CN114250293A - Molecular marker related to type 2diabetes and application thereof - Google Patents
Molecular marker related to type 2diabetes and application thereof Download PDFInfo
- Publication number
- CN114250293A CN114250293A CN202111573941.0A CN202111573941A CN114250293A CN 114250293 A CN114250293 A CN 114250293A CN 202111573941 A CN202111573941 A CN 202111573941A CN 114250293 A CN114250293 A CN 114250293A
- Authority
- CN
- China
- Prior art keywords
- type 2diabetes
- molecular marker
- type
- mellitus
- 2diabetes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the technical field of biological medicines, and relates to a molecular marker related to type 2diabetes, wherein the sequence of the molecular marker is a sequence shown in SEQ ID NO. 1. The molecular marker disclosed by the invention can be applied to aspects of auxiliary diagnosis of type 2diabetes, auxiliary evaluation of the disease risk or prognosis condition of type 2diabetes, auxiliary research of type 2diabetes and the like, has important guiding significance for early detection and prevention of type 2diabetes, particularly type 2diabetes in arsenic-exposed people, can be popularized in people, and has important significance in individuation, sensitive identification, screening and genetic counseling.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a molecular marker related to type 2diabetes and application thereof.
Background
Diabetes is a worldwide health problem, is the third chronic disease following cardiovascular diseases and tumors, and has a great influence on the quality of life and human health. The incidence of diabetes mellitus increases year by year, and the expenditure of medical expenses imposes a heavy burden on patients. More than 90% of diabetic patients are type 2diabetes mellitus (T2 DM). The etiology of T2DM has been studied in many ways, but has not been fully elucidated to date. It is now recognized that T2DM is caused by a combination of complex factors, such as environmental factors, autoimmune factors, lifestyle, eating habits, and genetic factors.
Arsenic is a strong oxidant, is widely distributed in water, soil and air in various forms as an environmental pollutant, and is increasingly widely and increasingly distributed in the environment along with the application and even abuse of arsenic-containing products in human society. After a human body takes in arsenic with an overdose amount for a long time through ways of drinking water and the like, the body decompensation can cause oxidative damage, which is one of the important pathological processes of diabetes. The diabetic patients often have complications before the occurrence due to unobvious and inconspicuous symptoms, so that the treatment difficulty is increased, and the life quality is obviously reduced. Therefore, if the occurrence of T2DM can be predicted as early as possible, especially in arsenic-exposed people, the method has great significance for reducing the harm caused by environmental exposure and improving the prevention and treatment of human chronic diseases.
The KEAP1 gene plays an important role in the antioxidant process of the organism. The Keap1-Nrf2 pathway is an important component of human body antioxidation, and the Nrf2 is an important intracellular regulatory factor and plays an important role in protecting cells. Normally, Keap1 forms a dimer with Nrf2 (Nrf2/Keap1 complex) and Nrf2 continues to degrade. When arsenic acts on an organism, the Nrf2/Keap1 complex is uncoupled, Nrf2 enters a cell nucleus, and downstream antioxidase is expressed. When the expression of the KEAP1 gene is abnormal (such as gene mutation, exogenous intervention and the like), the function of a Keap1-Nrf2 pathway can be changed, and the antioxidant function of the organism can be affected and even the organism is oxidized and damaged. Therefore, the genetic evaluation of the 2-type diabetes caused by arsenic exposure is carried out by analyzing and monitoring the polymorphic sites of the KEAP1 gene in arsenic-exposed people, and the improvement of the life quality of patients is of great significance.
Disclosure of Invention
In view of the above, in order to early assess the risk of type 2diabetes in arsenic-exposed people, the present invention aims to provide a molecular marker related to type 2diabetes and applications thereof, particularly type 2diabetes in arsenic-exposed people. By using the polymorphism or genotype of the KEAP1 gene provided by the invention as a molecular marker, the morbidity risk of the individual type 2diabetes can be better evaluated, early prevention and measures can be taken, and the harm of the type 2diabetes and complications to a human body can be reduced.
The invention is realized by the following technical scheme:
a molecular marker related to type 2diabetes is derived from a 19 th chromosome of a human genome and comprises an rs11545829 mutation site (a position of a short arm 10489289 of the 19 th chromosome) on a 5 th exon of a KEAP1 gene, wherein the genotype of the mutation site is A (the wild genotype is G, the mutation genotype is A, and the molecular marker related to type 2diabetes is obtained after mutation and is shown as SEQ ID No. 1).
The mutation pattern and mutation position of the indicated mutation sites are shown below:
GGTGTGGTGGCATGTGCCTGTAGTCGCAGCTACTCAGGAGGCTGAGACAGGAGAATCGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATCATGCCATTGCACTCCAGCCTGGGCAACACTGTGAGACACCATCTCAAAAGAAAAAAAACATTAGCCGGGTGTGGTGGTGCGCGCCTGTGGTCCCTGCTACTTGGGAGGCTGAGGCAGGAGGATGGCTGGAGCCCAGGCTGTTGAGGCTCCAGCGAGCTGTGATCACACCACTGCACTCCAGCTGGGCAACAGAGCGAGACCTTGTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAGGAAAGCAAAAGCAAAAGCAGTCCACAAAAGATGGGCTAGTCAGGACTCTTCCCCGCCCCCAGGGCCTCACCAAGGACGTAGATTCTCCCCTGGTGGACAGTGATCCCCAGGGCACTTCGCCGGTGCTTCATGGGGGCTACGAAAGTCCACGTCTCTGTTTCCACATC[A/G]TAGCGCTCCACGCTGTTCAGCTGGTCCTGACCATCATAGCCCCCAGCAGCATAGATACAGTTGTGCAGGACGCAGACGCCTAAAGGGCACCATGCAGAGAAGGTGACTCTGGGGGTCTGGCTTTGGGAACCCCAGCCATCACCTCCTTGAGGGAGACCTTTCCTCTCTCCTCTCCCTTCTCACCCTCAGAAATGAAGCGGGGAGAGAGAGAAGCTTGGACTCTATCAGAATCCAGGGCTTCTGTGGTTACCCCAGCATGAGGGTTGCAACAGGGGGTCTCTCCCAGGCCTGGCTCAGTTTCACCCCAGGATGGTAGGGGGTGTTCCTGGGTGCTCCCCTCCCTACCGTCCCCACCCACCTGCCCCGCTTCGGATGGTGTTCATTGCTGTGATCATTCGCCACTCGTTCCTCTCTGGGTAGTAACACTCAGCTGAATTAAGGCGGTTTGTCCCGTCAAAGCCCCCCACGGCATAAAGGAGACGATTGAGGACAGCCACGCC。
the Rs11545829 site is a G > A mutation in exon 5 of the KEAP1 gene and is located in chromosome 19 short arm 10489289. If the expression of the Keap1 gene is abnormal, the body antioxidant response is affected, and the type 2diabetes mellitus can be possibly caused. The risk of type 2diabetes in mutant homozygous (AA) carriers is lower than in wild homozygous (GG) and heterozygous carriers (GA).
The molecular marker related to the type 2diabetes mellitus is applied to the aspects of assisting in diagnosing the type 2diabetes mellitus, assisting in evaluating the disease risk or the prognosis condition of the type 2diabetes mellitus, assisting in researching the type 2diabetes mellitus and the like.
Further, the application comprises the application of the molecular marker related to the type 2diabetes mellitus in the preparation of a detection product for the type 2diabetes mellitus. The detection product comprises a detection chip for type 2diabetes, a detection reagent for type 2diabetes, a detection kit for type 2diabetes and the like.
The detection kit for the type 2diabetes comprises a primer designed according to the molecular marker sequence related to the type 2 diabetes; the primer is as follows:
5'-AAAAGCAAAAGCAGTCCACAAAAG-3'(SEQ ID NO.2)，
5'-CACAACTGTATCTATGCTGCTG-3'(SEQ ID NO.3),
the use method of the detection kit for the type 2diabetes mellitus comprises the following steps:
obtaining the genome DNA of a sample to be detected;
carrying out PCR amplification on the genome DNA of a sample to be detected to obtain a PCR product;
sequencing;
SNP genotyping is carried out, and the genotyping result is analyzed.
Further, the PCR amplification comprises a first round of PCR amplification, and the amplification system comprises: ddH2O 3.2.2 μ L, 10 XBuffer 1 μ L, Primer 2 μ L, dNTP0.8 μ L, enzyme 0.1 μ L, Sample 2 μ L, Mg2+1 μ L of paraffin oil 10 μ L;
the amplification procedure was: preheating at 95 ℃ for 15 min; operating at 94 ℃ for 30s, 60 ℃ for 10min and 72 ℃ for 30s, and circulating for 4 times; the operation is carried out for 30s at 94 ℃, 1min at 60 ℃ and 30s at 72 ℃ for 20 times.
Further, the PCR amplification also comprises a second round of PCR extension, and the extension system comprises: ddH2O 3.6.6 μ L, 10 XBuffer 2 μ L, Barcode 3.6 μ L, dNTP0.8 μ L, enzyme 0.1 μ L, Sample10 μ L, Mg2+1 μ L of paraffin oil 20 μ L;
the extension program is as follows: preheating at 95 ℃ for 15 min; the operation is carried out for 5 times at 94 ℃ for 30s, 60 ℃ for 4min and 72 ℃ for 30 s; the operation is carried out for 30s at 94 ℃, 1min at 65 ℃ and 30s at 72 ℃ for 10 times of circulation.
Preferably, the second round of expanded template is a dilution obtained by adding 100 μ L of ddH2O 100 to each well of the product of the first round of amplification, performing instantaneous centrifugation, and standing at room temperature for 10 min.
Type 2diabetes to which the present invention relates is in particular type 2diabetes caused by arsenic exposure.
The invention has the beneficial effects that:
arsenic is a strong oxidant, and after a human body takes in arsenic with an overdose amount for a long time through ways of drinking water and the like, the body can be subjected to oxidative damage due to decompensation, and the oxidative damage is one of important pathological processes of diabetes. The diabetic patients often have complications before the occurrence due to unobvious and inconspicuous symptoms, so that the treatment difficulty is increased, and the life quality is obviously reduced. Therefore, if the occurrence of T2DM can be predicted as early as possible, especially in arsenic-exposed people, the method has great significance for reducing the harm caused by environmental exposure and improving the prevention and treatment of human chronic diseases. The KEAP1 gene plays an important role in the antioxidant process of the organism. The Keap1-Nrf2 pathway is an important component of human body antioxidation, and the Nrf2 is an important intracellular regulatory factor and plays an important role in protecting cells. Normally, Keap1 forms a dimer with Nrf2 (Nrf2/Keap1 complex) and Nrf2 continues to degrade. When arsenic acts on an organism, the Nrf2/Keap1 complex is uncoupled, Nrf2 enters a cell nucleus, and downstream antioxidase is expressed. When the expression of the KEAP1 gene is abnormal (such as gene mutation, exogenous intervention and the like), the function of a Keap1-Nrf2 pathway can be changed, and the antioxidant function of the organism can be affected and even the organism is oxidized and damaged. Therefore, the genetic evaluation of the 2-type diabetes caused by arsenic exposure is carried out by analyzing and monitoring the polymorphic sites of the KEAP1 gene in arsenic-exposed people, and the improvement of the life quality of patients is of great significance.
The G & gtA mutant sequence of the rs11545829SNP locus of the KEAP1 gene is used as a molecular marker for predicting the onset risk of type 2diabetes, has important guiding significance for early detection and prevention of type 2diabetes, particularly type 2diabetes in arsenic-exposed people, can be popularized in the people, and has important significance in individuation, sensitive identification, screening and genetic consultation.
Drawings
FIG. 1 shows the result of agarose gel electrophoresis. The DNA Ladder comprises the following components in sequence from bottom to top: 100, 200, 300, 400, 500 bp; from left to right: in the scheme, the electrophoresis positions of A positive/A negative/B positive/B negative/marker are arranged at 350bp +, and the quality control is qualified.
Detailed Description
In order to better explain the problems to be solved, the technical solutions adopted and the beneficial effects achieved by the technical solutions of the present invention, further description will be given with reference to specific embodiments. It should be noted that the technical solutions of the present invention include, but are not limited to, the following embodiments.
The specific techniques or conditions not specified in the examples of the present invention are performed according to the techniques or conditions described in the literature in the art or according to the product specification. The reagents or instruments used are not indicated by manufacturers, and are all conventional products which can be obtained by commercial purchase and the like.
Example 1
1.1 primer design
Corresponding RS numbers are searched on NCBI websites to obtain site information and site sequences, and primer design is carried out by using Primer3.0, which is shown in Table 1. The BLAST carries out homology comparison before experiment, the sequence is obtained to be a unique sequence, and then verification experiment is carried out, and the corresponding primer sequences are as follows:
SEQ ID NO. 2: 5'-AAAAGCAAAAGCAGTCCACAAAAG-3' (Forward)
SEQ ID NO. 3: 5'-CACAACTGTATCTATGCTGCTG-3' (reverse)
TABLE 1 Main Experimental software and network resources
| Software/database | Version(s) | Developer or web site | |
| 1 | Primer 3online | Version 0.4.0 | http://frodo.wi.mit.edu/ |
| 2 | Oligo | Version 6.31 | Molecular Biology Insights Inc.,USA |
| 3 | NCBI | / | http://www.ncbi.nlm.nih.gov/ |
1.2DNA extraction
Using EltbioTMBlood genome DNA extraction kit-pre-packaged plate (Eltbio) by magnetic bead methodTMMag Blood DNA Kit) for extracting genomic DNA from fresh whole Blood, anticoagulated Blood, frozen whole Blood and other liquid samples;
agarose gel electrophoresis analysis detects the degree of degradation, in which the presence of miscellaneous bands, RNA and protein contamination is detected. And (4) quality control is qualified, and subsequent experiments are carried out.
1.3 library construction
The instruments, reagents, consumables and analysis software used in the construction process are shown in tables 2 and 3.
TABLE 2 Main Experimental Equipment and manufacturers
TABLE 3 Main test reagents, consumables and manufacturers
PCR amplification of KEAP1 rs11545829 site: one round of PCR amplification system is: ddH2O3.2. mu.L, 10 XBuffer 1. mu.L, Primer 2. mu.L (5 umol/. mu.L), dNTP0.8. mu.L, enzyme 0.1. mu.L, Sample 2. mu.L (20 ng/. mu.L), Mg2+1 μ L, paraffin oil 10 μ L. PCR reaction procedure: preheating at 95 ℃ for 15 min; operating at 94 ℃ for 30s, 60 ℃ for 10min and 72 ℃ for 30s, and circulating for 4 times; running at 94 deg.C for 30s, 60 deg.C for 1min, and 72 deg.C for 30s, and circulating for 20Next, the process is carried out. One round of product add ddH per well2O100. mu.L, and then subjected to instantaneous centrifugation (2000 rpm for 1s) and allowed to stand at room temperature for 10 min. With dilution (one round of product plus ddH per well)2O100 μ L of the resulting dilution) as two rounds of expanded template samples. The two-round PCR expansion system is as follows: ddH2O3.6. mu.L, 10 XBuffer 2. mu.L, Barcode 3.6. mu.L, dNTP 0.8. mu.L, enzyme 0.1. mu.L, Sample 10. mu.L, Mg2+1 μ L, paraffin oil 20 μ L. The PCR extension process is as follows: preheating at 95 ℃ for 15 min; the operation is carried out for 5 times at 94 ℃ for 30s, 60 ℃ for 4min and 72 ℃ for 30 s; the operation is carried out for 30s at 94 ℃, 1min at 65 ℃ and 30s at 72 ℃ for 10 times of circulation.
After the amplification is finished, carrying out electrophoresis detection on the PCR product, carrying out 3% agarose gel, loading the PCR product with 5ul, and observing whether an electrophoresis band is uniform or not, whether a hybrid band exists or not and the like.
The obtained PCR amplification product was added with a linker sequence (PCR product + linker sequence: 350bp +) and different samples were distinguished by the double-ended barcode principle.
Mixing samples, adjusting a 96-hole plate and a row gun to 5 mu L, taking a 10 mu L gun head, and sucking 5 mu L of PCR plate per hole to a U-shaped groove; transferring the product in the U-shaped groove to a round-bottom centrifuge tube by using a 200-mu-L pipette gun, screwing down, and oscillating for 30 seconds by using a turbine; the tubes were placed on a shaker and shaken overnight. 3% agarose gel electrophoresis (FIG. 1), observing the effect of PCR product, and determining whether PCR is successful. The DNA Ladder comprises the following components in sequence from bottom to top: 100, 200, 300, 400, 500 bp; the electrophoresis position of the library is 350bp +, and the quality control is qualified.
Purifying and performing quality control on the library by Agilent 2100;
dilution, the purified product is accurately quantified and diluted to the concentration required for sequencing (2nmol/L), volume > 15 uL.
1.4 sequencing:
illumina HiSeq X sequencing.
1.5 mutation detection:
SAMtools (v0.1.19) software for SNP genotyping.
HWE statistics are performed.
Example 2
The association of type 2diabetes with the rs11545829 site polymorphism was verified according to the following procedure.
Step 1: subjects 938 were randomly selected for arsenic exposure, a basic information questionnaire was conducted, subject urine and blood samples were collected, and subject urine arsenic and glycated hemoglobin (Hb1Ac) levels were measured. The subjects were divided into high arsenic exposure and low arsenic exposure groups according to whether they were at risk of arsenic exposure (urinary arsenic > 0.032 mg/L). Diagnostic criteria for diabetes: the diabetes diagnosis standard is published by the world health organization, namely Hb1Ac ≧ 6.5%. The subject base is shown in table 4 below.
TABLE 4 panelist base statistics
Step 2: collecting venous blood of an investigation object, placing the venous blood in an EDTA anticoagulant blood collection tube, fully and uniformly mixing, extracting genomic DNA in the blood by using a blood genomic DNA extraction kit, and storing at-20 ℃;
and step 3: the primers were extended by PCR according to the procedure of example 1;
and 4, step 4: the library was mixed and checked by 3% agarose gel electrophoresis (FIG. 1), and the effect of the PCR product was observed to determine whether the PCR was successful. The DNA Ladder comprises the following components in sequence from bottom to top: 100, 200, 300, 400, 500 bp; the electrophoresis position of the library is 350bp +, and the quality control is qualified;
purifying and performing quality control on the library by Agilent 2100;
dilution, the purified product is accurately quantified and diluted to the concentration required for sequencing (2nmol/L), volume > 15 uL.
And 5: illumina HiSeq X sequencing.
Step 6: SAMtools performed SNP genotyping. Hardy Wenberg equilibrium detection of the site p ═ 0.94. The genotyping results are shown in Table 5 below.
TABLE 5 statistics of KEAP1 rs11545829SNP genotyping results
a, checking a chi square; and b, checking the trend.
According to the detection results, 71 mutant homozygote AA carriers in the non-diabetic population, 19 mutant homozygote AA carriers in the diabetic population, chi-square test p is less than 0.05, and trend test p is less than 0.05, which shows that the 2-type diabetes prevalence rate of each genotype population has statistical difference, and the prevalence rate is reduced along with the increase of the number of mutant allele A. Using the SNPStats online analysis system, after adjusting confounding factors, it was determined that the site was inherited in the population in a recessive model (table 6). The investigator was divided into two groups of low-arsenic exposure group and high-arsenic exposure group according to the urinary arsenic level (the urinary arsenic of the low-arsenic exposure group is less than or equal to 0.032mg/L, and the urinary arsenic of the high-arsenic exposure group is more than or equal to 0.032mg/L), after the confounding factors were adjusted, the logistic regression result showed that the risk of occurrence of AA genotype carrier T2DM in the high-arsenic exposure group was 0.48 times that of GG + GA genotype carrier, 95% CI was 0.26-0.87, the risk of occurrence of AA genotype carrier T2DM in the low-arsenic exposure group was 0.33 times that of GG + GA genotype carrier, and 95% CI was 0.09-1.17, and the result showed that after the confounding factors between type 2diabetes patient and non-type 2diabetes patient were adjusted, the risk of occurrence of type 2diabetes of AA genotype carrier in the high-arsenic exposure group was 52% lower than that of diabetes carrier in other genotypes, and the protective effect was not statistically significant in the low-arsenic exposure group (Table 7).
TABLE 6 Association of KEAP1 rs11545829SNP with risk of type 2diabetes in different genetic models
TABLE 7 correlation of KEAPI rs11545829SNP with risk of developing type 2diabetes in different arsenic-exposed populations
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Harbin university of medicine
<120> molecular marker related to type 2diabetes and application thereof
<130> WK21-LQF-CN1-0454
<141> 2021-12-21
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1001
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggtgtggtgg catgtgcctg tagtcgcagc tactcaggag gctgagacag gagaatcgct 60
tgaacccagg aggtggaggt tgcagtgagc tgagatcatg ccattgcact ccagcctggg 120
caacactgtg agacaccatc tcaaaagaaa aaaaacatta gccgggtgtg gtggtgcgcg 180
cctgtggtcc ctgctacttg ggaggctgag gcaggaggat ggctggagcc caggctgttg 240
aggctccagc gagctgtgat cacaccactg cactccagct gggcaacaga gcgagacctt 300
gtttctaaaa aaaaaaaaaa aaaaaaaaaa aaggaaagca aaagcaaaag cagtccacaa 360
aagatgggct agtcaggact cttccccgcc cccagggcct caccaaggac gtagattctc 420
ccctggtgga cagtgatccc cagggcactt cgccggtgct tcatgggggc tacgaaagtc 480
cacgtctctg tttccacatc atagcgctcc acgctgttca gctggtcctg accatcatag 540
cccccagcag catagataca gttgtgcagg acgcagacgc ctaaagggca ccatgcagag 600
aaggtgactc tgggggtctg gctttgggaa ccccagccat cacctccttg agggagacct 660
ttcctctctc ctctcccttc tcaccctcag aaatgaagcg gggagagaga gaagcttgga 720
ctctatcaga atccagggct tctgtggtta ccccagcatg agggttgcaa cagggggtct 780
ctcccaggcc tggctcagtt tcaccccagg atggtagggg gtgttcctgg gtgctcccct 840
ccctaccgtc cccacccacc tgccccgctt cggatggtgt tcattgctgt gatcattcgc 900
cactcgttcc tctctgggta gtaacactca gctgaattaa ggcggtttgt cccgtcaaag 960
ccccccacgg cataaaggag acgattgagg acagccacgc c 1001
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aaaagcaaaa gcagtccaca aaag 24
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cacaactgta tctatgctgc tg 22
Claims (10)
1. A molecular marker related to type 2diabetes, which is characterized in that the sequence of the molecular marker is the sequence shown in SEQ ID NO. 1.
2. The molecular marker associated with type 2diabetes according to claim 1, wherein the type 2diabetes is type 2diabetes due to arsenic exposure.
3. The use of the molecular marker associated with type 2diabetes mellitus as claimed in claim 1 or 2, wherein the use comprises aiding in the diagnosis of type 2diabetes mellitus, aiding in the assessment of the risk of developing type 2diabetes mellitus or the prognostic status, or aiding in the study of type 2diabetes mellitus.
4. The use of the molecular marker associated with type 2diabetes mellitus according to claim 3, wherein the use specifically comprises applying the molecular marker associated with type 2diabetes mellitus in the preparation of a product for detecting type 2diabetes mellitus.
5. The application of the molecular marker related to type 2diabetes mellitus as claimed in claim 4, wherein the detection product comprises a detection chip for type 2diabetes mellitus, a detection reagent for type 2diabetes mellitus or a detection kit for type 2diabetes mellitus.
6. The detection kit for type 2diabetes according to claim 5, characterized in that the kit comprises primers designed according to the molecular markers associated with type 2 diabetes; the primer sequences are shown as SEQ ID NO.2 and SEQ ID NO. 3.
7. The use of the molecular marker related to type 2diabetes according to claim 3, characterized in that the specific operation of the use comprises:
obtaining the genome DNA of a sample to be detected;
designing a primer, carrying out specific amplification on the rs11545829 site, adding a connector sequence to an obtained PCR product, and distinguishing different samples and library mixed samples;
purifying the library;
sequencing;
SNP genotyping is carried out, and the genotyping result is analyzed.
8.The use of the molecular marker associated with type 2diabetes according to claim 7, wherein the PCR amplification comprises a first round of PCR amplification; the amplification system comprises: ddH2O3.2. mu.L, 10 XBuffer 1. mu.L, Primer 2. mu.L, dNTP 0.8. mu.L, enzyme 0.1. mu.L, Sample 2. mu.L, Mg2+1 μ L of paraffin oil 10 μ L;
the amplification procedure was: preheating at 95 ℃ for 15 min; operating at 94 ℃ for 30s, 60 ℃ for 10min and 72 ℃ for 30s, and circulating for 4 times; the operation is carried out for 30s at 94 ℃, 1min at 60 ℃ and 30s at 72 ℃ for 20 times.
9. The use of the molecular marker related to type 2diabetes mellitus according to claim 7, wherein the PCR amplification further comprises a second round of PCR extension, and the extension system comprises: ddH2O3.6. mu.L, 10 XBuffer 2. mu.L, Barcode 3.6. mu.L, dNTP 0.8. mu.L, enzyme 0.1. mu.L, Sample 10. mu.L, Mg2+1 μ L of paraffin oil 20 μ L;
the extension program is as follows: preheating at 95 ℃ for 15 min; the operation is carried out for 5 times at 94 ℃ for 30s, 60 ℃ for 4min and 72 ℃ for 30 s; the operation is carried out for 30s at 94 ℃, 1min at 65 ℃ and 30s at 72 ℃ for 10 times of circulation.
10. The use of the molecular marker related to type 2diabetes mellitus according to claim 9, wherein the second round of expanded template is the product of the first round of amplification added to ddH2And O, instantly centrifuging, and standing at room temperature for 10min to obtain a diluent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111573941.0A CN114250293A (en) | 2021-12-21 | 2021-12-21 | Molecular marker related to type 2diabetes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111573941.0A CN114250293A (en) | 2021-12-21 | 2021-12-21 | Molecular marker related to type 2diabetes and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114250293A true CN114250293A (en) | 2022-03-29 |
Family
ID=80796481
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111573941.0A Pending CN114250293A (en) | 2021-12-21 | 2021-12-21 | Molecular marker related to type 2diabetes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114250293A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105112415A (en) * | 2015-09-23 | 2015-12-02 | 博奥生物集团有限公司 | Genetic locus rs780092 and assay kit for type-2 diabetes disease risk assessment |
| CN106978474A (en) * | 2016-08-17 | 2017-07-25 | 上海易瑞生物科技有限公司 | A kind of diabetes B tumor susceptibility gene detection and genotyping kit and its application |
| CN108676871A (en) * | 2018-07-09 | 2018-10-19 | 中国人民解放军军事科学院军事医学研究院 | Type-II diabetes diagnosis marker |
-
2021
- 2021-12-21 CN CN202111573941.0A patent/CN114250293A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105112415A (en) * | 2015-09-23 | 2015-12-02 | 博奥生物集团有限公司 | Genetic locus rs780092 and assay kit for type-2 diabetes disease risk assessment |
| CN106978474A (en) * | 2016-08-17 | 2017-07-25 | 上海易瑞生物科技有限公司 | A kind of diabetes B tumor susceptibility gene detection and genotyping kit and its application |
| CN108676871A (en) * | 2018-07-09 | 2018-10-19 | 中国人民解放军军事科学院军事医学研究院 | Type-II diabetes diagnosis marker |
Non-Patent Citations (2)
| Title |
|---|
| CHENLU FAN ET AL.: "Research for type 2 diabetes mellitus in endemic arsenism areas in central China: role of low level of arsenic exposure and KEAP1 rs11545829 polymorphism", ARCH TOXICOL., vol. 96, no. 6, pages 1673 - 1683, XP037847907, DOI: 10.1007/s00204-022-03279-1 * |
| LINBO GAO ET AL.: "Epigenetic modifications but not genetic polymorphisms regulate KEAP1 expression in colorectal cancer", J CELL BIOCHEM., vol. 120, no. 8, pages 12311 - 12320, XP071665506, DOI: 10.1002/jcb.28495 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Replication of TCF4 through association and linkage studies in late-onset Fuchs endothelial corneal dystrophy | |
| Chen et al. | Comprehensive mutation analysis by whole-exome sequencing in 41 Chinese families with Leber congenital amaurosis | |
| CN110760580B (en) | Early diagnosis equipment for liver cancer | |
| Gorcenco et al. | New generation genetic testing entering the clinic | |
| EP2847593A1 (en) | Methods for predicting and detecting cancer risk | |
| CN108913776B (en) | Screening method and kit for DNA molecular markers related to radiotherapy and chemotherapy injury | |
| CN108004345B (en) | Method for high-throughput detection of wheat scab resistance genotyping and kit thereof | |
| CN115029431B (en) | Type 2 diabetes gene detection kit and type 2 diabetes genetic risk assessment system | |
| CN107557468B (en) | Cancer-testis gene genetic marker related to auxiliary diagnosis of primary lung cancer and application thereof | |
| CN114250293A (en) | Molecular marker related to type 2diabetes and application thereof | |
| Dueker et al. | Analysis of genetic linkage data for Mendelian traits | |
| Lu et al. | Molecular characterization of tetralogy of fallot within Digeorge critical region of the chromosome 22 | |
| CN113166810A (en) | SNP marker for diagnosing cerebral aneurysm including single base polymorphism of GBA gene | |
| WO2010007063A2 (en) | Method of diagnosing dyslexia | |
| WO2008010082A2 (en) | Diagnostic method for fibromyalgia (fms) or chronic fatigue syndrome (cfs) | |
| KR20150035847A (en) | Method, Composition, and Kit for Predicting the Risk of Developing Graft Versus Host Disease | |
| KR101593090B1 (en) | Method, Composition, and Kit for Predicting the Risk of Developing Graft Versus Host Disease | |
| CN116987788B (en) | Method and kit for detecting early lung cancer by using flushing liquid | |
| CN116083588B (en) | DNA methylation site combination as prostate cancer marker and application thereof | |
| CN106399572A (en) | Application of polymorphism of single nucleotide rs149308743 in screening of leprosy patients | |
| CN106520988A (en) | Application of single nucleotide polymorphism rs76418789 to screening of leprosy patients | |
| CN106399571A (en) | Application of SNP (single nucleotide polymorphism) rs181206 in screening of patients with leprosy | |
| Ken-Dror et al. | Approach for Genetic Studies | |
| CN112424381A (en) | SNP marker for diagnosing cerebral aneurysm, comprising single base polymorphism of ARHGAP32 gene | |
| KR101541141B1 (en) | Method, Composition, and Kit for Predicting the Risk of Developing Graft Versus Host Disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |