CN114231652A - Yeast colony PCR kit and application thereof - Google Patents

Abstract

The invention discloses a yeast colony PCR kit and application thereof, belonging to the technical field of molecular biology; the yeast colony PCR kit comprises yeast lysate and yeast PCR amplification Mix; the yeast lysate comprises 20mM KOH, 0.5% BSA by mass fraction and 1M betaine; the yeast PCR amplification Mix comprises Mg²⁺PCR buffer, dNTP, glycerol, ammonium sulfate and Phusion Taq enzyme. The kit is simple and convenient in use process, amplification is completed within 2h, the amplification efficiency is high, and the kit is suitable for popularization and application.

Description

Yeast colony PCR kit and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a yeast colony PCR kit and application thereof.

Background

Yeast, a eukaryote, has a fast growth rate, a mature post-translational modification system and a resistance selection system, and is often used as a heterologous host detection system for animal and plant protein expression and interaction in molecular biological research. Yeast single/double/triple hybrid technology derived from yeast is widely applied to protein-DNA, protein-protein, protein-RNA interaction detection.

In a yeast single/double/triple hybridization experiment, after a positive yeast clone is obtained, PCR amplification and sequencing are carried out on a yeast plasmid to identify gene information carried in the clone. Unlike bacteria such as Escherichia coli, the cell wall of yeast has complex polysaccharide components and is very difficult to break. Therefore, the conventional yeast cloning identification needs to enlarge and culture the bacterial colony, extract the plasmid after the yeast cell-wall breaking enzyme treatment, and then perform PCR amplification and sequencing. The whole process takes 3-5 days, and wastes time, money and labor.

At present, methods for direct PCR amplification using yeast colonies as templates have also been reported. In the method, substances such as higher-concentration SDS and the like are generally utilized to crack yeast cell walls to release yeast plasmid DNA, but the strong cracking agents generally have stronger inhibition effect on the activity of taq enzyme, so that PCR amplification is extremely unstable.

In view of this, the invention of the yeast colony PCR kit and the application method thereof is important for perfecting the yeast single/double/triple hybridization technology.

Disclosure of Invention

The invention discloses a yeast colony PCR kit which is simple and convenient to use, completes amplification within 2 hours and has high amplification efficiency.

In order to achieve the purpose, the invention adopts the following technical scheme:

a yeast colony PCR kit comprises yeast lysate and yeast PCR amplification Mix;

the yeast lysate comprises 20mM KOH, 0.5% BSA by mass fraction and 1M betaine;

the yeast PCR amplification Mix comprises Mg²⁺PCRbuffer, dNTP, glycerol, ammonium sulfate and Phusion Taq enzyme.

Preferably, when yeast PCR amplification Mix is used for amplification, the final concentrations of the components are:

preferably, it contains Mg²⁺The composition of the PCRbuffer comprises 50mM KCl, 10mM Tris-HCl and plasmid in terms of final concentration in the amplification systemWeight fraction 0.1% TritonX-100 and 0.1M MgCl₂。

Preferably, the Yeast PCR amplification Mix is 2 XYeast PCR Mix, diluted one time when used,

each 20mL of 2 × YeastPCRMix includes:

the method for carrying out yeast colony PCR by using the yeast colony PCR kit comprises the following steps:

(1) selecting yeast colony with diameter of 0.2-1mm, adding 10 μ L yeast lysate, mixing, and cracking at 95 deg.C for 3-5 min;

(2) the cleavage product was used as a template for PCR amplification using yeast PCR amplification Mix.

Further, the amplification system is:

further, the primer 1 and the primer 2 are universal primers for yeast vectors.

Further, the amplification procedure was:

in conclusion, the specific strong lysis solution is prepared aiming at polysaccharide components of yeast cell walls, when the kit is used, saccharomycetes are lysed in the yeast lysis solution for 5min, and genome and plasmid DNA are released, so that the kit can be directly used as a template for PCR amplification in yeast PCR amplification Mix to complete detection of a yeast sample, and is simple and efficient to operate; toxic reagents such as mercaptoethanol and SDS are not required to be added in the whole process, tedious operations such as mechanical wall breaking and the like are not required, operations such as sample split charging and the like are not required, and the process is the simplest in the market at present. The PCR amplification is not interfered by yeast lysate, tolerates polysaccharide, has high amplification rate (more than 15 s/Kb), has the amplification rate of fresh yeast of more than 95 percent, and is suitable for the rapid amplification identification of yeast single/double/triple hybrid positive clones.

Drawings

FIG. 1 is an electrophoretogram showing the amplification product of example 2;

wherein, lane 1 is the yeast single colony amplification product, and lane 2 is the blank control.

FIG. 2 shows the electrophoretogram of the amplification product of example 3.

FIG. 3 is an electrophoretogram showing the amplification product of example 4.

FIG. 4 is an electrophoretogram showing amplification products of groups 1 to 5 of example 5.

FIG. 5 is an electrophoretogram showing amplification products of groups 6 to 7 of example 5;

from left to right in the figure: lane 1: 20mM KOH; lanes 2-9: 30mM KOH; lanes 10-17: 50mM KOH.

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the examples, dNTPs were premixed solutions of dATP, dCTP, dGTP and dTTP, each at a concentration of 2.5mM, prepared with ultrapure water, and adjusted to pH 7.0 with a high-purity NaOH solution to a purity of 99% (HPLC) or more. Detecting without DNase, RNase, phosphatase, etc.; storing at-20 deg.C. Phusion Taq enzyme is purchased from TaKaRa company of Dalian province, has the concentration of 5U/mu L, has DNA polymerase activity, does not have 3 '→ 5' exonuclease activity and endonuclease activity, has thermal stability, and still keeps 50% of activity after being preserved for 1 hour at 94 ℃; storing at-20 deg.C.

Example 1

A Yeast colony PCR kit comprises Yeast lysate and 2 XYeast PCR Mix;

the yeast lysate comprises 20mM KOH, 0.5% BSA by mass fraction and 1M betaine;

2 × Yeast PCR Mix per 20mL included:

10 x containing Mg²⁺The PCR buffer comprises:

500mM KCl

100mM Tris-HCl

1％Triton X-100

1M MgCl₂。

example 2

Yeast colony PCR was performed using the yeast colony PCR kit of example 1:

(1) selecting yeast single colony with diameter of 1mm, adding 10 μ L yeast lysate, mixing, and lysing at 95 deg.C for 5 min;

(2) the lysate was aspirated as template and PCR amplification was performed using yeast PCR amplification Mix.

The amplification system is as follows:

the primer 1 and the primer 2 are universal primers of the yeast carrier.

The amplification procedure was:

the PCR amplification products were detected on a 1% agarose gel and a blank was set, and the results are shown in FIG. 1.

Example 3

Yeast colony PCR was performed using the yeast colony PCR kit of example 1:

(1) and (3) picking a yeast colony with the diameter of 0.2-1mm from a colony culture dish successfully transformed by the yeast library by using a 20-microliter gun head, slightly stirring in 10-microliter yeast lysate, confirming that the colony is mixed with the lysate, and performing lysis for 3-5min at 95 ℃.

(2) Taking 10 mu L of lysate as a template, and adding 2 XYeast PCR Mix to directly perform PCR reaction.

The amplification system is as follows:

primer 1(10 μ M): CTATTCGATGATGAAGATACCCCACCAAACCC, respectively;

primer 2(10 μ M): GTGAACTTGCGGGGTTTTTCAGTATCTACGAT, respectively; universal primers on vectors were constructed for the yeast library.

The amplification procedure was:

the PCR amplification products were detected on a 1% agarose gel and the results are shown in FIG. 2. The result shows that the yeast plasmid extracted by the kit is used for PCR amplification, the extraction efficiency is high, the specificity of the PCR amplification is good, the good detection effect can be achieved, and the kit has wide applicability. And the amplification product is flat-ended and does not contain A tail, so that the subsequent operations such as vector construction and the like are facilitated.

Example 4

Yeast colony PCR was performed using the yeast colony PCR kit of example 1:

(1) picking out yeast colony with diameter of 1mm with toothpick, gently stirring in 10 μ L yeast lysate, confirming that the colony is mixed with the lysate, and lysing at 95 deg.C for 3 min.

(2) 2 μ L of the lysate was used as a template, and 2 XYeast PCR Mix was added to directly perform PCR reaction.

The amplification system is as follows:

primer 1(10 μ M): CTATTCGATGATGAAGATACCCCACCAAACCC, respectively;

primer 2(10 μ M): GTGAACTTGCGGGGTTTTTCAGTATCTACGAT, respectively; universal primers on vectors were constructed for the yeast library.

The amplification procedure was:

co-amplifying 8 yeast single colonies, and using the same 8 yeast single colonies, amplifying using respectively Coolaber (cool lador), yinqiao kit and instructions; the PCR amplification products were detected on a 1% agarose gel and the results are shown in FIG. 3. The kit extracts yeast plasmids for PCR amplification, has higher extraction efficiency and better PCR amplification specificity compared with a control kit, can achieve good detection effect, and has wide applicability.

Example 5

The lysis temperature of the yeast lysate and the size of the picked yeast colonies were adjusted on the basis of example 3:

group 1-2 is to detect whether pyrolysis is required, the sample is divided into two in the yeast lysate, group 1: cracking for 5mins at room temperature; group 2: and (4) cracking at 95 ℃ for 5 mins.

Groups 3-5 compare the effect of different colony amounts on the response, group 3: colonies 3mm in diameter were added to 10uL of yeast lysate (very cloudy); group 4: group 3 samples were diluted to 1/10 using yeast lysate; group 5: group 3 samples were diluted to 1/50 using yeast lysate.

Groups 6-7 compare the effect of different KOH on the reaction, group 6: KOH concentration 30 mM; group 7: KOH concentration 50 mM;

the results are shown in fig. 4-5, compared with room temperature cracking, the pyrolysis effect is significantly better, and 100% amplification can be achieved; however, amplification is inhibited by an excessively large amount of yeast colonies and an excessively high KOH concentration.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to the above-described embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (5)

1. A yeast colony PCR kit is characterized in that,

comprises yeast lysate and yeast PCR amplification Mix;

the yeast lysate comprises 20mM KOH, 0.5% BSA (bovine serum albumin) by mass fraction and 1M betaine;

the yeast PCR amplification Mix comprises Mg²⁺PCR buffer, dNTP, glycerol, ammonium sulfate and Phusion Taq enzyme.

2. A yeast colony PCR kit as claimed in claim 1,

when yeast PCR amplification Mix is used for amplification, the final concentration of each component is as follows:

3. a yeast colony PCR kit as claimed in claim 2,

said Mg is contained²⁺The PCR buffer comprises 50mM KCl, 10mM Tris-HCl, 0.1% Triton X-100 and 0.1M MgCl according to the final concentration in the amplification system₂。

4. A yeast colony PCR kit as claimed in claim 3,

the Yeast PCR amplification Mix is 2 XYeast PCR Mix, and is diluted by one time when in use,

every 20mL of the 2 XYeast PCR Mix comprises:

5. a method of performing yeast colony PCR using the yeast colony PCR kit of any one of claims 1-4, comprising the steps of:

(1) selecting yeast colony with diameter of 0.2-1mm, adding 10 μ L of the yeast lysate, mixing, and cracking at 95 deg.C for 3-5 min;

(2) the cleavage product was used as a template for PCR amplification using yeast PCR amplification Mix.

Images