules in the total proportion still has no fluorescence signal, which indicates that the standard substance has good specificity and does not generate non-specific signals. The standard with 0.003% of the total variant molecule produced a significant fluorescence signal. In addition, the standard with 0.002% of the total variant molecules also produced a significant fluorescence signal. Therefore, the effect group has the technical effect of detecting one in three ten-thousandth, even has the technical effect of detecting one in five ten-thousandth, namely the effect group can quickly, accurately and sensitively detect the MRD.
Figure 12 compares the qPCR results for group seven. Since none of oligonucleotide strand PB inhibits amplification of non-target templates, neither oligonucleotide strand CB provides a specific fluorescent signal. All standards exhibited fluorescence signals with the same Ct values, so the control group one protocol did not have the technical effect of detecting one in thirty-one.
FIG. 13 shows the qPCR results for comparative group eight. Although the oligonucleotide chain CB can specifically identify the variation sites, the oligonucleotide chain PB does not inhibit the non-target template, and the oligonucleotide chain PB does not have the function of enriching and amplifying the target template, so that the proportion of the target template product in the total product in the target template standard is also between 3.13% and 0.002%, and the oligonucleotide chain CB is weak even if a signal is generated, and the gradient of different standards cannot be distinguished. Obviously, the solution of the eighth group cannot have the technical effect of detecting one in thirty-thousand. Compared with the results of example 1 and the results of example 2 and the results of comparative example five in FIG. 5, the signals also tend to decrease gradually, and it is again shown that if only the oligonucleotide CB is present, the competitive binding of the oligonucleotide PB is absent, and the target information at a low concentration cannot be detected.
FIG. 14 shows the qPCR results for comparative group nine. Because competition of the oligonucleotide chain PB and the oligonucleotide chain FP is introduced, different from the comparison group VII, Ct values of the variant molecules show a one-to-one correspondence relationship based on different overall proportions of the variant molecules. However, the Ct values of the standard with the variant molecule accounting for 0.000% of the total proportion are the same as those of the standard with the variant molecule accounting for 0.010%, 0.005%, 0.003% and 0.002%, and the results show that the setting of the comparison group nine can distinguish 0.10% and 0.00% well, but cannot achieve the technical effect of detecting one in thirty-one. Compared with the effect group of the embodiment, the specificity of the oligonucleotide CB is lacked, and the discrimination can be improved from 0.1% to 0.0033% by only increasing the oligonucleotide CB, further illustrating the unique creativity of the patent scheme.
In conclusion, the seventh comparison group is a conventional Taqman scheme in the industry, and it can be seen that the technical effect of detecting 0.0033% is not achieved; the eight and nine comparison groups are technical schemes which can be expected by practitioners of the same industry, and the technical effect of 0.0033% cannot be detected, but the nine comparison group has the technical effect of 0.1% detection; as can be seen, only the interaction of oligonucleotide FP with oligonucleotide PB and oligonucleotide CB is guaranteed to be 0.0033% by the stringent design.
Example 4
The related mutation of IDH2 gene is also closely related to the occurrence of leukemia. Studies by Yoshimi et al (2019) indicate that mutations in IDH2 can cause and contribute to the development of leukemia through the concerted action of epigenome and RNA splicing. Therefore, in addition to the aforementioned genes of FLT3 and the like, IDH2 is also an MRD-related gene that needs to be detected for leukemia. In this embodiment, IDH2 is used as a target gene, and c.419g > a mutation is used as a target mutation, so as to demonstrate the technical effect when the absolute number of target variant molecules is 4-10 and accounts for one thirteen of the total ratio. Thus, it was demonstrated that the method claimed in this patent can be used for the detection of mutations in different genes.
7 this example aims to illustrate that the patent scheme is expandable, but not only one example of FLT gene c.2523C > A mutation in examples 1-3, and like the previous example 3, this example demonstrates the technical effect of IDH2 gene when the absolute number of target variant molecules is 4-10, which is one thirteen ten thousand of the total ratio;
7.1 Effect group: setting of triple competition system
7.2 alignment group:
7.2.1 comparative group ten: the components only comprise an oligonucleotide chain FP, an oligonucleotide chain RP and a Taqman probe in the middle of a PCR product, and the oligonucleotide chain PB and the oligonucleotide chain CB are not added; the ordinary Taqman probe is used for replacing the oligonucleotide CB with a fluorescent function, and shows whether the detection effect of 0.0033 percent can be obtained when the competitive action of the oligonucleotide PB and the oligonucleotide CB does not exist;
7.2.2 comparative group eleven: the components only comprise the oligonucleotide chain FP, the oligonucleotide chain RP and the oligonucleotide chain CB, and show whether the detection effect of 0.0033 percent can be obtained when no competitive action is generated between the oligonucleotide chain PB and the oligonucleotide chain CB;
7.2.3 comparative group twelve: the kit comprises the components of only an oligonucleotide chain FP, an oligonucleotide chain RP, an oligonucleotide chain PB and a Taqman probe, and shows that the competitive relationship of only the oligonucleotide chain FP and the oligonucleotide chain PB is shown, and whether the detection effect of 0.0033 percent can be obtained when no competitive action occurs between the oligonucleotide chain CB and the oligonucleotide chain PB;
7.2.4 relative positions of oligonucleotide chain FP, oligonucleotide chain RP, oligonucleotide chain PB, oligonucleotide chain CB and Taqman probe are shown in FIG. 2, and the arrangement of comparison groups ten, eleven and twelve is the same as that of comparison groups one, two and three, respectively.
7.3 the sequences and settings of the four groups of oligonucleotide strands are as follows:
8 standard substance and reagent to be prepared
In this example, the standard substance was prepared by the same method as in example 3, and the reaction system and the qPCR procedure were also the same as in example 3, and thus are not described again.
8.1qPCR results were as follows:
figure 15 is qPCR results for effect groups. Due to the existence of triple competition relationship, namely, the oligonucleotide chain PB can generate inhibition effect on the amplification of the non-target template genome DNA, and meanwhile, the oligonucleotide chain CB can be specifically combined with the positive plasmid of the target template DNA molecule containing variation information to generate a fluorescence signal. After the amplification reaction is carried out for 55 cycles, the standard substance with the variant molecules accounting for 0.00 percent of the total proportion still has no fluorescence signal, which indicates that the specificity is good; but the standard with 0.003% of the total variant molecule produced a significant fluorescence signal. In addition, the standard with 0.002% of the total variant molecules also produced a significant fluorescence signal. Therefore, the effect group has the technical effect of detecting one in three ten-thousandth, even has the technical effect of detecting one in five ten-thousandth or lower, namely the effect group can quickly, accurately and sensitively detect the MRD.
Figure 16 qPCR results for comparative group ten. The group provides signals by using Taqman fluorescent probes designed by methods which are popular in the industry, does not have the amplification inhibition effect of oligonucleotide chain PB on non-target template DNA, does not provide specific fluorescent signals by oligonucleotide chain CB, and all standard products present fluorescent signals with the same Ct value, so that the scheme of the comparison group can not detect the technical effect of one in thirty ten minutes, and can not distinguish the technical effect of 0.1%.
FIG. 17 shows the qPCR results for comparative group eleven. Since no oligonucleotide chain PB suppresses amplification of the non-target template, the target template (containing mutation information) is not enriched, and although the oligonucleotide chain CB can specifically recognize the mutation signal, only the fluorescence signal of the standard (3.125%) with a high proportion of variant molecules in the total can be detected, but the standard with a low proportion cannot be distinguished from the standard with a 0.000% proportion. The solution of comparative group eleven therefore does not have the technical effect of detecting one in thirty-one.
FIG. 18 shows the qPCR results for comparative group twelve. Because the competition of the oligonucleotide chain PB and the oligonucleotide chain FP is introduced, different from the contrast group, the Ct value is slightly different based on the difference of the total proportion of variant molecules. However, the Ct values of the standard with 0.000% of the total percentage of the mutant molecules are the same as those of the standard with 0.100%, 0.010%, 0.005%, 0.003%, and 0.002% of the total percentage of the mutant molecules. The solution of the contrast group twelve cannot have the technical effect of detecting one in thirty-one ten thousand.
In conclusion, the comparison group ten is a conventional Taqman fluorescent probe arrangement scheme in the industry, and the technical effect that 0.0033% of the fluorescent probes can not be detected can be seen; the comparison of the eleven and twelve groups is a technical solution which is possibly foreseen by practitioners of the same industry, and the technical effect of 0.0033% cannot be detected; it was again demonstrated that the interaction of oligonucleotide strand FP, PB and CB requires a rigorous design to ensure that 0.0033% is detected and that this approach is generalizable.
Example 5 shows the detection effect when two oligonucleotide chains PB are present simultaneously
9 purposes: the effect sets of examples 1 to 4 demonstrate the technical effects achieved when one oligonucleotide FP, one oligonucleotide PB and one oligonucleotide CB are present at the mut and ref positions at the same time, i.e., when three oligonucleotide CB compete with each other, and compare the results when oligonucleotide PB and oligonucleotide CB are present and absent. In this example, the CHEK2 gene shows the technical effect of having one oligonucleotide FP, two oligonucleotide PB and one oligonucleotide CB at the mut and ref positions, i.e., four oligonucleotides compete with each other.
In clinical application, if the CHEK2 gene has site variation, the site variation needs to be determined to be on the CHEK2 true gene, and the CHEK2 true gene needs to be amplified without interference of the pseudogene. This example shows the oligonucleotide chains FP, PB and CB compositions designed for the exon region 14 of the true gene of CHEK2, as shown in the following table, where oligonucleotide chain PB and oligonucleotide chain CB are both designed at the place of the difference in the sequences of the true and false genes of CHEK2, two oligonucleotide chains PB (exon14PB-1, exon14PB-2) are perfectly matched with the sequences of the false genes (i.e., non-target templates), and suppress different false genes, respectively, and oligonucleotide chain CB is perfectly matched with the sequences of the true genes (i.e., target templates). Wherein the ratio of each of oligonucleotide strand FP and PB is 1: 10; the ratio of oligonucleotide strand FP to oligonucleotide strand RP is 1: 1. The experiment is set as an effect group, a comparison group thirteen and a comparison group fourteen, wherein the difference among the three groups is that the effect group is added with two oligonucleotide chains PB, and the comparison group thirteen is added with one oligonucleotide chain PB (namely exon14 PB-1); the fourteen control groups did not have any oligonucleotide strand PB added.
10 detailed description of the preferred embodiment
The oligonucleotide chains FP, PB and RP were diluted to 100. mu.M with 0.1 XTE solution as a mother solution, and the mother solutions of FP and RP were diluted to 10. mu.M with 0.1 XTE solution as a working solution. Amplification was performed according to the following procedure:
10.15 Xoligo Mix system:
10.2 configuration of the corresponding Experimental and control 5 Xoligo Mix amplification systems
10.3 qPCR Process conditions
FIG. 19 shows the 10.4qPCR fluorescence collection, and FIG. 19 shows the fluorescence signals of CHEK2 exon14 groups. The fourteen contrast groups have no blocking effect on pseudogene amplification due to the fact that any oligonucleotide PB is not added, and the Ct value is 32; thirteen comparison groups are added with an oligonucleotide PB which has partial blocking effect on pseudogene amplification, and the Ct value is 33; the effect group is that all PB groups are added, the amplification of all pseudogenes can be blocked, and the Ct value is 34.
10.5 Sanger sequencing of PCR amplification products of the effect group and the thirteen and fourteen control groups of CHEK2 exon 14;
10.6 analysis of the sequencing results of Sanger PCR products with different arrangements of CHEK2 exon14 As shown in FIG. 20, 96 bases contained in CHEK2 exon14 are shown in FIG. 20, the homology is between 90% and 98%, two pseudogenes are T at the position 109C (at the first arrow from the left), the result of a fourteen comparison group without any oligonucleotide chain PB added is shown as C at the point, C occupies about 4/5 under the condition that no real pseudogene is distinguished, and the signal of C is larger than that of T in the Sanger result, which is expected; the thirteen control group, to which an oligonucleotide chain PB was added, was shown as T at this point, indicating that the effect of suppression of the T-containing pseudogene was poor and that of the C-containing pseudogene was good, resulting in a majority of the T signal at this position; the control group to which all the oligonucleotide chains PB were added was excellent in the inhibition of all the pseudogenes at this point, and the proportion of C derived from the true gene was very high.
At position 117G (second arrow on the left), 6 pseudogenes are G as same as the true gene, only 1 pseudogene is A, the fourteen control groups without the addition of the oligonucleotide chain PB have no inhibition, and sanger shows G at this point, which is in line with the expectation; the comparative group thirteen with part of the oligonucleotide chain PB added is shown as a hetero-peak of A/G at the point, wherein the A signal is larger than the G signal, which indicates that the pseudogene containing A is not well inhibited, and in combination with the conditions of the positions 109C and 116C, the pseudogene which is not well inhibited can be judged to be the third from top to bottom in the pseudogene sequence; in the effect group, the positions 109C, 116C and 117G are the same as the true gene, and the simultaneous existence of two oligonucleotide chains PB is proved to have good inhibition effect on all the pseudogenes.
Similarly, at position 140C (third arrow from left), all pseudogenes are del C, and in the result of the fourteen comparative groups to which oligonucleotide chain PB was not added, this position is del C, and the C/T hetero-peak appears at the preceding 139 position; the amplification product of the comparative group thirteen containing partial inhibition effect also has del C at position 140, the pseudogene C signal of partial inhibition at position 139, and the situation of combining with positions 109C, 116C and 117G shows that the third pseudogene sequence is not well inhibited; in the effect group, all positions 140 are shown as C, and in the case of combining the positions 109C, 116C and 117G, we confirmed that when two oligonucleotide chains PB exist simultaneously, the CHEK2 true gene exon14 sequence was amplified.
In conclusion, the sanger results of the comparison effect group and the thirteen and fourteen comparison groups show that if the pseudogene is not inhibited, the information of the true gene is difficult to directly and obviously obtain; the system for inhibiting part of the pseudogenes can obtain certain true gene information, but only through reasonable arrangement, aiming at different conditions, all the pseudogenes can be inhibited by adopting two or even a plurality of oligonucleotide chains PB to obtain pure true gene products, thereby proving that the system based on a complex competition mechanism can be suitable for complex application scenes and can identify target information with high specificity.
Example 6 shows the detection effect when two oligonucleotide strands CB are present simultaneously
11 purposes: the detection effect of 2 oligonucleotide chains CB in the presence of the same time is shown to prove the content corresponding to the claims, and according to the requirement of an application scene, a plurality of oligonucleotide chains CB are designed to have the effect of improving the detection specificity, so that the patent scheme based on a complex competition mechanism has enough innovation and feasibility.
12 the oligonucleotide strand sequences used in this example are shown in the following table, wherein EGFR _858_ CB1 and EGFR _858_ CB2 were designed for the differences in the target templates shown in bold italics, respectively; GAPDH is an internal reference for the sample.
| Sequence name | Oligonucleotide strand FP sequence |
| EGFR_858_FP | GCAGCATGTCAAGATCACAGATT |
| GAPDH_FP | CCTTCTTGCCTCTTGTCTCTTAG |
| Oligonucleotide chain PB sequence | |
| EGFR_858_PB | GATCACAGATTTTGGGCTGGCCAAACTG-NH3 |
| Oligonucleotide chain RP sequence | |
| EGFR_858_RP | CCACCTCCTTACTTTGCCTCC |
| GAPDH_RP | TCATTGATGGCAACAATATCCACT |
| Oligonucleotide chain CB sequence | |
| EGFR_858_CB1 | FAM/TGGGC GT GCCAAA/MGB |
| EGFR_858_CB2 | CY5/AGC G GGCCAAAC/MGB |
| GAPDH_TM | ROX/CCAGAGTTAAAAGCAGCCCTGGTGACCAG |
The FP, RP, CB and PB dry powders were diluted to 100. mu.M with 0.1 XTE solution as mother liquor, and the FP, RP and CB mother liquor was diluted to 10. mu.M with 0.1 XTE solution as working liquor.
13, a specific implementation process:
13.1 two L858R standards were prepared, EGFR _ L858R (c.2573_2574TG > GT) (corresponding to EGFR _858_ CB1) and EGFR _ L858R (c.2573T > G) (corresponding to EGFR _858_ CB 2); the concentration is 0.1%; quantifying the concentration of the standard by ddPCR;
14 sets of settings
14.1 comparative group fifteen: wild type cfDNA standard, L858R content of 0%;
14.2 Effect group sixteen: 0.1% EGFR _ L858R (c.2573_2574TG > GT) (corresponding to EGFR _858_ CB1) cfDNA standard;
14.3 Effect group seventeen: 0.1% EGFR _ L858R (c.2573t > G) (corresponding to EGFR _858_ CB2) cfDNA standard;
14.4 configure the 5 × Oligo Mix system:
| EGFR _ L858R Experimental fractions | Primer concentration (μ M) | Volume (μ L) |
| EGFR_858_FP | 10 | 12 |
| EGFR_858_RP | 10 | 12 |
| EGFR_858_PB | 100 | 24 |
| EGFR_858_CB1 | 10 | 3 |
| |
10 | 3 |
| |
10 | 12 |
| GAPDH_RP | 10 | 12 |
| GAPDH_TM | 10 | 3 |
| Nuclease Free Water | 9 | |
| total | 90 |
Configuring an amplification System
14.5 qPCR Process conditions
14.6PCR results As shown in FIG. 21, it can be seen that in the results of the comparative group fifteen, only the signal of the internal reference GAPDH ROX can be seen because only the L858R is negative for 0% of the samples, while the signals of FAM and CY5 are not, which indicates that the oligonucleotide CB of this example does not generate non-specific signal for the negative samples and has good enough specificity.
14.7 results of the sixteen effect panel as shown in FIG. 22, since there is only one mutation in EGFR _ L858R, and correspondingly FAM signal, it can be seen from the results that there is also only the internal reference ROX signal and the FAM signal of EGFR _ L858R (c.2573_2574TG > GT). Although both EGFR _858_ CB2 and EGFR _858_ CB1 were present in the system, CY5 was not amplified in the effect panel, indicating that the EGFR _858_ CB2 probe was sufficiently specific for a substrate that was not its own corresponding template and did not produce non-specific signals; similarly, in the results of fig. 23 corresponding to the effect group seventeen, only the ROX signal and CY5 signal, but not the FAM signal, indicate that EGFR _858_ CB2 recognizes its corresponding template, and at the same time, does not perform misidentification on similar templates EGFR _ L858R (c.2573_2574TG > GT), and is specific enough.
This demonstrates that the effect group possesses the ability to detect one in a thousand EGFR _ L858R, which can be clearly distinguished from the control group (wild type). The technology has good specificity detection capability for detecting low abundance variation.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the spirit or scope of the invention.
Sequence listing
<110> Zell Gene technology (Suzhou) Ltd
<120> oligonucleotide system for detecting nucleic acid sample variation, application thereof and detection method based on the system
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA/RNA
<213> (Artificial sequence)
<400> 1
cctgacaaca tagttggaat ca 22
<210> 2
<211> 25
<212> DNA/RNA
<213> (Artificial sequence)
<400> 2
actccaggat aatacacatc acagt 25
<210> 3
<211> 33
<212> DNA/RNA
<213> (Artificial sequence)
<400> 3
tggaatcact catgatatct cgagccattt ttt 33
<210> 4
<211> 18
<212> DNA/RNA
<213> (Artificial sequence)
<400> 4
<210> 5
<211> 24
<212> DNA/RNA
<213> (Artificial sequence)
<400> 5
aagcacgttc ctggcggcca ggtc 24
<210> 6
<211> 23
<212> DNA/RNA
<213> (Artificial sequence)
<400> 6
gaagatgtgg aaaagtccca atg 23
<210> 7
<211> 18
<212> DNA/RNA
<213> (Artificial sequence)
<400> 7
<210> 8
<211> 33
<212> DNA/RNA
<213> (Artificial sequence)
<400> 8
tcccaatgga actatccgga acatcctgaa aaa 33
<210> 9
<211> 16
<212> DNA/RNA
<213> (Artificial sequence)
<400> 9
<210> 10
<211> 29
<212> DNA/RNA
<213> (Artificial sequence)
<400> 10
cccatcatct gcaaaaacat cccacgcct 29
<210> 11
<211> 22
<212> DNA/RNA
<213> (Artificial sequence)
<400> 11
gctctttctg aatggtggcc tg 22
<210> 12
<211> 40
<212> DNA/RNA
<213> (Artificial sequence)
<400> 12
caggaaacag ctatgaccga cgctagcagg cactgtccca 40
<210> 13
<211> 30
<212> DNA/RNA
<213> (Artificial sequence)
<400> 13
ggcctgttaa ttctggcata ctgttactga 30
<210> 14
<211> 38
<212> DNA/RNA
<213> (Artificial sequence)
<400> 14
gacctgttaa ttctggcata ctgttactga taatatat 38
<210> 15
<211> 21
<212> DNA/RNA
<213> (Artificial sequence)
<400> 15
ttctggcata ctcttactga t 21
<210> 16
<211> 23
<212> DNA/RNA
<213> (Artificial sequence)
<400> 16
gcagcatgtc aagatcacag att 23
<210> 17
<211> 23
<212> DNA/RNA
<213> (Artificial sequence)
<400> 17
ccttcttgcc tcttgtctct tag 23
<210> 18
<211> 28
<212> DNA/RNA
<213> (Artificial sequence)
<400> 18
gatcacagat tttgggctgg ccaaactg 28
<210> 19
<211> 21
<212> DNA/RNA
<213> (Artificial sequence)
<400> 19
ccacctcctt actttgcctc c 21
<210> 20
<211> 24
<212> DNA/RNA
<213> (Artificial sequence)
<400> 20
tcattgatgg caacaatatc cact 24
<210> 21
<211> 13
<212> DNA/RNA
<213> (Artificial sequence)
<400> 21
tgggcgtgcc aaa 13
<210> 22
<211> 12
<212> DNA/RNA
<213> (Artificial sequence)
<400> 22
<210> 23
<211> 29
<212> DNA/RNA
<213> (Artificial sequence)
<400> 23
ccagagttaa aagcagccct ggtgaccag 29
Claims (10)
1. An oligonucleotide system for detecting variations in a nucleic acid sample, the oligonucleotide system comprising at least three oligonucleotide strands, wherein:
the first oligonucleotide chain is provided with a first sequence and a second sequence which are connected, the first sequence is complementary with a non-target template base, has one or a plurality of base differences with the complementary sequence of the target template and is competitively combined with the target template with the second oligonucleotide chain;
the second oligonucleotide strand is base complementary to the target template, differs from the complementary sequence of the non-target template by one or more bases and competes with the first oligonucleotide strand for binding to the non-target template without overlapping the third oligonucleotide strand;
a third sequence and a fourth sequence which are connected are arranged on the third oligonucleotide chain, the third sequence is the same as the base sequence of the second sequence and is competitively combined with the target template and the non-target template, and the fourth sequence is complementary with the upstream sequence base of the difference sequence of the target template and the non-target template;
the target template has at least one base variation relative to the non-target template, and the variation site of the target template and the site corresponding to the variation site in the non-target template are located within the range covered by the first sequence or the second oligonucleotide chain.
2. The oligonucleotide system of claim 1, wherein:
for the target template, the gibbs free energy of the third oligonucleotide strand is less than the gibbs free energy of the first oligonucleotide strand, and the gibbs free energy of the first sequence is greater than the gibbs free energy of the second oligonucleotide strand;
for non-target templates, the gibbs free energy of the third oligonucleotide strand is greater than the gibbs free energy of the first oligonucleotide strand, and the gibbs free energy of the first sequence is less than the gibbs free energy of the second oligonucleotide strand.
3. The oligonucleotide system of claim 1, wherein: 1M Na at 45 ℃+Under the condition of concentration, the water-soluble organic acid,
the Gibbs free energy of the first oligonucleotide strand, the Gibbs free energy of the second oligonucleotide strand, or the Gibbs free energy of the third oligonucleotide strand satisfies-57.96 kcal/mol.ltoreq.G.ltoreq.14.81 kcal/mol;
the gibbs free energy of the second or third sequence satisfies-1.27 kcal/mol ≤ ag ≤ 16.96 kcal/mol;
the difference between the Gibbs free energy of the first oligonucleotide strand and the Gibbs free energy of the second oligonucleotide strand satisfies 0.42kcal/mol ≦ Δ G ≦ 14.64 kcal/mol;
the difference between the Gibbs free energy of the first oligonucleotide strand and the Gibbs free energy of the third oligonucleotide strand satisfies 8.36kcal/mol ≦ Δ G ≦ 15.91 kcal/mol.
4. The oligonucleotide system of claim 1, wherein: the oligonucleotide system comprises two or more first oligonucleotide chains or second oligonucleotide chains.
5. The oligonucleotide system of claim 4, wherein: the two or more first oligonucleotide strands are specifically combined with different non-target templates respectively, and the number of the types of the non-target templates is more than or equal to that of the first oligonucleotide strands.
6. The oligonucleotide system of claim 4, wherein: the two or more second oligonucleotide chains are respectively combined with different target templates in a specific mode, and the number of the types of the target templates is more than or equal to that of the second oligonucleotide chains.
7. The oligonucleotide system of claim 1, wherein: the 3' end of the first oligonucleotide strand or the second oligonucleotide strand is modified with a structure or group that prevents extension.
8. The oligonucleotide system of claim 1, wherein: and both ends of the second oligonucleotide chain are respectively modified with a fluorescent group and a fluorescence quenching group.
9. A method for detecting a variation in a nucleic acid sample using the oligonucleotide system of any one of claims 1 to 8, comprising the steps of: and adding the oligonucleotide system and the oligonucleotide chain matched with the third oligonucleotide chain into a sample to be detected, performing qPCR amplification, and identifying a nucleic acid variation sample according to the intensity of a fluorescent signal.
10. Use of the oligonucleotide system of any one of claims 1 to 8 for preparing a reagent for detecting residual foci and a reagent for detecting low-abundance variation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111519899.4A CN114277101B (en) | 2021-12-13 | 2021-12-13 | Oligonucleotide system for detecting variation of nucleic acid sample, application and detection method based on system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111519899.4A CN114277101B (en) | 2021-12-13 | 2021-12-13 | Oligonucleotide system for detecting variation of nucleic acid sample, application and detection method based on system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114277101A true CN114277101A (en) | 2022-04-05 |
| CN114277101B CN114277101B (en) | 2022-11-04 |
Family
ID=80871821
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111519899.4A Active CN114277101B (en) | 2021-12-13 | 2021-12-13 | Oligonucleotide system for detecting variation of nucleic acid sample, application and detection method based on system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277101B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170327868A1 (en) * | 2015-10-21 | 2017-11-16 | Admera Health LLC | Blocker based enrichment system and uses thereof |
| CN108048531A (en) * | 2017-11-16 | 2018-05-18 | 苏州吉玛基因股份有限公司 | A kind of super retardance fluorescence quantifying PCR method of highly sensitive detection rare mutation |
| CN110869516A (en) * | 2017-07-26 | 2020-03-06 | 积水医疗株式会社 | Method for detecting mutant gene |
| CN111004839A (en) * | 2019-12-18 | 2020-04-14 | 杭州瑞普基因科技有限公司 | Method for detecting target mutation by carrying out retardation substitution amplification enrichment based on blocking substance modified by locked nucleic acid |
| WO2020119721A1 (en) * | 2018-12-12 | 2020-06-18 | 上海迈景纳米科技有限公司 | Nucleic acid amplification blocking agent for detecting low-abundance mutation sequence and use thereof |
| CN112708662A (en) * | 2020-12-28 | 2021-04-27 | 阅尔基因技术（苏州）有限公司 | Nucleotide composition for inhibiting non-target area in biological DNA sample and application thereof |
-
2021
- 2021-12-13 CN CN202111519899.4A patent/CN114277101B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170327868A1 (en) * | 2015-10-21 | 2017-11-16 | Admera Health LLC | Blocker based enrichment system and uses thereof |
| CN110869516A (en) * | 2017-07-26 | 2020-03-06 | 积水医疗株式会社 | Method for detecting mutant gene |
| CN108048531A (en) * | 2017-11-16 | 2018-05-18 | 苏州吉玛基因股份有限公司 | A kind of super retardance fluorescence quantifying PCR method of highly sensitive detection rare mutation |
| WO2020119721A1 (en) * | 2018-12-12 | 2020-06-18 | 上海迈景纳米科技有限公司 | Nucleic acid amplification blocking agent for detecting low-abundance mutation sequence and use thereof |
| CN111004839A (en) * | 2019-12-18 | 2020-04-14 | 杭州瑞普基因科技有限公司 | Method for detecting target mutation by carrying out retardation substitution amplification enrichment based on blocking substance modified by locked nucleic acid |
| CN112708662A (en) * | 2020-12-28 | 2021-04-27 | 阅尔基因技术（苏州）有限公司 | Nucleotide composition for inhibiting non-target area in biological DNA sample and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| LUCIA R. WU等: "Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification", 《NAT BIOMED ENG》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114277101B (en) | 2022-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9169520B2 (en) | Cancer marker, method for evaluation of cancer by using the cancer marker, and evaluation reagent | |
| CN111118151A (en) | Human SMN1 and SMN2 gene copy number detection kit based on digital PCR method | |
| CN107365769B (en) | Bubbling primer, kit composed of bubbling primer and application of kit | |
| CN101899496A (en) | K-Ras gene mutation typing fluorescence quantitative PCR detection kit and detection method thereof | |
| CN111979307B (en) | Targeted sequencing method for detecting gene fusion | |
| CN101875971A (en) | Rapid detection of BRAF (Block-Repeated Active Flag) gene mutation | |
| CN116716397A (en) | Method and device for detecting DMD gene variation, probe and kit | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| US20230304081A1 (en) | Primer and probe design method, detection composition, and kit for mirna detection | |
| CN110241264B (en) | Quantitative detection kit for Hepatitis B Virus (HBV) DNA | |
| CN108060213A (en) | Isothermal duplication method detection SNP site probe and kit based on the recombinase-mediated that probe is oriented to | |
| CN114277101B (en) | Oligonucleotide system for detecting variation of nucleic acid sample, application and detection method based on system | |
| CN107604067A (en) | A kind of primer and kit for the mutation of testing goal gene low frequency | |
| CN108949911B (en) | Method for identifying and quantifying low frequency somatic mutations | |
| CN113604589B (en) | Kit for simultaneously detecting drug-resistant locus and virulence genotyping of helicobacter pylori and metabolic genotyping of proton pump inhibitor | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN115011594A (en) | Liquid phase hybridization capture probe for detecting HPV, application and kit thereof | |
| CN110669840B (en) | NPM1 mutation detection kit | |
| CN117280042A (en) | Systems for detecting targeted genetic variations and viral genomes and methods of making and using the same | |
| CN113881674A (en) | Application of LINC00958 in preparation of reagent and kit for diagnosing and monitoring chronic myelocytic leukemia | |
| CN108998535B (en) | KRAS gene multiple mutation site detection kit | |
| CN113481197A (en) | Linear probe and method for detecting miRNA (micro ribonucleic acid) by using same | |
| CN112501306A (en) | Kit for CpG island methylation phenotype detection and application thereof | |
| US20200318198A1 (en) | Biomarkers for disease burden of neuroblastoma | |
| CN111471768A (en) | PCR primer group and kit for detecting JAK2V617F and CA L R ninth exon gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |