CN114246938A

CN114246938A - Use of IL-4 in the manufacture of a medicament for the treatment of retinal degenerative diseases

Info

Publication number: CN114246938A
Application number: CN202210089700.7A
Authority: CN
Inventors: 柳夏林; 何嫦; 周恬
Original assignee: Zhongshan Ophthalmic Center
Current assignee: Zhongshan Ophthalmic Center
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2022-03-29

Abstract

The invention relates to the use of IL-4 for the preparation of a medicament for the treatment of retinal degenerative diseases. Experiments such as ERG, OCT, fundus imaging, H & E and the like prove that RPE cell damage of mice with retinal degeneration can be obviously reduced by injecting IL-4 into the vitreous chamber, visual function is protected, and retina thinning is delayed. Immunofluorescence staining proves that IL-4 can act on an IL-4R alpha receptor of retinal pigment epithelial cells, and the tight junction of mouse RPE cells of a retinal degeneration model is regulated and restored. After IL-4 intervention, the expression level of RPE scleral complex inflammatory factors can be reduced, and the genes related to antioxidant stress of the factors are up-regulated, so that the oxidative stress state of retinal pigment epithelium is improved, and the death process of retinal photoreceptor cells is delayed. The invention provides experimental basis and theoretical basis for potential clinical application of IL-4 in treating retinal degenerative diseases and IL-4 as an immunomodulator, and IL-4 has wide application prospect in preparing pharmaceutical preparations for treating retinal degenerative diseases.

Description

Use of IL-4 in the manufacture of a medicament for the treatment of retinal degenerative diseases

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to an application of IL-4 in preparation of a medicine for treating retinal degeneration diseases.

Background

The retinal degeneration disease is a kind of intractable blindness-causing eye disease which seriously harms the visual function of human, has become the prominent main blindness-causing eye disease in China, including age-related macular degeneration (AMD), Retinitis Pigmentosa (RP), Stargardt disease and the like, and an effective treatment method is still lacking clinically. Dysfunction and loss of retinal pigment epithelial cells (RPE) are common pathological features common to such diseases. The previous research suggests that RPE cells participate in the pathological and physiological processes of retina through the actions of nutrition, barrier, phagocytosis and the like, and part of RPE cells can express immune-related receptors such as TLRs, Fc-gamma and the like, mediate local immune response and influence cell survival and repair. The search for functional features and repair potential of RPE from immune factors is an important research direction in the treatment of retinal degenerative diseases.

IL-4 is a cytokine with immunoregulatory functions, secreted by mast cells, Th2 cells, eosinophils and basophils, involved in regulating leukocyte survival, Th2 cell-mediated immunity, IgE class switching in B cells under physiological and pathological conditions, and promoting tissue repair and homeostasis by regulating macrophage development of an anti-inflammatory phenotype. The expression of IL-4 is controversial in various retinal diseases. In wet age-related macular degeneration, cystoid macular edema, and ischemic retinal vein occlusion, there are reports of increased IL-4 expression by intraocular fluid screening; however, in several other studies, such as Eales disease, diabetic retinopathy, reduced or undetectable IL-4 expression has also been reported. In retinal degenerative diseases, there is no report on the use of IL-4 as an active factor for therapy.

Disclosure of Invention

The invention aims to solve the problems existing in the treatment of retinal degenerative diseases in the prior art, and provides a pharmaceutical composition for effectively treating the retinal degenerative diseases, which takes IL-4 as an active ingredient, can effectively improve the oxidative stress state of retinal pigment epithelium, delay the death process of retinal photoreceptor cells, has the effects of resisting inflammation and protecting nerves, can relieve retinal damage, improve the retinal function and provide practical experimental basis and theoretical basis for clinically treating the retinal degenerative diseases.

In order to solve the above technical problems, the present invention is achieved by the following technical solutions.

The invention provides a pharmaceutical composition for treating eye diseases, which comprises IL-4 and phosphate buffer solution, wherein the concentration of the IL-4 is 2 mug/muL.

Preferably, the ocular disease is selected from retinal degeneration.

The invention provides a pharmaceutical preparation for treating eye diseases in a second aspect, which comprises IL-4, phosphate buffer and pharmaceutically acceptable auxiliary materials, wherein the concentration of the IL-4 is 2 mug/muL.

Preferably, the ocular disease is selected from retinal degeneration.

Preferably, the dosage form of the pharmaceutical preparation is selected from one or more of solution, sol, emulsion and suspension.

Preferably, the pharmaceutical formulation is selected from a solution.

Preferably, the pharmaceutically acceptable auxiliary materials are selected from one or more of solvents, solubilizers, surfactants, bacteriostats, antioxidants and chelating agents.

In a third aspect, the invention provides the use of IL-4 in a medicament for the treatment of an ocular disease and/or for the amelioration of a physiological indicator associated with an ocular disease.

Preferably, the ocular disease is selected from retinal degeneration.

Preferably, the physiological indicators associated with ocular diseases are selected from one or more of the number of RPE pigmentary disorder aggregates deposited under the retina, the number of retinal exudation and plica, the thickness of retinal photoreceptor cell layers, the level of retinal RPE cell expression of antioxidant stressors.

Compared with the prior art, the invention has the following technical effects:

(1) the invention fully proves the relevant therapeutic effect of IL-4 on the retinal degeneration diseases through a large amount of researches. Wherein, IL-4 obviously inhibits the oxidative stress reaction of the RPE cells by regulating the oxidative stress state of the RPE cells, so that the Electroretinogram (ERG) waveform amplitude is improved, and the retinal inflammation microenvironment is regulated, so that RPE pigment disorder mass deposited under the retina is reduced, the retinal exudation and the plica are reduced, and the visual function is improved. IL-4 has anti-inflammatory and neuroprotective effects, increases the thickness of a retinal photoreceptor cell layer, relieves retinal damage, improves retinal function, and provides a new treatment idea for clinical treatment of retinal degenerative diseases.

(2) The invention deeply researches the relevant mechanism of IL-4 in treating retinal degenerative diseases, and definitely determines that IL-4 can activate the expression IL-4 receptor IL-4R alpha of retinal RPE cells, increase the level of the retinal RPE cells expressing antioxidant stressors, and inhibit retinal inflammatory reaction, thereby providing a practical theoretical basis for the subsequent treatment and drug development of retinal relevant diseases.

Drawings

FIG. 1 is a graph showing the effect of IL-4 on Electroretinograms (ERG) in mice.

FIG. 2 is a graph showing the effect of IL-4 on the Optical Coherence Tomography (OCT) of mouse eyes.

Fig. 3 is a diagram showing the fundus photography results.

FIG. 4 is a graph showing the effect of IL-4 on the number of RPE pigment clumps in subretinal disorders in mice.

FIG. 5 is a graph showing the immunofluorescence assay results of IL-4 on mouse RPE-scleral complex plating.

FIG. 6 is a graph showing the effect of IL-4 on the mRNA level of mouse RPE-scleral complex expression of inflammatory factors and oxidative stress-related factors.

Detailed Description

In order to make the objects, technical solutions and effects of the present invention clearer and clearer, the present invention is further described in detail below with reference to examples. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The reagents, consumables and instruments used in the present invention are commercially available unless otherwise specified. Animal ethics and all experimental operations are in accordance with the State Committee for science and technology, the regulations on the management of laboratory animals. The experimental methods used in the present invention, such as immunohistochemistry, animal experiments, etc., are all routine methods and techniques in the art.

Representative results from selection of biological experimental replicates are presented in the context figure, and data are presented as mean ± SD and mean ± SEM as specified in the figure. All in vitro experiments were repeated at least three times and animal experiments were repeated twice. Data were analyzed using GraphPad Prism 8.0 or SPSS 22.0 software. And comparing the difference of the average values of two or more groups by adopting conventional medical statistical methods such as t test, chi-square test, variance analysis and the like. p < 0.05 was considered a significant difference.

Example 1 construction of disease model

Sodium iodate (NaIO)₃) Is a stable oxidant, and can increase the conversion of glycine in melanocyte into cytotoxic compound glyoxylic acid by specific chemical reaction with melanin, so that NaIO is₃RPE cells are selectively injured, and then secondary injury of photoreceptor cells occurs, mimicking the pathological changes of retinal degeneration. Thus the present invention employs NaIO₃And constructing a relevant disease model. The method comprises the following specific steps:

(1) dissolving IL-4 in Phosphate Buffer Solution (PBS) to prepare the concentration of 2 mu g/mu L, and obtaining IL-4 solution for later use;

(2) c57BL/6J mice (purchased from Jiangsu Jiejiao kang Biotech Co., Ltd.) for 8-12 weeks were randomly divided into three groups of 10 mice each;

(3) group 1 (blank) was injected in tail vein with PBS, while injecting 1 μ L PBS into the vitreous cavity; group 2 (model group) in tail vein injection NaIO₃Intravitreal injection of 1 μ L PBS; group 3 (treatment group) caudal vein injection of NaIO₃And injecting 1 mu L of the IL-4 solution prepared in the step (1) into a vitreous cavity. Tail vein injection NaIO in

groups

2 and 3₃The concentration of group 1 was 20mg/kg, and PBS of the same volume as that of group 2 and group 3 was injected into the tail vein of group 1;

(4) the vitreous cavity is injected once in the same day of tail vein molding, and the material is taken on the 7 th day after molding to evaluate the treatment effect.

EXAMPLE 2 Electroretinogram (ERG) evaluation of retinal function in mice after IL-4 treatment

The whole experiment process is carried out under weak red light illumination.

(1) In the case of NaIO₃Electroretinography (ERG) was performed on the day 7 of molding for each of the above groups of mice using a electroretinogram apparatus (celeries-Diagnosys system). Mice were dark adapted for 12 hours prior to examination. 4.3 percent chloral hydrate (10 mL/kg) is injected into the abdominal cavity for anesthesia, and the compound tropicamide eye drops are used for mydriasis;

(2) the mice were fixed on the experimental plate and the electrodes were installed. Dropping a little methylcellulose on the cornea, tightly attaching a recording electrode (a ring cornea electrode made of 0.2mm copper wires) on the corner edge, placing a reference electrode (a needle electrode) under the buccal part of the same side of the mouse, and placing a grounding electrode under the tail part of the mouse;

(3) the relevant examination was started about 5 minutes after dark adaptation again. Dark-adapted erg (scotoptic erg) detection and recording were performed using international clinical vision electrophysiological standardization protocol. Record 1.0 cd.m, respectively^-2，3.0cd•m^-2And 10.0 cd.m^-2The ERG waveform of the mice under the illumination intensity is subjected to standard flash stimulation of 30 Hz when the stroboscopic response is detected, and the first three response waves are discarded. The application software analyzes and counts the waveforms.

The results of the detection are shown in FIG. 1. Wherein 1a is the change condition of a wave under different light intensity stimuli; and 1b is the change of the b wave. In the figure, the PBS group is blank group 1, NaIO₃+ PBS group is the control group of the intervention model of retinal degeneration mouse, NaIO₃The + IL-4 group was the IL-4 treatment group of mice with retinal degeneration. Dark adaptation takes place 12 hours later, at 1.0, 3.0 and 10.0cdsm²Under the illumination intensity, the amplitude of the wave a and the wave b of the ERG is counted, and NaIO can be observed₃The wave amplitudes of a wave and b wave of the mouse are obviously reduced compared with the PBS control group; following IL-4 treatment, two different stimulation intensities (1.0, 3.0 and 10.0 cds/m) were indicated in dark²) A wave and b wave of ERG appear in the lower partThe waveform amplitude in the meaning of the mathematics suggests that the retinal nerve function is partially improved, and the amplitude of the visible treatment group is obviously improved compared with the control group: p < 0.05, P < 0.01, P < 0.001.

Example 3 Optical Coherence Tomography (OCT) evaluation of retinal thickness in mice following IL-4 treatment

(1) In the case of NaIO₃On day 7 of molding, OCT tests were performed on the above groups of mice using electroretinography (SPECTRALIS-OCT, Heidelberg, Germany). 4.3 percent chloral hydrate (10 mL/kg) is injected into the anterior abdominal cavity for anesthesia, and the compound tropicamide eye drops are used for mydriasis;

(2) after anesthesia, the mouse head is fixed at a proper position of an OCT jaw frame, and a bulbar conjunctiva is clamped by forceps to rotate the eyeball position, so that an OCT detection light source is aligned to a laser spot area. The laser spot is scanned by a three-dimensional scanning method set in a computer, and a point 3mm away from the papilla of the eye is taken as the center of a circle and 1.5mm is taken as the radius for scanning. The scanning range covers four directions of the transverse direction, the longitudinal direction, the nasal side and the temporal side of the retina so as to calculate the average thickness of the retina.

The results of the detection are shown in FIG. 2. Wherein 2a-c is the condition of Optical Coherence Tomography (OCT) of mouse eyes after IL-4 treatment, the arrow indicates the high reflectance point representing the subretinal RPE lesion, and the dotted line indicates the Outer Nuclear Layer (ONL) where the photoreceptor cells are located, NaIO₃After modeling, RPE focus is increased, photoreceptor damage is lost, ONL thickness is thinned, and RPE focus is obviously reduced and ONL thickness is increased after IL-4 treatment; and 2d is a statistical map of retinal thickness. Indicating that the structure of the diseased retina was significantly restored after IL-4 treatment, xp < 0.001.

EXAMPLE 4 Ocular fundus evaluation of inflammatory exudation of retina after IL-4 treatment

(1) In the case of NaIO₃On day 7 of modeling, fundus imaging examinations were performed on each of the above groups of mice using a small animal retina imaging system (Micron II, Phoenix Research Laboratories). 4.3 percent chloral hydrate (10 mL/kg) is injected into the anterior abdominal cavity for anesthesia, the compound tropicamide eye drops are used for mydriasis, and the surface of the eye is coated with artificial tears for moisture preservation;

(2) after anesthesia, the mouse head is placed on a proper position of a jaw frame, and a detection light source of an eyeground photographing system is aligned to the vertex of a cornea. The light inlet direction and the light source brightness are adjusted to ensure that the visual nipple is positioned at the right center of the visual field, and the whole back polar part is imaged.

The results of the detection are shown in FIG. 3. Result 3a shows that NaIO₃White folds (white arrows) and foci (black arrows) in the diseased retina increased significantly, indicating that the more severe the retinal degeneration, the treatment group of mice (NaIO)₃+ IL-4) is significantly reduced compared to the control group white folds and exudation foci, indicating a reduced degree of retinal degeneration, 3b is a statistical plot of retinal exudation foci; 3c is a statistical map of the white retinal folds,. p < 0.001.

Example 5 Paraffin section H & E staining to observe changes in retinal structure in IL-4 treated mice

(1) In the case of NaIO₃Carrying out cervical dislocation and sacrifice on each group of mice on the 7 th day of molding, obtaining eyeballs, and fixing the eyeballs in 10% formalin for 18-24 hours;

(2) dehydrating in gradient ethanol for 12 hours; soaking in dimethylbenzene for 2 hours and paraffin at 65 ℃ for 3-4 hours in sequence for permeabilization and wax immersion;

(3) wrapping the tissue by an automatic embedding machine, and attaching the 3-4 mu m section obtained by a slicing machine on a glass slide;

(4) dewaxing by using dimethylbenzene, and cleaning by using gradient alcohols of 100%, 95% and 75% until hydration;

(5) performing hematoxylin dip dyeing for 10-15 minutes, and washing with running water;

(6) differentiating by using 1% hydrochloric acid alcohol for 1-2 seconds, bluing by using saturated ammonia water for several seconds, and washing by using running water for 15-30 minutes;

(7) dip-dyeing with 1% alcohol-soluble eosin for 5-15 seconds; and (5) performing conventional dehydration, transparency and sealing.

The results of the detection are shown in FIG. 4. Result 4a shows that NaIO₃Subretinal disorder RPE pigment mass of diseased mice was significantly increased, and the mice treated group (NaIO)₃+ IL-4) vs. control NaIO₃The RPE pigment mass was significantly reduced in the lesion group. 4b is a statistical plot of the number of subretinal disturbed RPE pigment clusters,. p < 0.01.。

Example 6 immunofluorescence staining of RPE-scleral complex plating:

(1) in the case of NaIO₃Carrying out cervical dislocation and sacrifice on each group of mice on the 7 th day of molding to obtain eyeballs;

(2) fixing the eyeball in 4% PFA with volume more than 20 times of that for 60 min;

(3) fixing eyeball with toothed forceps under dissecting microscope, removing optic nerve, connective tissue and muscle from the wall of the eyeball, cutting off cornea, and removing iris, crystal, retina and other tissues to obtain complete RPE-sclera complex;

(4) blocking the RPE-scleral complex in 0.5% Triton X-100/PBS +5% BSA at room temperature for 1 hour or overnight at 4 ℃;

(5) freshly prepared immunofluorescence primary anti-antibody (ZO-1, IL-4R α): 5% BSA in 1: 100 ratios were diluted, RPE-scleral complex was placed in the antibody and incubated overnight at 4 ℃ while the EP tube was gently shaken every few hours to fully contact the antibody.

(6) Taking out the RPE-sclera complex, incubating the secondary antibody for 1-2 hours at room temperature, and keeping out of the sun; PBST is washed for 6 times, 10 minutes each time;

(7) transferring the RPE-sclera complex onto a glass slide, removing impurities with toothless forceps under a dissecting stereomicroscope, radially cutting 4-6 knives with the optic disc as the center, dropping a little anti-fluorescence quenching blocking agent blocking piece with the RPE layer upward, observing under a fluorescence microscope or a confocal microscope, and taking pictures.

The results of the detection are shown in FIG. 5. The results showed that the RPE cells of normal mice were in a honeycomb hexagonal structure, forming an integral tight junction barrier, NaIO₃The tight junctions of the RPE cells in the diseased groups were disrupted, while the tight junctions were restored after IL-4 treatment. In addition, IL-4 receptor IL-4R alpha is mainly expressed in RPE cells after IL-4 stem prediction, which indicates that IL-4 can act on RPE cells through IL-4R alpha to promote the recovery of barrier function.

Example 7 detection of mRNA level Gene expression changes by RPE-scleral Complex qPCR

(1) Extraction of mouse RPE-scleral complex RNA: placing a group of 2 RPE-scleral complexes in 1mL Trizol, violently shaking, and shattering tissues;

(2) adding 200-;

(3) centrifuging at 4 deg.C (13.2 ten thousand cycles for 30-40 min), transferring the supernatant (400-;

(4) adding isopropanol with the same volume, shaking violently, standing at-20 deg.C for more than 2 hr, centrifuging, and discarding supernatant;

(5) adding 1mL of 70% RNase-free ethanol, bouncing up the precipitate, centrifuging again, sucking out the ethanol, and naturally drying in a fume hood;

(6) 20-30 μ L DEPC water (depending on the size of the precipitate) was added, placed on ice and tested for A260/280 and concentration. Using PrimeScript^TMCarrying out cDNA reverse transcription by using an RT reagent Kit cDNA reverse transcription Kit; then, according to the instructions, real-time quantitative PCR was carried out using SYBERGREEN kit, GAPDH as internal reference, 2^-∆∆CtResults analysis was performed with the PCR primers shown in table 1 below.

TABLE 1 PCR primers

Primer name	Forward	Reverse
			Nqo1	AGGATGGGAGGTACTCGAATC	AGGCGTCCTTCCTTATATGCTA
Gapdh	GCCAAGGCTGTGGGCAAGGT	TCTCCAGGCGGCACGTCAGA
			Il-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
Nfkb1	GGAGGCATGTTCGGTAGTGG	CCCTGCGTTGGATTTCGTG

The results of the detection are shown in FIG. 6. Wherein IL-6 and NF-kB reflect inflammation, and Nqo1 reflects antioxidant stress factor expression. Can be seen in NaIO₃In the intervening model group, the expression of inflammatory factors is increased, the expression level of factors resisting oxidative stress is reduced, and NaIO is performed after IL-4 treatment₃The expression of the inflammatory factors in the model group is reduced, and the expression level of protective factors resisting oxidative stress is increased, which shows that IL-4 can effectively improve the oxidative stress state of retinal pigment epithelium and inhibit the retinal inflammatory reaction.

In conclusion, experiments such as ERG, OCT, fundus imaging, H & E and the like prove that the injection of IL-4 in a vitreous cavity can obviously reduce RPE cell damage of a mouse with retinal degeneration, protect visual function and delay retina thinning. Immunofluorescence staining proves that IL-4 can act on an IL-4R alpha receptor of retinal pigment epithelial cells, and the tight junction of mouse RPE cells of a retinal degeneration model is regulated and restored. After IL-4 intervention, the expression level of RPE scleral complex inflammatory factors can be reduced, and the genes related to antioxidant stress of the factors are up-regulated, so that the oxidative stress state of retinal pigment epithelium is improved, and the death process of retinal photoreceptor cells is delayed. The invention provides experimental basis and theoretical basis for potential clinical application of IL-4 in treating retinal degenerative diseases and IL-4 as an immunomodulator, and IL-4 has wide application prospect in preparing pharmaceutical preparations for treating retinal degenerative diseases.

The above detailed description section specifically describes the analysis method according to the present invention. It should be noted that the above description is only for the purpose of helping those skilled in the art better understand the method and idea of the present invention, and not for the limitation of the related contents. The present invention may be appropriately adjusted or modified by those skilled in the art without departing from the principle of the present invention, and the adjustment and modification also fall within the scope of the present invention.

Claims

1. A pharmaceutical composition for treating eye diseases, which comprises IL-4 and phosphate buffer, wherein the concentration of the IL-4 is 2 mug/muL.

2. The pharmaceutical composition according to claim 1, wherein the ocular disease is selected from retinal degeneration.

3. The pharmaceutical preparation for treating the eye diseases is characterized by comprising IL-4, phosphate buffer and pharmaceutically acceptable auxiliary materials, wherein the concentration of the IL-4 is 2 mu g/mu L.

4. The pharmaceutical formulation according to claim 3, wherein the ocular disease is selected from retinal degeneration.

5. The pharmaceutical formulation of claim 3, wherein the pharmaceutical formulation is selected from one or more of a solution, a sol, an emulsion, and a suspension.

6. The pharmaceutical formulation of claim 5, wherein the pharmaceutical formulation is selected from a solution.

7. The pharmaceutical formulation according to claim 3, wherein the pharmaceutically acceptable excipient is selected from one or more of a solvent, a solubilizer, a surfactant, a bacteriostatic agent, an antioxidant, and a chelating agent.

Use of IL-4 in a medicament for treating an ocular disease and/or for ameliorating a physiological indicator associated with an ocular disease.

9. Use according to claim 8, wherein the ocular disease is selected from retinal degeneration.

10. The use of claim 8, wherein the physiological indicators associated with ocular disease are selected from one or more of the number of RPE pigmentary disorder aggregates deposited subretinally, the number of retinal exudations and plications, the retinal photoreceptor cell layer thickness, the level of retinal RPE cell expression of antioxidant stressors.