CN114250326A - Kit for detecting hepatitis B virus DNA by one-tube method and application thereof - Google Patents
Kit for detecting hepatitis B virus DNA by one-tube method and application thereof Download PDFInfo
- Publication number
- CN114250326A CN114250326A CN202210184581.3A CN202210184581A CN114250326A CN 114250326 A CN114250326 A CN 114250326A CN 202210184581 A CN202210184581 A CN 202210184581A CN 114250326 A CN114250326 A CN 114250326A
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- kit
- extracting solution
- virus
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of kits. The invention provides a kit for detecting hepatitis B virus DNA by a one-tube method and application thereof. The kit comprises two components. One is a highly efficient extraction reagent: compared with the existing extraction reagent, the extraction reagent is simpler to operate and more convenient to use; does not contain organic solution, protects operators and reduces environmental pollution. The hepatitis B virus DNA in the serum can be efficiently combined on the magnetic beads by only 3 steps of operation. The other component is an amplification reagent: the primers and the probes for amplification are complementarily combined with common segments of genotypes B, C and D, and the amplification efficiency is up to more than 95%; but does not bind with nucleic acid sequences of other viruses (such as EB virus, hepatitis C virus, hepatitis A virus and the like) and has high specificity. The minimum detection limit for serum samples was 5 international units/ml.
Description
Technical Field
The invention relates to the technical field of kits, in particular to a kit for detecting hepatitis B virus DNA by a one-tube method and application thereof.
Background
The current DNA extraction methods applied to real-time fluorescent quantitative PCR detection mainly comprise four methods, namely an alkali cracking method, a boiling cracking method, a chromatographic column method and a magnetic bead method. The magnetic bead method for extracting DNA is to crack cells by using a cell lysis solution, DNA molecules released from the cells are specifically adsorbed to the surfaces of magnetic particles, and impurities such as protein and the like are not adsorbed and remain in the solution. After reacting for a certain time, separating the magnetic particles from the liquid under the action of a magnetic field, recovering the particles (namely the magnetic bead-DNA mixture), and eluting with an eluent to obtain pure DNA. And adding the pure DNA into the PCR reaction solution to perform fluorescent quantitative PCR reaction.
The extraction agent used in the extraction process of the current commonly used magnetic bead method is various, and the use of a large amount of organic solvent is easy to cause harm to operators. And in the whole elution process, protein and salt molecules can be removed relatively thoroughly by washing in multiple steps, so that the time consumption of the whole real-time fluorescence quantitative PCR detection process is increased, the workload of operation is increased, pollution is easy to occur, and the final detection precision is influenced. In addition, since DNA extraction and PCR amplification are not performed in the same vector, mishandling during extract transfer can also affect the final result, and the increase in the number of washes is also prone to laboratory contamination and DNA loss.
Therefore, how to develop a kit for realizing extraction and amplification of DNA in one tube, and identifying HBV fragments for amplification through a specific sequence of a primer probe has the advantages that products extracted by a magnetic bead method and PCR amplification are carried out in the same carrier, DNA loss caused by multiple elution and washing is not needed, and the kit has important significance for improving the clinical detection quality.
Disclosure of Invention
The invention aims to provide a kit for detecting hepatitis B virus DNA by a tube method and application thereof, the extraction reagent of the invention uses a magnetic bead method to extract hepatitis B virus nucleic acid (DNA), and the whole magnetic bead is added into reaction liquid for fluorescent quantitative PCR detection, thereby reducing nucleic acid loss and indirect pollution caused by washing for several times, greatly improving the detection sensitivity and reaching the lowest detection limit of 5 IU/ml.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a hepatitis B virus DNA quantitative detection kit, which comprises an upstream primer, a downstream primer, a probe and a hepatitis B virus DNA extracting solution;
the sequence of the upstream primer is as follows:
a-1：ACTGTTCAAGCCTCCAAG；
b-1：TAGGAGGCTGTAGGCATAAAT；
or c-1: TTGTTGGTTCTTCTGGACTA, respectively;
the sequence of the downstream primer is as follows:
a-2：AGAGTAACTCCACAGAAGC；
b-2：AGATGATTAGGCAGAGGTGAA；
or c-2: GTGCTGGTGGTTGATGAT, respectively;
the sequence of the probe is as follows:
a-3：TGTGCCTTGGGTGGCTTTGGGGCAT；
b-3：AGGCATAAATTGGTCTGTTCACCAGCACCAT；
or c-3: TCAAGGTATGTTGCCCGTTTGT are provided.
Preferably, the hepatitis B virus DNA extracting solution comprises extracting solution 1-4, wherein the extracting solution 1 is one or more of triton X-100, guanidinium isothiocyanate, guanidinium hydrochloride, Tris, SDS, EDTA and sodium chloride.
Preferably, the extract 2 is one or more of 4-hydroxyethylpiperazine ethanesulfonic acid, sodium chloride, magnetic beads, CTBA buffer solution and 1 XTE buffer solution.
Preferably, the extracting solution 3 is one or more of 4-hydroxyethyl piperazine ethanesulfonic acid, triton X-100, Tris, SDS and sodium chloride.
Preferably, the extracting solution 4 is one or more of mineral oil and paraffin oil.
Preferably, the volume ratio of the extracting solution 1-4 is 1-3: 2-4: 4-8: 1 to 3.
Preferably, when the kit is used for extracting serum, the volume ratio of the extracting solution 1 to the serum to the extracting solution 2 is 3-5: 2-4: 0.5 to 1.5; the volume ratio of the extracting solution 3 to the extracting solution 4 is 2-4: 0.5 to 1.5.
Preferably, the lowest detection limit of the kit on B, C, D gene is 5 IU/ml; the amplification efficiency of the kit to B, C, D gene is more than 95%.
Preferably, the procedure for the kit amplification is as follows: 48-52 ℃ for 4-10 min; 93-97 ℃ for 1-3 min; (92-98 ℃, 10-20 s; 55-65 ℃, 30-38 s) for 42-48 cycles; 22-28 ℃ for 8-12 s.
The invention also provides application of the kit in preparation of hepatitis B virus DNA detection products.
The invention provides a hepatitis B virus DNA quantitative detection kit, which comprises an upstream primer, a downstream primer, a probe and a hepatitis B virus DNA extracting solution, wherein the sequence of the upstream primer is shown as SEQ ID NO: 1, the sequence of the downstream primer is shown as SEQ ID NO: 2, the sequence of the probe is shown as SEQ ID NO: 3, respectively. The kit disclosed by the invention is simple in operation steps, does not use organic solution, reduces the harm of organic reagents to operators and reduces the pollution to the environment. Meanwhile, only 3 steps are needed to extract the HBV virus in the serum to the magnetic beads. The designed primer probe can specifically recognize common fragments of B, C, D genes, and the amplification efficiency reaches more than 95%. The specificity is very strong, the DNA extraction and amplification can be realized in one tube by specifically recognizing the gene segment of the hepatitis B virus B, C, D, the operation is convenient and quick, and the sensitivity is high. The kit can directly add the DNA mixture adsorbed on the magnetic beads into a PCR reaction system for detection, and the specific sequence of the primer probe is used for identifying HBV fragments for amplification, so that the advantage that products extracted by the magnetic bead method and the PCR amplification are carried out in the same carrier without DNA loss caused by multiple elution and washing is realized, the detection sensitivity is improved, and the kit has important significance for improving the clinical detection quality.
Drawings
FIG. 1 is a C gene map of the national ginseng in example 1;
FIG. 2 is a C gene map of example 2;
FIG. 3 is a plot of the quantitative restriction experiment for the gene C in example 4;
FIG. 4 is a diagram showing quantitative limiting amplification of the C gene in example 4;
FIG. 5 is a plot of the quantitative restriction experiment for the gene B in example 5;
FIG. 6 is a diagram showing quantitative limiting amplification of the gene B in example 5;
FIG. 7 is a drawing showing a C gene map of a restriction enzyme for quantitative determination of the D gene in example 6;
FIG. 8 is a diagram showing quantitative restriction amplification of the D genotype in example 6;
FIG. 9 is a graph of the fit of example 7 after assigning a value to 4 positive samples using two standard curves;
FIG. 10 shows the genetic marker of example 7, Chinese ginseng B;
FIG. 11 is a reference mark of the homemade enterprise in example 7;
FIG. 12 shows the lowest detected peak of genotype C at 12 out of example 3;
FIG. 13 shows the case of 12-12 peak-out of the lowest detection limit of the C gene in example 3;
FIG. 14 shows the peak-out-of-minimum detection limit condition 12 of the B gene in example 3;
FIG. 15 shows the peak-out-of-minimum detection limit condition 12 of the B gene in example 3;
FIG. 16 shows the peak-limited minimum detection condition 12 and 12 of the D gene in example 3;
FIG. 17 shows the peak-limiting detection condition 12 and 12 for the D gene in example 3.
Detailed Description
In the present invention, the B, C, D gene is a B, C, D genotyping gene for hepatitis B.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1 extraction and amplification of sample DNA
(1) Mixing 400 μ l of extractive solution 1 (prepared from Triton X-100 and 5M guanidinium isothiocyanate at a volume ratio of 1: 80), 300 μ l of serum and 100 μ l of extractive solution 2 (prepared from 4-hydroxyethyl piperazine ethanesulfonic acid 20mM, 2M sodium chloride and magnetic beads at a volume ratio of 7: 1: 2) in a centrifuge tube, standing for 10min, and centrifuging at 500rpm for 30 s;
(2) centrifuging, placing the centrifuge tube on a magnetic bead separator, standing for 1min, and removing waste liquid;
(3) adding 600 μ l of extractive solution 3 (prepared from Triton X-100 and 2M sodium chloride at a volume ratio of 1: 100) and 200 μ l of mineral oil into a centrifuge tube, mixing, and centrifuging at 500rpm for 30 s;
(4) after centrifugation, placing the centrifugal tube on a magnetic bead separator, standing for 1min, and centrifuging at 500rpm for 20 seconds after waste liquid is removed;
(5) placing the centrifugal tube on a magnetic bead separator after centrifugation, standing for 1min, removing waste liquid again, adding 40ul of reaction liquid, and mixing to obtain a mixed liquid for later use; (the reaction solution is 10.4. mu.l of primer and probe mixture, 4.6. mu.l of water, and 25. mu.l of enzyme mixture (Taq enzyme, UNG enzyme, magnesium ion, and deoxyribonucleoside triphosphate) for 40 ul);
(6) the mixture was subjected to PCR according to the procedure of Table 1.
TABLE 1
Example 2 calculation of extraction efficiency
The national reference C gene sample with known concentration is extracted by the method of example 1, and is substituted into the value calculated by the standard curve to be compared with the standard value. I.e. concentration calculated substituted into standard/sample concentration 100= extraction efficiency%. The national reference C gene standard curve is shown in FIG. 2, and the results are shown in Table 2.
TABLE 2
Example 3 lowest detection Limit of 3B, C, D Gene
The concentration using the national reference substance is shown in the table 2, after the gradient dilution is carried out to 5IU/ml, 24 times of repeated detection are carried out, if 23 times of peak detection are carried out, the positive detection rate of 95 percent which is regulated by the drug administration is met. 23/24=95.8% shows the lowest peak detection limit number of the C gene, and the peak is detected by 24 samples of 5IU/ml, as shown in FIG. 12 and FIG. 13, and the peak is detected by 24 samples of 5IU/ml, and the peak is detected by the lowest peak detection limit number of the B gene, as shown in FIG. 14 and FIG. 15. As shown in FIG. 16 and FIG. 17, the number of peaks was the lowest detection limit of the D gene, and the peak was detected in 24 samples of 5 IU/ml. I.e. meets the minimum detection limit requirement. Therefore, the lowest detection limit of the B, C, D gene is 5 IU/ml.
Example 4C Gene quantitation Limit
Use of C Gene Panax japonicus 5 x 107IU/ml samples were diluted in 10-fold gradient with template concentrations of 5 x 106IU/ml、5*105IU/ml、5*104IU/ml、5*103IU/ml、5*102IU/ml and other 5 concentrations, continuously diluting the samples to 10IU/ml templates, performing amplification experiments after extracting the samples to obtain data shown in the following table 3, making standard curves by using the 5 gradient CT values corresponding to the concentration logC, substituting the CT values detected for 11 times by the 10IU/ml template into the standard curves, and calculating to obtain the difference value between the logC value and the standard logC value which is less than or equal to 0.4, namely the detected concentration of 10IU/ml meets the accuracy requirement, and obtaining the C genotype quantitative limit of 10 IU/ml. Meanwhile, the amplification efficiency of the standard yeast is calculated to be 105.96 percent, which meets the preparation requirement of the standard yeast. The coefficient of variation of the CT value of the template with 10IU/ml is calculated to be 0.54 percent, and the requirement of regulation is met. See fig. 2 and 3.
TABLE 3
Example 5B Gene quantitation Limit
Use of B Gene Panax japonicus 5 x 106IU/ml samples were diluted in 10-fold gradient with template concentrations of 5 x 105IU/ml、5*104IU/ml、5*103IU/ml、5*102IU/ml、5*101IU/ml and other 5 concentrations, continuously diluting the samples to 10IU/ml templates, carrying out amplification experiments on the samples after extraction to obtain the following data, making a standard curve by using the 5 gradient CT values corresponding to the concentration logC, substituting the 11 CT values detected by the 10IU/ml template into the standard curve, and calculating to obtain a logC value and a marked log value, wherein the difference between the logC value and the marked log value is not more than 0.4, namely the detected concentration of 10IU/ml meets the accuracy requirement, and the B genotype quantification limit is 10 IU/ml. Meanwhile, the amplification efficiency of the standard yeast is calculated to be 103.58 percent, which meets the preparation requirement of the standard yeast. The coefficient of variation of the CT value of the template with 10IU/ml is calculated to be 1.334 percent, which meets the specified requirements. See fig. 4 and 5.
TABLE 4
Example 6D Gene quantitation Limit
Since the D gene is of a rare genotype and is not provided by the national ginseng of the institute, the research was carried out by synthesizing a D gene plasmid, and the quantitative concentration of the D gene plasmid after synthesis is 6.57 x 1013copy/ml, which was diluted 10-fold in a gradient to D3(6.57 x 10)3copy/ml), making a standard curve by using the national reference C gene, quantifying the concentration of D3 to 51.28IU/ml, diluting D3 by 5 times to obtain 10IU/ml, and repeatedly extracting and amplifying the sample for 11 times, wherein the data are shown in the table below. The difference between the LOGC calculated by substituting the CT values of 11 times into the national reference standard curve and the marking value is less than or equal to 0.4. That is, the detected concentration of 10IU/ml meets the accuracy requirement, and the obtained D genotype quantitative limit is 10 IU/ml. Meanwhile, the amplification efficiency of the standard yeast is calculated to be 108.63 percent, which meets the preparation requirement of the standard yeast. The coefficient of variation of the CT value of the template with 10IU/ml is calculated to be 0.691 percent, which meets the specified requirements. See fig. 6 and 7.
TABLE 5
Example 7 accuracy experiment
Height using positive sampleThe method comprises the steps of respectively using national ginseng and enterprise self-made reference products to detect samples with 4 concentration, namely, medium and low concentration samples, using extraction reagents and amplification reagents developed in the research, repeatedly detecting the 4 samples for 2 times, respectively substituting CT mean values into national ginseng standard curves and enterprise reference product standard curves to calculate, linearly fitting logC values calculated by the two, and fitting R2And the linearity is good, so that enterprise references can be used for assigning values to the samples instead of national references. Meanwhile, the difference between the two is less than or equal to 0.4, which meets the requirement. See FIGS. 8-11.
TABLE 6
TABLE 7
From the above examples, the present invention provides a kit for detecting hepatitis b virus DNA by one-tube method and its application. The kit comprises two components. One is a highly efficient extraction reagent: compared with the existing extraction reagent, the extraction reagent is simpler to operate and more convenient to use; does not contain organic solution, protects operators and reduces environmental pollution. The hepatitis B virus DNA in the serum can be efficiently combined on the magnetic beads by only 3 steps of operation. The other component is an amplification reagent: the primers and the probes for amplification are complementarily combined with common segments of genotypes B, C and D, and the amplification efficiency is up to more than 95%; but does not bind with nucleic acid sequences of other viruses (such as EB virus, hepatitis C virus, hepatitis A virus and the like) and has high specificity. The minimum detection limit for serum samples was 5 international units/ml.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Beijing Ji inspection medical science and technology Co., Ltd
<120> kit for detecting hepatitis B virus DNA by one-tube method and application thereof
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
actgttcaag cctccaag 18
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
taggaggctg taggcataaa t 21
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttgttggttc ttctggacta 20
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agagtaactc cacagaagc 19
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
agatgattag gcagaggtga a 21
<210> 6
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtgctggtgg ttgatgat 18
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgtgccttgg gtggctttgg ggcat 25
<210> 8
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aggcataaat tggtctgttc accagcacca t 31
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcaaggtatg ttgcccgttt gt 22
Claims (9)
1. A hepatitis B virus DNA quantitative determination kit is characterized in that the kit comprises an upstream primer, a downstream primer, a probe and a hepatitis B virus DNA extracting solution;
the sequence of the upstream primer is as follows:
a-1：ACTGTTCAAGCCTCCAAG；
b-1：TAGGAGGCTGTAGGCATAAAT；
or c-1: TTGTTGGTTCTTCTGGACTA, respectively;
the sequence of the downstream primer is as follows:
a-2：AGAGTAACTCCACAGAAGC；
b-2：AGATGATTAGGCAGAGGTGAA；
or c-2: GTGCTGGTGGTTGATGAT, respectively;
the sequence of the probe is as follows:
a-3：TGTGCCTTGGGTGGCTTTGGGGCAT；
b-3：AGGCATAAATTGGTCTGTTCACCAGCACCAT；
or c-3: TCAAGGTATGTTGCCCGTTTGT are provided.
2. The kit according to claim 1, wherein the hepatitis B virus DNA extracting solution comprises extracting solution 1-4, and the extracting solution 1 is one or more of Triton X-100, guanidinium isothiocyanate, guanidinium hydrochloride, Tris, SDS, EDTA and sodium chloride.
3. The kit according to claim 2, wherein the extract 2 is one or more of 4-hydroxyethylpiperazine ethanesulfonic acid, sodium chloride, magnetic beads, CTBA buffer, and 1 XTE buffer.
4. The kit according to claim 2, wherein the extract 3 is one or more of 4-hydroxyethylpiperazine ethanesulfonic acid, triton X-100, Tris, SDS and sodium chloride.
5. The kit according to claim 3, wherein the extract 4 is one or more of mineral oil and paraffin oil.
6. The kit according to claim 4, wherein the volume ratio of the extracting solution 1-4 is 1-3: 2-4: 4-8: 1 to 3.
7. The kit according to any one of claims 2 to 6, wherein the volume ratio of the extracting solution 1 to the serum to the extracting solution 2 in the serum extraction is 3 to 5: 2-4: 0.5 to 1.5; the volume ratio of the extracting solution 3 to the extracting solution 4 is 2-4: 0.5 to 1.5.
8. The kit according to any one of claims 1 to 6, wherein the procedure for amplification of the kit is as follows: 48-52 ℃ for 4-10 min; 93-97 ℃ for 1-3 min; (92-98 ℃, 10-20 s; 55-65 ℃, 30-38 s) for 42-48 cycles; 22-28 ℃ for 8-12 s.
9. Use of the kit of any one of claims 1 to 8 in the preparation of a hepatitis b virus DNA detection product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210184581.3A CN114250326A (en) | 2022-02-28 | 2022-02-28 | Kit for detecting hepatitis B virus DNA by one-tube method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210184581.3A CN114250326A (en) | 2022-02-28 | 2022-02-28 | Kit for detecting hepatitis B virus DNA by one-tube method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114250326A true CN114250326A (en) | 2022-03-29 |
Family
ID=80797089
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210184581.3A Pending CN114250326A (en) | 2022-02-28 | 2022-02-28 | Kit for detecting hepatitis B virus DNA by one-tube method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114250326A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701267A (en) * | 2009-11-26 | 2010-05-05 | 戴立忠 | Fluorescence quantitative PCR detection kit of hepatitis B virus and application thereof |
| CN102140558A (en) * | 2011-04-21 | 2011-08-03 | 东北制药集团辽宁生物制药有限公司 | Quantitative detection method of hepatitis B virus and kit thereof |
| CN102154510A (en) * | 2011-02-25 | 2011-08-17 | 湖南圣湘生物科技有限公司 | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN102212621A (en) * | 2011-05-09 | 2011-10-12 | 中国人民解放军第四军医大学 | Detection kit and detection method for hepatitis B virus genotyping |
| CN103642941A (en) * | 2013-12-12 | 2014-03-19 | 东北制药集团辽宁生物医药有限公司 | Quantitative detection kit of hepatitis B virus (HBV) nucleic acid |
| CN107022543A (en) * | 2017-05-25 | 2017-08-08 | 郑州市第六人民医院 | One kind extracts hbv nucleic acid with magnetic bead, extracts reagent, extracting method, quantitative detection kit |
| CN107312874A (en) * | 2017-07-18 | 2017-11-03 | 广州市宝创生物技术有限公司 | Primer, probe and the kit and method of highly sensitive real time fluorescent quantitative detection HBV nucleic acid |
-
2022
- 2022-02-28 CN CN202210184581.3A patent/CN114250326A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101701267A (en) * | 2009-11-26 | 2010-05-05 | 戴立忠 | Fluorescence quantitative PCR detection kit of hepatitis B virus and application thereof |
| CN102154510A (en) * | 2011-02-25 | 2011-08-17 | 湖南圣湘生物科技有限公司 | Nucleic acid quantitative detection kit for hepatitis C virus (HCV) |
| CN102140558A (en) * | 2011-04-21 | 2011-08-03 | 东北制药集团辽宁生物制药有限公司 | Quantitative detection method of hepatitis B virus and kit thereof |
| CN102212621A (en) * | 2011-05-09 | 2011-10-12 | 中国人民解放军第四军医大学 | Detection kit and detection method for hepatitis B virus genotyping |
| CN103642941A (en) * | 2013-12-12 | 2014-03-19 | 东北制药集团辽宁生物医药有限公司 | Quantitative detection kit of hepatitis B virus (HBV) nucleic acid |
| CN107022543A (en) * | 2017-05-25 | 2017-08-08 | 郑州市第六人民医院 | One kind extracts hbv nucleic acid with magnetic bead, extracts reagent, extracting method, quantitative detection kit |
| CN107312874A (en) * | 2017-07-18 | 2017-11-03 | 广州市宝创生物技术有限公司 | Primer, probe and the kit and method of highly sensitive real time fluorescent quantitative detection HBV nucleic acid |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109722431B (en) | Non-alcohol virus nucleic acid extraction kit based on magnetic bead method | |
| CN108823282B (en) | Sample nucleic acid detection kit, reagent and application thereof | |
| CN111690640A (en) | Virus preservation solution highly compatible with paramagnetic particle method virus nucleic acid extraction kit | |
| CN107354239B (en) | Multiplex fluorescence quantitative PCR method and kit for detecting EB virus | |
| JP2002501759A (en) | Improved method for isolating nucleic acids | |
| CN101586162B (en) | Method of extracting target nucleic acid and performing PCR amplification | |
| CN105907734B (en) | Taq DNA polymerase, PCR reaction solution and application thereof | |
| CN113913421A (en) | Reagent and method for extracting DNA from whole blood | |
| CN113145079A (en) | Novel coronavirus nucleic acid extraction kit and nucleic acid extraction method | |
| WO2014079002A1 (en) | Tracing method and detection kit for test sample in next-generation sequencing technique of dna | |
| CN103184214A (en) | Hepatitis B virus nucleic acid rapid extraction reagent | |
| CN112899268A (en) | Kit for extracting viral nucleic acid by magnetic bead method | |
| CN111748628B (en) | Primer and kit for detecting thyroid cancer prognosis related gene variation | |
| TW201321520A (en) | Method and system for virus detection | |
| CN113186249A (en) | Rapid extraction kit for viral nucleic acid and use method thereof | |
| CN114250326A (en) | Kit for detecting hepatitis B virus DNA by one-tube method and application thereof | |
| CN112111601A (en) | Novel dual rapid RT-PCR detection kit for coronavirus | |
| CN116286792A (en) | Whole blood genome DNA rapid extraction kit and use method thereof | |
| CN114807120A (en) | High-sensitivity virus nucleic acid extraction kit | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| CN114525275A (en) | Method and kit for applying eutectic solvent to DNA extraction and DNA extraction | |
| CN113025686A (en) | Viral RNA releasing agent, kit and application thereof | |
| CN113930418A (en) | Nucleic acid releasing agent and method for releasing nucleic acid | |
| CN112795564A (en) | Rapid total nucleic acid extraction method and kit | |
| CN115786327A (en) | Alcohol-free cleaning solution and application method thereof in extraction of new coronavirus nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |