CN114277016B - RNase H mutant and application thereof - Google Patents
RNase H mutant and application thereof Download PDFInfo
- Publication number
- CN114277016B CN114277016B CN202111561645.9A CN202111561645A CN114277016B CN 114277016 B CN114277016 B CN 114277016B CN 202111561645 A CN202111561645 A CN 202111561645A CN 114277016 B CN114277016 B CN 114277016B
- Authority
- CN
- China
- Prior art keywords
- leu
- mutant
- rnase
- val
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an RNase H mutant, relates to the technical field of biology, and particularly relates to an RNase H mutant and application thereof. The RNase H mutant can accurately recognize and cut an RNA single strand in a DNA-RNA hybrid chain, so that the RNase H mutant does not recognize or cut a short hybrid chain, and the accuracy of recognizing and cutting a target fragment by the RNase H is improved.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an RNase H mutant and application thereof.
Background
Transcriptome sequencing (RNA-seq) can comprehensively and rapidly obtain almost all transcript sequence information of specific tissues or organs of a certain species under specific conditions, and is a main means for researching gene expression regulation. Samples in transcriptome sequencing are total RNA derived from cells or tissues isolated, including coding RNA (mRNA) and non-coding RNA (ncRNA). Ncrnas include lncRNA, rRNA, tRNA, miRNA and circRNA, etc. For target RNAs (mRNA and LncRNA) in transcriptome analysis, rRNA data is redundant information, as rRNA content is more than 80% of total RNA and transcript information is provided very little, wasting valuable sequencing data. Therefore, rRNA removal is required during RNA sequencing.
The current method for removing rRNA is an RNase H digestion method, a specific DNA probe is adopted to hybridize with rRNA, RNA single strands in a DNA-RNA hybridization chain can be specifically digested by utilizing RNase H, mRNA, lncRNA and the like which are not hybridized with the probe are not affected, and therefore target RNA is enriched. The method has good compatibility to low input samples (such as 10ng sample input) and poor quality samples (such as FFPE samples), and has high rRNA removal efficiency and low cost. The RNase H digestion method comprises three main steps of hybridization of the probe and rRNA, digestion of rRNA chain by RNase H and digestion of the probe by DNase I, wherein in the step of digestion of rRNA by RNase H, the characteristic that RNase H is an endonuclease can specifically digest RNA strand in DNA-RNA hybrid chain, and digestion of rRNA in the DNA probe and rRNA hybrid chain. In this method, there is a significant disadvantage in that the DNA probe is designed with the rRNA sequence as a template to try for specific matching, so that the length of the probe is generally 30nt or more, but even so, in the hybridization process of the probe and rRNA, there is incomplete hybridization of the DNA probe with a short sequence formed by RNA of non-rRNA, which is recognized and digested by RNase H, resulting in disruption or degradation of RNA of non-rRNA.
Thus, it becomes important to obtain an RNase H mutant capable of accurately recognizing and cleaving an RNA strand in a DNA-RNA hybrid strand.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides an RNase H mutant, which changes the identification length of a parent RNase H to a hybrid chain, so that the RNase H mutant does not identify or cut a short hybrid chain, and improves the accuracy of identifying and cutting a target fragment by the RNase H.
In order to achieve the above purpose, the present invention provides the following technical solutions:
in one aspect the invention provides an RNase H mutant comprising a mutation in the amino acid sequence shown in SEQ ID No.1, said mutation being one or more of an insertion, substitution or deletion, preferably said mutation comprising an amino acid substitution at one or more amino acid positions in the sequence of SEQ ID No. 1.
In some embodiments, the RNase H mutant comprises a substitution at amino acid 67 of the amino acid sequence shown in SEQ ID No. 1; preferably, the substitution is a substitution of D (aspartic acid) for Q (glutamine) or D for N (asparagine).
In some embodiments, the RNase H mutant is a substitution of glutamine for amino acid 67 in the amino acid sequence shown in SEQ ID No. 1.
In some embodiments, the RNase H mutant is a substitution of amino acid 67 in the sequence of SEQ ID No.1 to asparagine.
In some embodiments, the RNase H mutant comprises the amino acid sequence shown in SEQ ID No. 2.
In some embodiments, the RNase H mutant comprises the amino acid sequence shown in SEQ ID No. 3.
In some embodiments, the RNase H mutant has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID No.1 or SEQ ID No.2 or SEQ ID No.3 and has activity to recognize and cleave a single RNA strand in a DNA-RNA hybrid strand.
In some embodiments, the RNase H mutant is capable of recognizing and cleaving an RNA single strand in a DNA-RNA hybrid strand formed by at least 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, or 50nt complementary pairing.
In some embodiments, the RNase H mutant is capable of withstanding a high temperature of 65 ℃ for at least 4 hours, and the activity of recognizing and cleaving RNA single strands in a DNA-RNA hybrid strand is unchanged.
Nucleic acid encoding said RNase H mutant.
A vector comprising the nucleic acid encoding the RNase H mutant.
In another aspect, the invention provides a host cell for expressing the RNase H mutant according to the present invention.
In another aspect, the invention provides a method for preparing an RNase H mutant according to the present invention.
The invention also provides an application of the RNase H mutant in the rRNA removal step.
The invention also provides a kit, which comprises the RNase H mutant.
Substitution in the present invention is represented by triplets: letter-number-letter, wherein the number indicates the position of the mutated amino acid, the letter preceding the number corresponds to the amino acid to which the mutation relates, and the letter following the number indicates the amino acid used to replace the amino acid preceding the number.
Terminology
RNase H: ribonuclease H is capable of recognizing and cleaving RNA strands in the DNA-RNA hybrid strand.
rRNA residual Rate: the ratio of reads of rRNA in the sequencing data to the entire sequencing reads.
Drawings
FIG. 1A shows the results of denaturing gel assay for digestion of DNA-RNA hybrid strands of different lengths with the enzyme RNase H of example 1; FIG. 1B is a graph showing the results of the detection of denaturing gums by the RH1 mutase in example 1 on DNA-RNA hybrid strands of different lengths; FIG. 1C shows the results of denaturing gel assay for the RH2 mutase enzyme of example 1 on digestion of DNA-RNA hybrid strands of different lengths.
FIG. 2 shows the number of gene detections of RNA sample libraries treated by the enzyme digestion with the proenzyme RNase H and RH2 mutant of example 3.
FIG. 3 shows the result of rRNA digestion after high temperature treatment with the enzyme RNase H and RH2 mutant of example 4.
Detailed Description
The technical scheme of the invention is further described below by means of specific embodiments in combination with the accompanying drawings. However, the following examples are merely illustrative of the present invention and are not representative or limiting of the scope of the present invention. The protection scope of the invention is subject to the claims. In the examples below, reagents and consumables were purchased from commercial suppliers, and experimental methods and techniques were used as conventional in the art, unless otherwise specified.
Table 1 sequences referred to in the examples
| Primer name | Sequence (5 '. Fwdarw.3') | SEQ ID NO. |
| GAPDH gene upstream primer | ATTTGGCTACAGCAACAGGGTG | 7 |
| GAPDH gene downstream primer | AACTGGTTGAGCACAGGGTACTTTAT | 8 |
| PGK1 gene upstream primer | ACCAGGTAGGTTCTGAGACACTT | 9 |
| PGK1 gene downstream primer | GTGGTGGATTACCTGGAAGAG | 10 |
Example 1
The method comprises the steps of carrying out site mutation on a primase RNase H (the amino acid sequence is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO. 4) to obtain mutant enzyme, respectively digesting DNA-RNA hybrid chains with different lengths by using the primase and the mutant enzyme, observing whether the hybrid chains are broken or not, and evaluating the recognition and cutting functions of the mutant enzyme.
Obtaining a mutant protease: respectively carrying out RH1 and RH2 mutation on the RNase H, wherein the RH1 mutation refers to the substitution of the 67 th amino acid of the RNase H of the original enzyme from D to N, the RH2 mutation refers to the substitution of the 67 th amino acid of the RNase H of the original enzyme from D to Q, the mutated sequence is recombined into a PET expression vector, and protein expression is carried out in escherichia coli to respectively obtain the RNase H mutant protein RH1 mutant enzyme (the amino acid sequence is shown as SEQ ID NO.2, the nucleotide sequence is shown as SEQ ID NO. 5) and the RH2 mutant enzyme (the amino acid sequence is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO. 6).
Testing to identify cutting function: the original enzymes RNase H, RH1 mutant enzyme and RH2 mutant enzyme respectively digest DNA-RNA hybridization chains with different lengths at 37 ℃ for 30min with the same enzyme activity (5U/. Mu.l), wherein the DNA-RNA hybridization chains are respectively 1nt complementary, 2nt complementary, 4nt complementary, 6nt complementary, 8nt complementary and 11nt complementary, and the digested products are used for detecting whether the hybridization chains are cut through denaturing gel.
Comparison of recognition cutting functions: as shown in FIG. 1, when the RNA strand and the DNA strand are in 4nt complementary pairing to form a hybrid chain, the original enzyme RNase H can recognize the hybrid chain and cut, and the RH1 mutant enzyme and the RH2 mutant enzyme can not cut the hybrid chain in the 4nt complementary pairing, when the RNA strand and the DNA strand are in 6nt complementary pairing to form the hybrid chain, the RH1 mutant enzyme and the RH2 mutant enzyme can recognize the hybrid chain and cut, and the RH1 mutant enzyme has a stronger cutting effect than the RH2 mutant enzyme.
Example 2
Total RNA (Total RNA) extracted from 1 μg of human HEK293 cells is used as a starting sample, the Total RNA is subjected to rRNA removal by using a primordial enzyme RNase H and an RH2 mutant enzyme, and the expression amounts of reference genes GAPDH mRNA and PGK1 mRNA in the RNA sample after rRNA removal are detected by QPCR, so that the influence of the mutant enzyme on non-rRNA is evaluated.
Obtaining rRNA-removed RNA samples: rRNA in Total RNA was removed by using and referring to the method of Ribo-off rRNA Depletion Kit (Human/Mouse/Rat) kit (Cat N406) from Nanjinozan Biotechnology Co., ltd, wherein in the RNase H digestion step, the RNase H digestion step was performed using the original enzyme RNase H (10U/. Mu.l) and the RH2 mutase (10U/. Mu.l), respectively, and Nanjinozan Biotechnology Co., ltd was usedThe digested product was subjected to nucleic acid purification using RNA Clean reads kit (cat. No. N412), and 35. Mu.l of nucleic-free ddH was finally used 2 O was eluted and 30. Mu.l of the supernatant was used as the template for the subsequent QPCR.
QPCR detects the expression levels of GAPDH mRNA and PGK1 mRNA: the expression levels of the GAPDH gene mRNA and the PGK1 gene mRNA were measured using the Nannofacian Biotechnology Co., ltd. HiScript II One Step qRT-PCR SYBR Green Kit kit (cat. No. Q221), and the primers used therein are shown in Table 1.
QPCR detection results: table 2 shows the results of QPCR, both in the GAPDH gene and in the PGK1 gene, the Ct value obtained by the enzyme RNase H for the digestion step was greater than that obtained by the enzyme RH2 mutant, indicating that the use of the enzyme RH2 mutant had less effect on other RNAs than rRNA.
TABLE 2 expression level of GAPDH Gene and PGK1 Gene mRNA
Example 3
Total RNA (Total RNA) extracted from 1 μg of human HEK293 cells is used as a starting sample, the Total RNA is subjected to rRNA removal by using a primordial enzyme RNase H and an RH2 mutant enzyme, and a strand specific transcriptome library is constructed on the RNA sample after rRNA removal.
RNA samples were obtained from rRNA removal as in example 2, and strand-specific library construction was performed using the Nanjinovirzan biotechnology Co., ltd. VAHTS Universal V RNA-seq Library Prep Kit for Illumina kit (cat. NR 605) to analyze the library products by sequencing.
As shown in FIG. 2, the detection number of library genes constructed using RH2 mutant enzyme was higher than that constructed using the enzyme RNase H.
Example 4
Total RNA (Total RNA) extracted from 1 mug of human HEK293 cells is taken as a starting sample, the enzyme RNase H and RH2 mutant enzyme are subjected to different high temperature treatment time, rRNA is removed from the Total RNA, and a strand specific transcriptome library is constructed on the removed RNA to evaluate the high temperature tolerance of the mutant enzyme.
And respectively placing the original enzyme RNase H and RH2 mutant enzyme at 65 ℃ for 1H and 4H, and obtaining the original enzyme RNase H and RH2 mutant enzyme after high-temperature treatment.
RNA samples from which rRNA was removed were obtained as in example 2, and strand-specific library construction was performed using the kit (cat# NR 605) of VAHTS Universal V RNA-seq Library Prep Kit for Illumina, nanjinouzan biotechnology Co., ltd., wherein in the RNase H digestion step, the library products obtained were subjected to sequencing analysis using the non-high temperature treated enzyme RNase H and RH2 mutant enzymes and the high temperature treated enzyme RNase H and RH2 mutant enzymes, respectively.
As shown in FIG. 3, sequencing data shows rRNA residual rate, when RH2 mutant enzyme is treated at 65 ℃ for 4 hours, rRNA residual rate is less than 5%, which indicates that the mutant enzyme after high temperature treatment has better digestion effect on rRNA in heterozygote chain, and the rRNA residual rate of the original enzyme RNase H after high temperature treatment is much higher than that before high temperature treatment, which indicates that the activity of the original enzyme RNase H is obviously weakened after high temperature treatment.
Sequence listing
<110> Nanjinouzan Biotech Co., ltd
<120> an RNase H mutant and use thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 299
<212> PRT
<213> human source (Homo sapiens)
<400> 1
Met Asp Leu Ser Glu Leu Glu Arg Asp Asn Thr Gly Arg Cys Arg Leu
1 5 10 15
Ser Ser Pro Val Pro Ala Val Cys Arg Lys Glu Pro Cys Val Leu Gly
20 25 30
Val Asp Glu Ala Gly Arg Gly Pro Val Leu Gly Pro Met Val Tyr Ala
35 40 45
Ile Cys Tyr Cys Pro Leu Pro Arg Leu Ala Asp Leu Glu Ala Leu Lys
50 55 60
Val Ala Asp Ser Lys Thr Leu Leu Glu Ser Glu Arg Glu Arg Leu Phe
65 70 75 80
Ala Lys Met Glu Asp Thr Asp Phe Val Gly Trp Ala Leu Asp Val Leu
85 90 95
Ser Pro Asn Leu Ile Ser Thr Ser Met Leu Gly Arg Val Lys Tyr Asn
100 105 110
Leu Asn Ser Leu Ser His Asp Thr Ala Thr Gly Leu Ile Gln Tyr Ala
115 120 125
Leu Asp Gln Gly Val Asn Val Thr Gln Val Phe Val Asp Thr Val Gly
130 135 140
Met Pro Glu Thr Tyr Gln Ala Arg Leu Gln Gln Ser Phe Pro Gly Ile
145 150 155 160
Glu Val Thr Val Lys Ala Lys Ala Asp Ala Leu Tyr Pro Val Val Ser
165 170 175
Ala Ala Ser Ile Cys Ala Lys Val Ala Arg Asp Gln Ala Val Lys Lys
180 185 190
Trp Gln Phe Val Glu Lys Leu Gln Asp Leu Asp Thr Asp Tyr Gly Ser
195 200 205
Gly Tyr Pro Asn Asp Pro Lys Thr Lys Ala Trp Leu Lys Glu His Val
210 215 220
Glu Pro Val Phe Gly Phe Pro Gln Phe Val Arg Phe Ser Trp Arg Thr
225 230 235 240
Ala Gln Thr Ile Leu Glu Lys Glu Ala Glu Asp Val Ile Trp Glu Asp
245 250 255
Ser Ala Ser Glu Asn Gln Glu Gly Leu Arg Lys Ile Thr Ser Tyr Phe
260 265 270
Leu Asn Glu Gly Ser Gln Ala Arg Pro Arg Ser Ser His Arg Tyr Phe
275 280 285
Leu Glu Arg Gly Leu Glu Ser Ala Thr Ser Leu
290 295
<210> 2
<211> 299
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Asp Leu Ser Glu Leu Glu Arg Asp Asn Thr Gly Arg Cys Arg Leu
1 5 10 15
Ser Ser Pro Val Pro Ala Val Cys Arg Lys Glu Pro Cys Val Leu Gly
20 25 30
Val Asp Glu Ala Gly Arg Gly Pro Val Leu Gly Pro Met Val Tyr Ala
35 40 45
Ile Cys Tyr Cys Pro Leu Pro Arg Leu Ala Asp Leu Glu Ala Leu Lys
50 55 60
Val Ala Asn Ser Lys Thr Leu Leu Glu Ser Glu Arg Glu Arg Leu Phe
65 70 75 80
Ala Lys Met Glu Asp Thr Asp Phe Val Gly Trp Ala Leu Asp Val Leu
85 90 95
Ser Pro Asn Leu Ile Ser Thr Ser Met Leu Gly Arg Val Lys Tyr Asn
100 105 110
Leu Asn Ser Leu Ser His Asp Thr Ala Thr Gly Leu Ile Gln Tyr Ala
115 120 125
Leu Asp Gln Gly Val Asn Val Thr Gln Val Phe Val Asp Thr Val Gly
130 135 140
Met Pro Glu Thr Tyr Gln Ala Arg Leu Gln Gln Ser Phe Pro Gly Ile
145 150 155 160
Glu Val Thr Val Lys Ala Lys Ala Asp Ala Leu Tyr Pro Val Val Ser
165 170 175
Ala Ala Ser Ile Cys Ala Lys Val Ala Arg Asp Gln Ala Val Lys Lys
180 185 190
Trp Gln Phe Val Glu Lys Leu Gln Asp Leu Asp Thr Asp Tyr Gly Ser
195 200 205
Gly Tyr Pro Asn Asp Pro Lys Thr Lys Ala Trp Leu Lys Glu His Val
210 215 220
Glu Pro Val Phe Gly Phe Pro Gln Phe Val Arg Phe Ser Trp Arg Thr
225 230 235 240
Ala Gln Thr Ile Leu Glu Lys Glu Ala Glu Asp Val Ile Trp Glu Asp
245 250 255
Ser Ala Ser Glu Asn Gln Glu Gly Leu Arg Lys Ile Thr Ser Tyr Phe
260 265 270
Leu Asn Glu Gly Ser Gln Ala Arg Pro Arg Ser Ser His Arg Tyr Phe
275 280 285
Leu Glu Arg Gly Leu Glu Ser Ala Thr Ser Leu
290 295
<210> 3
<211> 299
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Met Asp Leu Ser Glu Leu Glu Arg Asp Asn Thr Gly Arg Cys Arg Leu
1 5 10 15
Ser Ser Pro Val Pro Ala Val Cys Arg Lys Glu Pro Cys Val Leu Gly
20 25 30
Val Asp Glu Ala Gly Arg Gly Pro Val Leu Gly Pro Met Val Tyr Ala
35 40 45
Ile Cys Tyr Cys Pro Leu Pro Arg Leu Ala Asp Leu Glu Ala Leu Lys
50 55 60
Val Ala Gln Ser Lys Thr Leu Leu Glu Ser Glu Arg Glu Arg Leu Phe
65 70 75 80
Ala Lys Met Glu Asp Thr Asp Phe Val Gly Trp Ala Leu Asp Val Leu
85 90 95
Ser Pro Asn Leu Ile Ser Thr Ser Met Leu Gly Arg Val Lys Tyr Asn
100 105 110
Leu Asn Ser Leu Ser His Asp Thr Ala Thr Gly Leu Ile Gln Tyr Ala
115 120 125
Leu Asp Gln Gly Val Asn Val Thr Gln Val Phe Val Asp Thr Val Gly
130 135 140
Met Pro Glu Thr Tyr Gln Ala Arg Leu Gln Gln Ser Phe Pro Gly Ile
145 150 155 160
Glu Val Thr Val Lys Ala Lys Ala Asp Ala Leu Tyr Pro Val Val Ser
165 170 175
Ala Ala Ser Ile Cys Ala Lys Val Ala Arg Asp Gln Ala Val Lys Lys
180 185 190
Trp Gln Phe Val Glu Lys Leu Gln Asp Leu Asp Thr Asp Tyr Gly Ser
195 200 205
Gly Tyr Pro Asn Asp Pro Lys Thr Lys Ala Trp Leu Lys Glu His Val
210 215 220
Glu Pro Val Phe Gly Phe Pro Gln Phe Val Arg Phe Ser Trp Arg Thr
225 230 235 240
Ala Gln Thr Ile Leu Glu Lys Glu Ala Glu Asp Val Ile Trp Glu Asp
245 250 255
Ser Ala Ser Glu Asn Gln Glu Gly Leu Arg Lys Ile Thr Ser Tyr Phe
260 265 270
Leu Asn Glu Gly Ser Gln Ala Arg Pro Arg Ser Ser His Arg Tyr Phe
275 280 285
Leu Glu Arg Gly Leu Glu Ser Ala Thr Ser Leu
290 295
<210> 4
<211> 898
<212> DNA
<213> human source (Homo sapiens)
<400> 4
atggatctca gcgagctgga gagagacaat acaggccgct gtcgcctgag ttcgcctgtg 60
cccgcggtgt gccgcaagga gccttgcgtc ctgggcgtcg atgaggcggg caggggcccc 120
gtgctgggcc ccatggtcta cgccatctgt tattgtcccc tgcctcgcct ggcagatctg 180
gaggcgctga aagtggcaga ctcaaagacc ctattggaga gcgagcggga aaggctgttt 240
gcgaaaatgg aggacacgga ctttgtcggc tgggcgctgg atgtgctgtc tccaaacctc 300
atctctacca gcatgcttgg gcgggtcaaa tacaacctga actccctgtc acatgataca 360
gccactgggc ttatacagta tgcattggac cagggcgtga acgtcaccca ggtattcgtg 420
gacaccgtag ggatgccaga gacataccag gcgcggctgc agcaaagttt tcccgggatt 480
gaggtgacgg tcaaggccaa agcagatgcc ctctacccgg tggttagtgc tgccagcatc 540
tgtgccaagg tggcccggga ccaggccgtg aagaaatggc agttcgtgga gaaactgcag 600
gacttggata ctgattatgg ctcaggctac cccaatgatc ccaagacaaa agcgtggttg 660
aaggagcacg tggagcctgt gttcggcttc ccccagtttg tccggttcag ctggcgcacg 720
gcccagacca tcctggagaa agaggcggaa gatgttatag gaggactcag catccgagaa 780
tcaggaggga ctcaggaaga tcacatccta cttcctcaat gaagggtccc aagcccgtcc 840
ccgttcttcc caccgatatt tcctggaacg cggcctggag tcagcaacca gcctctag 898
<210> 5
<211> 898
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atggatctca gcgagctgga gagagacaat acaggccgct gtcgcctgag ttcgcctgtg 60
cccgcggtgt gccgcaagga gccttgcgtc ctgggcgtcg atgaggcggg caggggcccc 120
gtgctgggcc ccatggtcta cgccatctgt tattgtcccc tgcctcgcct ggcagatctg 180
gaggcgctga aagtggcaaa ctcaaagacc ctattggaga gcgagcggga aaggctgttt 240
gcgaaaatgg aggacacgga ctttgtcggc tgggcgctgg atgtgctgtc tccaaacctc 300
atctctacca gcatgcttgg gcgggtcaaa tacaacctga actccctgtc acatgataca 360
gccactgggc ttatacagta tgcattggac cagggcgtga acgtcaccca ggtattcgtg 420
gacaccgtag ggatgccaga gacataccag gcgcggctgc agcaaagttt tcccgggatt 480
gaggtgacgg tcaaggccaa agcagatgcc ctctacccgg tggttagtgc tgccagcatc 540
tgtgccaagg tggcccggga ccaggccgtg aagaaatggc agttcgtgga gaaactgcag 600
gacttggata ctgattatgg ctcaggctac cccaatgatc ccaagacaaa agcgtggttg 660
aaggagcacg tggagcctgt gttcggcttc ccccagtttg tccggttcag ctggcgcacg 720
gcccagacca tcctggagaa agaggcggaa gatgttatag gaggactcag catccgagaa 780
tcaggaggga ctcaggaaga tcacatccta cttcctcaat gaagggtccc aagcccgtcc 840
ccgttcttcc caccgatatt tcctggaacg cggcctggag tcagcaacca gcctctag 898
<210> 6
<211> 898
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
atggatctca gcgagctgga gagagacaat acaggccgct gtcgcctgag ttcgcctgtg 60
cccgcggtgt gccgcaagga gccttgcgtc ctgggcgtcg atgaggcggg caggggcccc 120
gtgctgggcc ccatggtcta cgccatctgt tattgtcccc tgcctcgcct ggcagatctg 180
gaggcgctga aagtggcaca gtcaaagacc ctattggaga gcgagcggga aaggctgttt 240
gcgaaaatgg aggacacgga ctttgtcggc tgggcgctgg atgtgctgtc tccaaacctc 300
atctctacca gcatgcttgg gcgggtcaaa tacaacctga actccctgtc acatgataca 360
gccactgggc ttatacagta tgcattggac cagggcgtga acgtcaccca ggtattcgtg 420
gacaccgtag ggatgccaga gacataccag gcgcggctgc agcaaagttt tcccgggatt 480
gaggtgacgg tcaaggccaa agcagatgcc ctctacccgg tggttagtgc tgccagcatc 540
tgtgccaagg tggcccggga ccaggccgtg aagaaatggc agttcgtgga gaaactgcag 600
gacttggata ctgattatgg ctcaggctac cccaatgatc ccaagacaaa agcgtggttg 660
aaggagcacg tggagcctgt gttcggcttc ccccagtttg tccggttcag ctggcgcacg 720
gcccagacca tcctggagaa agaggcggaa gatgttatag gaggactcag catccgagaa 780
tcaggaggga ctcaggaaga tcacatccta cttcctcaat gaagggtccc aagcccgtcc 840
ccgttcttcc caccgatatt tcctggaacg cggcctggag tcagcaacca gcctctag 898
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atttggctac agcaacaggg tg 22
<210> 8
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
aactggttga gcacagggta ctttat 26
<210> 9
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
accaggtagg ttctgagaca ctt 23
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gtggtggatt acctggaaga g 21
Claims (7)
1. An RNaseH mutant, wherein the amino acid sequence of the mutant is shown as SEQ ID NO.2 or SEQ ID NO. 3.
2. A nucleic acid encoding the RNaseH mutant of claim 1.
3. A vector comprising the nucleic acid of claim 2.
4. A host cell comprising the RNaseH mutant of claim 1, the nucleic acid of claim 2, or the vector of claim 3.
5. A method of making site-directed mutagenesis of the RNaseH mutant of claim 1.
6. Use of the RNaseH mutant of claim 1 in a step of removing rRNA during transcriptome banking.
7. A kit comprising the RNaseH mutant of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111561645.9A CN114277016B (en) | 2021-12-20 | 2021-12-20 | RNase H mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111561645.9A CN114277016B (en) | 2021-12-20 | 2021-12-20 | RNase H mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114277016A CN114277016A (en) | 2022-04-05 |
| CN114277016B true CN114277016B (en) | 2023-08-29 |
Family
ID=80873108
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111561645.9A Active CN114277016B (en) | 2021-12-20 | 2021-12-20 | RNase H mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114277016B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007141580A2 (en) * | 2006-06-09 | 2007-12-13 | Medical Research Council | Rnase h2 complex and genes therefor |
| CN107119043A (en) * | 2017-04-28 | 2017-09-01 | 北京全式金生物技术有限公司 | A kind of non-targeted RNA method in removal RNA samples |
| CN111378720A (en) * | 2018-12-29 | 2020-07-07 | 浙江安诺优达生物科技有限公司 | Construction method and application of sequencing library of long-chain non-coding RNA |
-
2021
- 2021-12-20 CN CN202111561645.9A patent/CN114277016B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007141580A2 (en) * | 2006-06-09 | 2007-12-13 | Medical Research Council | Rnase h2 complex and genes therefor |
| CN107119043A (en) * | 2017-04-28 | 2017-09-01 | 北京全式金生物技术有限公司 | A kind of non-targeted RNA method in removal RNA samples |
| CN111378720A (en) * | 2018-12-29 | 2020-07-07 | 浙江安诺优达生物科技有限公司 | Construction method and application of sequencing library of long-chain non-coding RNA |
Non-Patent Citations (1)
| Title |
|---|
| ribonuclease H2 subunit A [Homo sapiens];NP_006388 .2;《GenBank数据库》;参见序列部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114277016A (en) | 2022-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113166797B (en) | Nuclease-based RNA depletion | |
| US20180208968A1 (en) | Methods for depleting rna from nucleic acid samples | |
| RU2603082C2 (en) | Methods of sequencing of three-dimensional structure of the analyzed genome region | |
| CN110520542A (en) | Method for targeting nucleic acid sequence enrichment and the application in the nucleic acid sequencing of error correcting | |
| EP3854873A1 (en) | Compositions and methods for accurately identifying mutations | |
| US20050277139A1 (en) | Methods and apparatus for the detection and validation of microRNAs | |
| CN110628880B (en) | Method for detecting gene variation by synchronously using messenger RNA and genome DNA template | |
| US10563268B2 (en) | Long non-coding RNA and use thereof in detection of intramuscular fat in pigs | |
| CN108103206B (en) | Intramuscular fat related lncRNA and application thereof | |
| CN108251539A (en) | A kind of and the relevant SNP marker of chicken Carcass Traits and its application, detection primer, detection kit | |
| EP4061963A1 (en) | Method for identifying gene fusions by circle cdna amplification | |
| CN108085399B (en) | Novel application of lncRNA and trans-regulatory gene WNT11 thereof | |
| CN114277016B (en) | RNase H mutant and application thereof | |
| CN112662771B (en) | Targeting capture probe of tumor fusion gene and application thereof | |
| AU2018367394A1 (en) | Method for making a cDNA library | |
| CN104726604B (en) | Decayed-sample degradation DNA (deoxyribonucleic acid) detection method and application thereof | |
| WO2017037057A1 (en) | Novel mirna biomarkers and use thereof | |
| US11155853B2 (en) | System and method for targeted depletion of nucleic acids | |
| US20190203272A1 (en) | Use of brca1 and/or jaml genes in predicting intramuscular fat content of pork and in selective breeding of pigs | |
| JP5546165B2 (en) | Non-japonica eel detection primer set, non-japonica eel contamination inspection method, and eel species identification method | |
| CN110592183A (en) | Preparation method of high-throughput sequencing library for detecting ultralow-frequency gene mutation | |
| CN108103064B (en) | Long-chain non-coding RNA and application thereof | |
| CN112522425A (en) | Marker gene for DPC cell identification and classification, screening method and application | |
| KR102578040B1 (en) | Composition for determining the growth stage of fetal bovine and use thereof | |
| KR101330398B1 (en) | DNA fragment markers for detecting improvement of porcine meat quality using SNPs in region of muscle specific microRNA-1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |