CN114277082B - Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application - Google Patents
Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application Download PDFInfo
- Publication number
- CN114277082B CN114277082B CN202111498965.4A CN202111498965A CN114277082B CN 114277082 B CN114277082 B CN 114277082B CN 202111498965 A CN202111498965 A CN 202111498965A CN 114277082 B CN114277082 B CN 114277082B
- Authority
- CN
- China
- Prior art keywords
- a2ti
- inhibitor
- proliferation
- prv
- inhibiting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a method for inhibiting the replication and proliferation of pseudorabies viruses in vitro by using an annexin A2/S100A10 heterotetramer inhibitor A2ti-1 and application thereof, wherein the inhibitor A2ti-1 can be used for developing related antiviral drugs for inhibiting the replication and proliferation of pseudorabies viruses in vitro. The invention verifies that the DNA content, virus titer and expression level of structural protein of A2ti-1 after PRV infection are obviously reduced compared with a control group under the use concentration of not less than 62.5 mu M on PK-15 cells, and shows that the A2ti-1 can be used for inhibiting the in vitro replication and proliferation of pseudorabies virus.
Description
Technical Field
The invention relates to a method for inhibiting pseudorabies virus replication and proliferation in vitro by using annexin A2/S100A10 heterotetramer (A2 t) inhibitor A2ti-1 and application thereof, belonging to the technical fields of cell biology and virology.
Background
Pseudorabies virus (Pseudorabies virus, PRV) belongs to the family herpesviridae (Herpesviridae family), the genus varicella virus of the subfamily herpesviridae (Alphaherpesvirinae subfamily) (Varicellovirus genus), the surface of the virion is enveloped, the genome is a double stranded DNA virus, about 15 ten thousand bases in size, containing 72 open reading frames (open reading frame, ORF), encoding 70 different proteins. PRV can infect various animals such as dogs, cats, sheep, cattle, foxes, minks, mice and the like, the mortality rate is almost 100%, after pigs are infected with pseudorabies viruses, the swinery manifestations of different stages are different, and sows mainly show reproductive disorders such as abortion, stillbirth, mummy, weak baby and the like; the suckling piglets mainly show neurological symptoms, screamina and white foam, and die within 48-72 hours; the nursery pigs show neurological symptoms and respiratory symptoms after infection; after the fattening pigs are infected, respiratory tract symptoms are mainly shown, nerve symptoms are occasionally seen, and the death rate is usually low.
It is worried that cases of multiple PRV infected persons have been reported in recent years, and it is confirmed that under specific conditions, PRV is indeed transmissible across species, causing infection of persons, mainly manifested as symptoms of viral encephalitis, and that most of the reported cases have poor prognosis. More importantly, the occurrence of pseudorabies virus variant strains greatly reduces the protection efficacy of commercial vaccines used in the current pig farm, and the laboratory of the unit where the applicant is located shows that the infection rate of pseudorabies wild viruses in the pig farm is still very high through many years of serological monitoring data, and the positive rates of the sample and the pig farm are about 40.0% and 70.0% respectively. Given that there is currently no specific therapeutic for PRV, the widespread popularity of pseudorabies viruses poses a threat to both the practitioner in the swine industry and to other persons in close contact therewith. Therefore, there is a need to develop a method for screening potential therapeutic drugs against pseudorabies viruses.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide an application of an annexin A2/S100A10 hetero-tetramer (A2 t) inhibitor A2ti-1 in inhibiting pseudorabies virus replication and proliferation in vitro.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
use of inhibitor A2ti-1 for inhibiting replication and proliferation of pseudorabies virus in vitro.
The inhibitor A2ti-1 is used at a concentration of 31.25 mu mol/L to 250 mu mol/L.
The inhibitor A2ti-1 is used at a concentration of 62.5-125. Mu. Mol/L.
The inhibitor A2ti-1 is applied to the preparation of antiviral drugs for resisting pseudorabies virus infection.
The invention has the beneficial effects that:
the invention comprehensively utilizes techniques such as cytobiology, virology and the like, and discovers that the annexin A2/S100A10 hetero-tetramer (A2 t) inhibitor A2ti-1 has the effect of inhibiting the PRV from replicating and proliferating in vitro. The in vitro use concentration of A2ti-1 was first determined by cytotoxicity assays on commercial A2 ti-1. The effect of A2ti-1 on inhibiting PRV infection in vitro was then evaluated using Immunofluorescence (IFA), fluorescent quantitative PCR, viral titer assay (TCID 50), western immunoblotting techniques, and the like, and found to significantly inhibit replication and proliferation of PRV.
The method can obviously inhibit the replication and proliferation of PRV on pig kidney epithelial cells (PK-15), and when the treatment concentration of the inhibitor is 62.5 mu M or 125 mu M, compared with a control group without the inhibitor, the fluorescence intensity of PRV, the content of PRV genome DNA, the virus titer and the expression quantity of PRV structural protein are obviously reduced, and the A2ti-1 can effectively inhibit the replication and proliferation of PRV.
The annexin A2/S100A10 heterotetramer (A2 t) inhibitor A2ti-1 provided by the invention can be applied to the research and development of antiviral drugs for resisting PRV infection.
Drawings
FIG. 1 shows the cytotoxicity test results of A2ti-1 on PK-15 cells;
FIG. 2 immunofluorescence assay for inhibition of PRV proliferation on PK-15 cells by A2 ti-1;
wherein PRV-GFP is green fluorescent, the higher the fluorescence intensity, the more virus proliferation is indicated, and the green fluorescence intensity of PRV-GFP can be seen to be remarkably reduced when the inhibitor concentration is 62.5 mu M and 125 mu M compared with the 0 mu M group;
FIG. 3 shows the results of a dependency assay of different doses of A2ti-1 on inhibition of PRV proliferation in vitro;
wherein, A, PRV DNA content; b, virus titre TCID 50 ；
FIG. 4 inhibition of PRV proliferation in vitro by A2ti-1 at various time of action;
wherein "-", control; "+" inhibitor-treated group.
Detailed Description
The following describes the embodiments of the present invention in further detail with reference to examples.
The main experimental materials and instrument equipment used in the embodiment of the invention are as follows:
(1) Main experiment materials
PK-15 cells, PRV-GFP strain, PRV-HeNLH/2017 strain were stored in the laboratory, PRV gE murine monoclonal antibody, pEASY-Blunt-UL54 standard plasmid was prepared and stored in the laboratory. Murine beta-tubulin mab (cat# M20005, abmart); alexa Fluor 488 donkey anti-mouse antibody (cat# A21202, invitrogen); DAPI (2- (4-Amidinophelyl) -6-indolecarbamidine dihydrochloride) (cat# D8200, solarbio); cellTiter 96 AQueous single solution cell proliferation assay kit (cat# G3582, promega); DMEM cell culture Medium (Dulbecco's modified Eagle's Medium) (cat# 12100, solarbio); protein Marker (cat# PR1930, solarbio); fetal bovine serum (fetal bovine serum, FBS) (cat# FSP500, excell Bio); inhibitor A2ti-1 (cat# HY-136465, MCE company); fluorescent quantitation reagent SYBR Green (cat# 04913914001, roche); ECL hypersensitive chemiluminescence (cat number: P10300, new seime); viral nucleic acid extraction kit (cat# RC311-C1, north Renzan Co.); fluorescent quantitative 96-well plates and various types of cell culture plates (Coring corporation); polyvinylidene fluoride film (polyvinylidene fluoride, PVDF) (Millipore Co.)
(2) Main instrument and equipment
CO 2 A cell incubator (Thermo Fisher Scientific); a biosafety cabinet (Thermo Fisher Scientific); ultra clean bench (SANYO); ultrapure water instrument (Millipore); -20 ℃ refrigerator (BOSCH); -40 ℃ ultra low temperature refrigerator (Haier); -an ultra low temperature refrigerator (Thermo Fisher Scientific) at 80 ℃; a mini high speed centrifuge (Eppendorf); a bench top high-speed refrigerated centrifuge (Eppendorf); micropipettes (Eppendorf); an electronic analytical balance (Mettler Toledo); confocal microscopy (Zeiss); a 96-well plate reader (Thermo Fisher Scientific); real-Time fluorescent quantitative PCR instrument (7500 Fast Real-Time PCR system, applied Biosystem); protein electrophoresis apparatus and protein transfer apparatus (Bio-Rad).
EXAMPLE 1 cytotoxicity assay of A2ti-1 on PK-15 cells
The cytotoxic effect of the inhibitor on PK-15 cells was determined using CellTiter 96 AQUeous single solution cell proliferation assay kit.
(1) PK-15 cells were cultured at 1X 10 4 The individual cells/wells were plated in 96-well plates and the next step was performed until the cells had grown to an abundance of 70-80%. A blank was set and at least three wells were repeated for each concentration.
(2) Dilution inhibitor: the A2ti-1 inhibitor was diluted with DMEM cell culture medium containing 10% (v/v) FBS (fetal bovine serum) to give the A2ti-1 inhibitor concentrations in the medium as follows: 0. Mu.M, 31.25. Mu.M, 62.5. Mu.M, 125. Mu.M, 250. Mu.M, 500. Mu.M.
(3) Incubation inhibitor: old medium was discarded and 100 μl of inhibitor was added to each well at the corresponding concentration. The 96-well plate is placed in a cell culture incubator for incubation for 36-48h.
(4) Reading: after adding 20. Mu.L CellTiter 96 AQUous single solution reagent to each well, the plate was transferred to 5% CO at 37 ℃ 2 Incubate for 2h in the cell incubator and then record the absorbance at 490nm on a 96-well plate reader.
(5) Data analysis: statistical analysis was performed using GraphPad software Student t-test; ns is no significant difference, p <0.001, indicating that the difference is very significant.
As a result, as shown in FIG. 1, when the inhibitor concentration was 31.25 to 250. Mu.M, there was no significant effect on the cell activity, i.e., no cytotoxicity, as compared with the control group (0. Mu.M) to which A2ti-1 was not added, and the results were used in the subsequent examples.
EXAMPLE 2 immunofluorescence evaluation of the inhibitory Effect of A2ti-1 on PRV infection
(1) PK-15 cells were cultured at 1X 10 4 The individual cells/wells were plated in 96-well plates and the next step was performed when the cells were grown to an abundance of about 80%. A blank control was set. At least three wells were repeated for each concentration.
(2) Different concentrations of A2ti-1 (0 μm,62.5 μm and 125 μm) were incubated simultaneously with PRV-GFP strain (multiplicity of infection moi=0.1) for 1h at 37 ℃ and then rinsed 3 times with PBS buffer before adding DMEM cell maintenance solution (containing 2% (v/v) FBS) containing the corresponding concentration of inhibitor for further incubation for 24 hours.
(3) The culture supernatant was discarded, rinsed 3 times with PBS, then fixed for 15 minutes with 200. Mu.L of 4% (wt%) paraformaldehyde added to each well, and then rinsed 3 times with PBS.
(4) 100. Mu.L of DAPI staining solution was added to each well, stained at room temperature for 10 minutes, and the staining solution was discarded, and washed with PBS 3 times for 5 minutes each.
(5) The PRV strain is observed under a fluorescence microscope, and the green fluorescence intensity represents the proliferation condition of the PRV strain.
The results are shown in FIG. 2, where the green fluorescence intensity was significantly reduced in the inhibitor-treated groups (62.5. Mu.M and 125. Mu.M) compared to the control group (0. Mu.M), indicating that proliferation of PRV strains was significantly inhibited.
EXAMPLE 3 dose-dependent assessment of inhibition of PRV replication proliferation by A2ti-1
(1) PK-15 cells were cultured in 2.5X10-fold 4 Each cell/well was seeded with 24-well cell culture plates, 500. Mu.L of DMEM cell culture medium (containing 10% FBS) was added to each well, and cultured in a cell culture incubator for 24 hours.
(2) The medium was discarded, washed 3 times with PBS, and then incubated with PRV virus (PRV-HeNLH/2017 strain) at a multiplicity of infection (multiplicity of infection, MOI) of 0.01 together with the corresponding concentrations of inhibitor A2ti-1 (0. Mu.M, 62.5. Mu.M and 125. Mu.M) in the cell culture wells for 1 hour, with 0. Mu.M being the control group without inhibitor, each group being duplicated in three; after incubation, the medium was discarded, the cells were rinsed three times with PBS, and further added with DMEM cell maintenance solution (containing 2% (v/v) FBS) at the corresponding concentration A2ti-1, and incubation was continued in the cell incubator for 24 hours.
(3) And then repeatedly freezing and thawing for three times, lysing cells, transferring the frozen and thawed products into a 1.5mL sterile centrifuge tube, centrifuging for 5 minutes at a speed of 12000 r/min, and transferring the supernatant into a new 1.5mL sterile centrifuge tube, namely preparing samples of a control group and an A2ti-1 treatment group, wherein the whole process requires strict sterile operation.
(4) Determination of PRV DNA content in control and A2ti-1 treated groups. 200. Mu.L of each of the control group and the A2ti-1 inhibitor-treated group was sampled and viral nucleic acid was extracted according to the instructions of the viral DNA/RNA extraction kit. Then, a standard curve is established by using pEASY-Blunt-UL54 plasmid standard, amplification is performed by using established fluorescence quantitative PCR for PRV UL54 gene, and the copy number of the gene is calculated according to the standard curve to represent the content of PRV DNA in each group. The primers and the reaction system are shown in Table 1 and Table 2, the reaction program uses the ABI timing fluorescence quantitative PCR instrument self-carried program, and the specific amplification program is as follows: step 1, pre-denaturation: 95 ℃ for 30s; step 2, 40 cycles: 95 ℃,5s, then 60 ℃ and 15s.
(5) Determination of PRV virus titers in control and A2ti-1 treated groups. PK-15 cells were assayed at 1.0X10 by half the cell culture infection (50%tissue culture infective dose,TCID50) 4 Spreading individual cells/wells on 96-well plates, discarding the supernatant medium when the monolayer cells of each well grow to 90% abundance, and rinsing with PBS 3 times; then adding a 10-fold ratio diluted virus solution sample with DMEM cell maintenance solution (containing 2.0% (v/v) FBS) to obtain a dilution of 10 in order -1 -10 -10 Is a virus diluent to be tested; applying samples with a multi-channel applicator, the first column of the 96-well plate corresponding to 10 -1 Dilution of the mixture, second column corresponding to 10 -2 The dilution of the mixture was analogized, the last two columns were used as blank, and the maintenance solution without virus solution was added, with 8 replicates for each dilution. Placing in cell incubator, culturing for 3-5 days, observing cytopathic effect caused by PRV infection under microscope, and recording cytopathic wells at each dilutionNumber, TCID by Reed-Muench two-phase method 50 Is calculated by the computer.
As shown in FIG. 3, PRV DNA content was significantly reduced in the A2ti-1 treated group (FIG. 3A), as compared to the non-inhibitor A2ti-1 (0. Mu.M) group, virus Titer (TCID) 50 ) Is also significantly reduced (fig. 3B), and the effect of A2ti-1 on inhibition of PRV replication and proliferation is also stronger with a significant dose dependence at high concentration (125 μm) of inhibitor.
TABLE 1 primers for fluorescent quantitative PCR
| Primer name | Sequence (5 '-3') |
| PRV-UL54 forward primer | TGCAGCTACACCCTCGTCC(SEQ ID NO.1) |
| PRV-UL54 reverse primer | TCAAAACAGGTGGTTGCAGTAAA(SEQ ID NO.2) |
TABLE 2 fluorescent quantitative PCR reaction System
Example 4 evaluation of the Effect of A2ti-1 on inhibition of PRV replication and proliferation at various time of action
PK-15 cells were cultured in 2.5X10-fold 5 The individual cells/wells were seeded with 24-well cell culture plates, and 500. Mu.L of DMEM cell culture medium (containing 10% (v/v) FBS) was added to each well and cultured in a cell culture incubator for 24 hours; PRV virus with MOI of 0.01 when cells are full of about 90% (PRV-HeNLH/2017 strain)Incubation with 125. Mu.M of A2ti-1 inhibitor was performed for 1 hour in the culture wells, while the control group was given with no inhibitor, and 3 replicates were given for each infection time point.
After incubation at 37℃for 1 hour, the supernatant was discarded, washed 3 times with PBS, and then incubated with DMEM cell maintenance solution containing 125. Mu. M A2ti-1 (containing 2% (v/v) FBS), the infected control group was only added with maintenance solution (without inhibitor A2 ti-1), and the incubation was continued in a cell incubator. Collecting adherent cells (discarded supernatant) at corresponding time points 12, 24 and 36 hours after infection, and freezing to-80 ℃ low-temperature refrigerator; then 150 mu L of RIPA cell lysate is added, the lysate is placed on ice for about 1 minute, the lysate is transferred into a 1.5mL sterile centrifuge tube, the lysate is centrifuged at a low temperature of 12000 r/min for 5 minutes, and the supernatant is transferred into a new 1.5mL sterile centrifuge tube, thus obtaining the protein sample. Preserving in-80 deg.c refrigerator for use.
The expression of the viral structural protein gE was determined by Western Blotting (WB) in inhibitor treated groups (indicated by "+") and in control groups (indicated by "-"). The specific implementation steps are as follows:
(1) Sample denaturation treatment: 80. Mu.L of sample is taken, 20. Mu.L of 5 Xprotein loading buffer is added into water, boiled for 10 minutes and kept at-20 ℃ for standby.
(2) 10 mu L of the protein sample is taken and added into a loading hole on a 12.0% denatured protein prefabricated gel, after electrophoresis for 15 minutes at 100V, the electrophoresis is switched to 150V to continue until bromophenol blue reaches the bottom position, and the protein markers are thoroughly separated.
(3) Transfer printing: cutting PVDF film with proper size according to the size of the glue, activating in methanol for 30 seconds for standby, transferring the albumin glue and the film together into transfer printing liquid, balancing for about 5 minutes, arranging sponge, 3 layers of filter paper, albumin glue, PVDF film, 3 layers of filter paper and sponge in sequence from the cathode of an electric transfer printing instrument, thoroughly removing bubbles by using a glass rod before each layer of filter paper is paved, and clamping in the transfer printing liquid; 100V, constant pressure electrophoresis for 30-60 min.
(4) Closing the membrane: the membranes were soaked to 5.0% (w/v) skimmed milk powder (0.5% (v/v) PBST formulation). The cells were closed at room temperature for 2 hours.
(5) Incubating primary antibodies: murine monoclonal antibodies to PRV gE protein were diluted 1:50-fold with 5.0% (w/v) skimmed milk powder (0.5% (v/v) PBST, and tubulin antibodies (murine anti-beta-tubulin monoclonal antibodies) were diluted 1:1000-fold and incubated with PVDF membrane for about 1 hour at room temperature. PBST (containing 0.5% (v/v) Tween-20) was added to wash the membrane 3 times for 5 minutes each.
(6) Secondary antibody incubation: donkey anti-mouse antibodies were diluted 1:1000 with 5.0% (w/v) skimmed milk powder (0.5% (v/v) PBST formulation), and also applied to the membranes, incubated for about 1 hour at room temperature, and washed 4 times with PBST for 5 minutes each.
(7) Color development: the ECL hypersensitive chemiluminescent liquid prepared in the ratio of 1:1 is uniformly added to a PVDF film, and the PVDF film is placed in a gel imaging scanner to adjust the proper exposure time for color development.
The results are shown in figure 4, which shows that western blot experiments ("-", control; "+" inhibitor treated) showed significantly lower PRV gE protein content in the A2ti-1 inhibitor treated group ("+") than the control ("-") 12 hours, 24 hours, and 36 hours post-infection, further demonstrating that A2ti-1 can significantly inhibit replication and proliferation of PRV at the cellular level.
Sequence listing
<110> animal immunology important laboratory of agricultural academy of sciences in Henan province
<120> method for inhibiting pseudorabies virus in vitro replication and proliferation by using inhibitor A2ti-1 and application thereof
<130> fluorescent quantitative PCR
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence ()
<400> 1
tgcagctaca ccctcgtcc 19
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence ()
<400> 2
tcaaaacagg tggttgcagt aaa 23
Claims (4)
1. Use of inhibitor A2ti-1 for inhibiting replication and proliferation of pseudorabies virus in vitro.
2. The use according to claim 1, wherein the inhibitor A2ti-1 is used in a concentration of 62.5 μmol/L to 250 μmol/L.
3. The use according to claim 2, wherein the inhibitor A2ti-1 is used in a concentration of 62.5 μmol/L to 125 μmol/L.
4. The application of the inhibitor A2ti-1 in preparing antiviral drugs for resisting pseudorabies virus infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111498965.4A CN114277082B (en) | 2021-12-09 | 2021-12-09 | Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111498965.4A CN114277082B (en) | 2021-12-09 | 2021-12-09 | Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114277082A CN114277082A (en) | 2022-04-05 |
| CN114277082B true CN114277082B (en) | 2023-06-16 |
Family
ID=80871394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111498965.4A Active CN114277082B (en) | 2021-12-09 | 2021-12-09 | Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277082B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117815236B (en) * | 2024-03-06 | 2024-05-28 | 华南农业大学 | Application of Torrin 1 and pseudorabies virus inhibiting drug |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110731958A (en) * | 2019-10-25 | 2020-01-31 | 扬州大学 | Application of EGCG in preparation of preparation for preventing and/or treating PRV infection and preparation for preventing and/or treating PRV infection |
| CN110934862A (en) * | 2020-01-02 | 2020-03-31 | 四川农业大学 | Application of kaempferol in anti-pseudorabies virus medicine |
| WO2020092354A1 (en) * | 2018-10-29 | 2020-05-07 | Ullah Heyamet | Methods for treating virus infection or proliferation |
| CN113171374A (en) * | 2021-06-09 | 2021-07-27 | 扬州大学 | Application of sea buckthorn polysaccharide in preparation of preparation for preventing and/or treating porcine pseudorabies virus infection |
-
2021
- 2021-12-09 CN CN202111498965.4A patent/CN114277082B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020092354A1 (en) * | 2018-10-29 | 2020-05-07 | Ullah Heyamet | Methods for treating virus infection or proliferation |
| CN110731958A (en) * | 2019-10-25 | 2020-01-31 | 扬州大学 | Application of EGCG in preparation of preparation for preventing and/or treating PRV infection and preparation for preventing and/or treating PRV infection |
| CN110934862A (en) * | 2020-01-02 | 2020-03-31 | 四川农业大学 | Application of kaempferol in anti-pseudorabies virus medicine |
| CN113171374A (en) * | 2021-06-09 | 2021-07-27 | 扬州大学 | Application of sea buckthorn polysaccharide in preparation of preparation for preventing and/or treating porcine pseudorabies virus infection |
Non-Patent Citations (3)
| Title |
|---|
| Pseudorabies Virus Regulates the Extracellular Translocation of Annexin A2 To Promote Its Proliferation;Maoyang Weng等;J Virol;第第97卷卷(第第3期期);第e0154522篇 * |
| 膜联蛋白A2在病毒感染中的作用研究进展;李琼毅等;生物学杂志;第36卷(第6期);79-81 * |
| 靶向HP-PRRSV ORF7基因的siRNA重组伪狂病病毒的体外复制抑制效果;曹素芳;;中国兽医学报(11);4402-4450 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114277082A (en) | 2022-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7910366B2 (en) | Cell strain capable of being cultured without ingredients derived from animals, method of producing the same, method of producing virus using the same, and method of producing vaccine | |
| KR20000029968A (en) | Immortalized cell lines for virus growth | |
| NO343489B1 (en) | Method of amplifying a pox virus under serum-free conditions. | |
| CN111088319B (en) | Inactivated virus sample RNA preservation solution and preparation method thereof | |
| Pindak et al. | Growth and cytopathogenicity of Trichomonas vaginalis in tissue cultures | |
| CN114277082B (en) | Method for inhibiting pseudorabies virus in-vitro replication and proliferation by using inhibitor A2ti-1 and application | |
| Pham et al. | Isolation of Ontario aquatic bird bornavirus 1 and characterization of its replication in immortalized avian cell lines | |
| Zhang et al. | Complete genome sequence and pathogenesis of bovine viral diarrhea virus JL-1 isolate from cattle in China | |
| Mahmoud et al. | Prevalence of bovine herpesvirus-1 in sheep and goats in Egypt | |
| Wang et al. | Establishment and characterization of a new cell line from koi brain (Cyprinus carpio L.) | |
| Cui et al. | Synergy of subgroup J avian leukosis virus and Eimeria tenella to increase pathogenesis in specific-pathogen-free chickens | |
| Genovesi et al. | Effect of macrophage-specific colony-stimulating factor (CSF-1) on swine monocyte/macrophage susceptibility to in vitro infection by African swine fever virus | |
| CN112362880A (en) | IFA (IFA neutralizing antibody) detection method for PRRSV (porcine reproductive and respiratory syndrome Virus) | |
| Nišavić et al. | Molecular detection of bovine herpesvirus 1 (BoHV-1) in cattle in Serbia | |
| CN102416164A (en) | Application of interleukin-27 to preparation of medicine for resisting influenza A virus | |
| Claydon et al. | Attempts at producing a hybridised Penaeus mondon cell line by cellular fusion | |
| CN110484515B (en) | Vaccine vector for preventing FAdV-4 and NDV, and preparation method and application thereof | |
| CN108210497B (en) | Application of compound MLN4924 in preparation of bunyaviridae phlebovirus inhibitor | |
| JP2019511208A (en) | How to make a virus | |
| Saleh et al. | In vitro growth of the microsporidian Heterosporis saurida in the eel kidney EK-1 cell line | |
| Andoh et al. | The haemagglutination activity of equine herpesvirus type 1 glycoprotein C | |
| JP3994159B2 (en) | Animal-derived component-free culture medium and cell line production method using the same | |
| CN108531485A (en) | Applications of the pig miR-27b-3p as PRRS virus mortifier | |
| Elashmawy et al. | Seroprevalence and molecular detection of isolated BoHV-1 among farm animals | |
| CN117070476B (en) | Bovine herpesvirus 4 strain and application thereof in preparation of inactivated vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |