CN114231554B - Vitamin k 2 Biosynthesis method of serial products - Google Patents
Vitamin k 2 Biosynthesis method of serial products Download PDFInfo
- Publication number
- CN114231554B CN114231554B CN202111614876.1A CN202111614876A CN114231554B CN 114231554 B CN114231554 B CN 114231554B CN 202111614876 A CN202111614876 A CN 202111614876A CN 114231554 B CN114231554 B CN 114231554B
- Authority
- CN
- China
- Prior art keywords
- hept
- vitamin
- pcr
- products
- phy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn - After Issue
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1031—Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/66—Preparation of oxygen-containing organic compounds containing the quinoid structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/0103—Heptaprenyl diphosphate synthase (2.5.1.30)
Abstract
The invention relates to the technical field of bioengineering, in particular to vitamin K 2 A method of biosynthesis of a series of products comprising the steps of: step one, knocking out the hepS gene in Bacillus subtilis168 genes to obtain delta hepS strain BS01; step two, knocking out the hepT gene in Bacillus subtilis168 genes to obtain delta hepT strain BS02; step three, amplifying the yqiD gene of the escherichia coli or the hepT gene of Bacillus subtilis by PCR; connecting the obtained PCR product with an expression vector pHY-P43 to obtain a recombinant plasmid, and transferring to BS02 to obtain the vitamin K 2 Engineering bacteria of serial products. The invention is used for obtaining different food-grade vitamin K 2 Homologs are of great importance.
Description
Technical Field
The invention relates to the technical field of bioengineering, in particular to vitamin K 2 A biosynthesis method of the serial products.
Background
As an important class of fat-soluble vitamins, vitamin K 2 Has important application in the fields of food and medicine. Proper amount of vitamin K-enriched supplement for healthy people 2 The food can effectively reduce fracture incidence. In addition, more and more data show that vitamin K deficiency is a significant cause of bleeding disorders and death in infants worldwide. Also, similar to coenzyme Q, vitamin K 2 As a membrane-bound electron carrier, it has the function of repairing damaged cell mitochondria, which plays an important role in preventing human from being afflicted with pulmonary fibrosis after parkinson's disease is healed. Due to these several applications, the international market is directed to vitamin K 2 The demand for (2) has increased in recent years.
Vitamin K 2 The synthesis of (2) is generally carried out by microbial fermentation. The chemical structure of the metabolite is formed by connecting a menaquinone main chain and n isoprene side chains. Depending on the number of isoprene units in the side chain, this is generally denoted MK-n, where n is generally 4-13. The number of isoprene is determined by the microorganism to be synthesized. In general, MK-4 is mainly synthesized in Flavobacterium, MK-8 is synthesized by E.coli, and MK-7 is synthesized by Bacillus subtilis metabolism. n are different, and the biocompatibility, half-life and curative effect of the n are different. If MK-7 has longer half-life than MK-4 and MK-8, the biocompatibility is better; MK-4 biosynthesis is generally higher than MK-7, MK-8.
Bacillus subtilis is used as a feed for Food and drug administration (Food and drug)Drug Administration, FDA) are certified as food-safe microorganisms and have important significance in the synthesis of food-grade vitamins. However, none of the prior art has been able to synthesize vitamin K in the same microorganism, bacillus subtilis 2 Methods of various homologs.
Disclosure of Invention
The present invention has for its object to propose a vitamin K 2 Biosynthesis method of serial products to solve the problem that different food-grade vitamin K can not be synthesized in the prior art 2 Homologs problems.
Based on the above object, the present invention provides a vitamin K 2 A method of biosynthesis of a series of products comprising the steps of:
step one, knocking out the hepS gene in the Bacillus subtilis168 gene, purifying an amplified product, and then chemically converting the amplified product into Bacillus subtilis competent cells to obtain a delta hepS strain BS01;
step two, knocking out the hepT gene in Bacillus subtilis168 genes, purifying an amplified product, and then chemically converting the amplified product into BS01 competent cells to obtain delta hepT strain BS02;
step three, amplifying the yqiD gene of the escherichia coli or the hepT gene of Bacillus subtilis by PCR; connecting the obtained PCR product with an expression vector pHY-P43 to obtain a recombinant plasmid, and transferring to BS02 to obtain the vitamin K 2 Engineering bacteria of serial products.
Preferably, the method for obtaining Δheps strain BS01 in the first step includes the steps of:
a1, culturing Bacillus subtilis168 original bacteria to an exponential growth medium phase, and extracting whole genome DNA;
a2, culturing Escherichia coli JM109 containing the P7C6 plasmid to an exponential growth medium phase, and extracting the P7C6 plasmid;
a3, taking Bacillus subtilis168 whole genome DNA as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA is used as a template of the intermediate fragment, a specific primer shown as SEQ ID NO.1-6 is designed for PCR amplification, and amplified products are purified and then are chemically transformed into Bacillus subtilis competent cells, thus obtaining the plasmid DNA.
Preferably, the method for obtaining Δhept strain BS02 in the second step includes the steps of:
b1, culturing Bacillus subtilis168 original bacteria to an exponential growth medium phase, and extracting whole genome DNA;
b2, culturing Escherichia coli JM109 containing the P7C6 plasmid to an exponential growth medium phase, and extracting the P7C6 plasmid;
b3, taking Bacillus subtilis168 whole genome DNA as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA is used as a template of the intermediate fragment, a specific primer shown as SEQ ID NO.7-12 is designed for PCR amplification, and after the amplification product is purified, the amplification product is chemically transformed into BS01 competent cells, so that the PCR-based plasmid DNA is obtained.
Preferably, primer pairs of the hepT gene of Bacillus subtilis and 168 are shown in SEQ ID NO.13-14, and the obtained PCR product is connected with an expression vector pHY-P43 to obtain a recombinant plasmid pHY-yqiD, and the obtained BS/pHY-yqiD engineering bacterium is BS03 for producing MK-4.
Preferably, the primer pair for PCR amplification of the yqiD gene of the escherichia coli is shown as SEQ ID No.15-16, and the obtained PCR product is connected with an expression vector pHY-P43 to obtain a recombinant plasmid pHY-hepT, and the obtained BS/pHY-hepT engineering bacterium is BS04.
As an alternative embodiment, the biosynthesis method further comprises designing PCR point mutation primer according to the amino acid site to be mutated, amplifying the product by PCR with the recombinant plasmid pHY-hepT as a template, transforming the obtained recombinant plasmid, and transferring to BS02 to obtain vitamin K 2 Mutant strains of the series of products.
Preferably, the amino acid site to be mutated is aspartic acid at 112 th site of the hepT, PCR point mutation primer pairs are designed as shown in SEQ ID NO.17-18 to mutate the aspartic acid at 112 th site into alanine, and the amplified product is transformed to obtain recombinant plasmid pHY-hepT' to obtain mutant BS02 D112A BS05 for MK-5 production.
Preferably, the amino acid site to be mutated is aspartic acid at position 116 of the hepT, and a PCR point mutation primer pair is designed as shown in SEQ ID NO.19-20 to mutate the aspartic acid at position 116 intoAlanine, amplification product transformation treatment to obtain recombinant plasmid pHY-hepT ", mutant strain BS02 was obtained D116A BS06 for producing MK-6.
Preferably, the amino acid site to be mutated is isoleucine at position 115 of the hepT, a PCR point mutation primer pair is designed as shown in SEQ ID NO.21-22 to mutate the isoleucine at position 115 into aspartic acid, and the amplified product is transformed to obtain a recombinant plasmid pHY-hepT', thus obtaining a mutant strain BS02 D115A BS07 for producing MK-8.
Preferably, the PCR amplification system is plasmid DNA 1uL,Buffer with MgSO 4 5uL, primer each 1uL,dNTP 1uL,DNA Polymerase 1.2uL,ddH 2 O was made up to 50uL.
The invention has the beneficial effects that: the invention obtains vitamin K by changing the gene in bacillus subtilis168 2 Comprising MK-4, MK-5, MK-6, MK-7, MK-8; realizes the synthesis of vitamin K in the same microorganism bacillus subtilis 2 Methods of obtaining various homologs, the invention is directed to obtaining different food grade vitamin K 2 Homologs are of great importance.
Drawings
For a clearer description of one or more embodiments of the present description or of the solutions of the prior art, the drawings that are necessary for the description of the embodiments or of the prior art will be briefly described, it being apparent that the drawings in the description below are only one or more embodiments of the present description, from which other drawings can be obtained, without inventive effort, for a person skilled in the art.
FIG. 1 is a schematic diagram of a gene knockout map of the present invention;
FIG. 2 is a schematic diagram of a site-directed mutagenesis scheme according to the present invention;
FIG. 3 is a graph showing MK-4,5,6,7,8 standard samples produced by a constructed strain of the invention;
FIG. 4 is a graph of MK-4 measured in BS03 constructed in accordance with the present invention;
FIG. 5 is a graph of MK-5 measured in BS05 constructed in accordance with the present invention;
FIG. 6 is a graph of MK-6 measured in BS06 constructed in accordance with the present invention;
FIG. 7 is a graph of MK-7 measured in BS00 of the present invention;
FIG. 8 is a graph of MK-8 measured in BS07 of the present invention;
FIG. 9 is a graph showing comparison of the content of different strains constructed according to the present invention.
Detailed Description
For the purposes of promoting an understanding of the principles and advantages of the disclosure, reference will now be made in detail to the following specific examples.
It is noted that unless otherwise defined, technical or scientific terms used in one or more embodiments of the present disclosure should be taken in a general sense as understood by one of ordinary skill in the art to which the present disclosure pertains.
Examples
Construction of Strain BS01
The B.subtilis168 (Bacillus subtilis) original strain, namely BS00, was cultured to the middle of exponential growth, 4mL of bacterial liquid was taken, the bacterial liquid was collected by centrifugation at 10,000Xg for 5 minutes, the medium was discarded, and whole genome DNA was extracted according to the kit instructions. Escherichia coli JM109 harboring the P7C6 plasmid was cultured to the medium of exponential growth, 4mL of the bacterial liquid was collected by centrifugation at 8,000Xg for 2 minutes, the medium was discarded, and plasmid DNA was extracted according to the kit instructions. Taking the whole genome DNA of bacillus subtilis168 as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA was used as a template for the intermediate fragment, the gene sequence of the hepS involved was shown as SEQ ID NO.23, and the products were amplified by PCR by designing the relevant forward and reverse primers (the following specific primers shown as SEQ ID NO.1-6 arranged in sequence from top to bottom).
Specific primers were designed as follows:
L-△hepS-F：5’-ATCATCAATGACATCATCATGAACC
L-△hepS-R：5’-CCCCGGGTACCATTATGCAGGACTCAAAAG
△hepS-P7C6-L：5’-CTGCATAATGGTACCCGGGGATCCTCT
△hepS-P7C6-R：5’-GGACAAGGGTGATATTTGTTCAAGCGAAAACATACCAC
R-△hepS-L：5’-TTTCGCTTGAACAAATATCACCCTTGTCCCCAAA
R-△hepS-R：5’-TGGAGGACATAGAACATGAAAGAAG
the PCR amplification systems of the left and right homology arms are as follows: ddH 2 O10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL,Primer star 12.5uL each. PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃for 10s,55℃for 5s,72℃for 10 s) and finally extension at 72℃for 5min.
Intermediate fragment PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃for 10s,55℃for 5s,72℃for 12 s) and finally extension at 72℃for 5min.
And (3) purifying a target gene band amplified product, chemically converting the target gene band amplified product into competent cells of the strain BS00, and after the transformant grows on a flat plate to be converted, picking up the transformant for liquid culture, and verifying the PCR bacterial liquid to obtain the delta hepS strain, namely the strain BS01.
Construction of Strain BS02
BS00 was cultured to the mid-exponential growth phase, 4mL of bacterial liquid was taken, bacterial cells were collected by centrifugation at 10,000Xg for 5 minutes, the medium was discarded, and whole genome DNA was extracted according to the kit instructions. Escherichia coli JM109 harboring the P7C6 plasmid was cultured to the medium of exponential growth, 4mL of the bacterial liquid was collected by centrifugation at 8,000Xg for 2 minutes, the medium was discarded, and plasmid DNA was extracted according to the kit instructions. Taking the whole genome DNA of bacillus subtilis168 as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA was used as a template for the intermediate fragment, the gene sequence of the hepT involved was shown as SEQ ID NO.24, and the products were amplified by PCR by designing the relevant forward and reverse primers (the following specific primers shown as SEQ ID NO.7-12 arranged in sequence from top to bottom).
Specific primers were designed as follows:
L-△hepT-F：5’-TGATCGTCATTCTGTCCAATGT
L-△hepT-R：5’-GGATCCCCGGGTTTTTTGTAGATATTAAGAAATTTCTCCGCC
△hepT-P7C6-F：5’-CGGAGAAATTTCTTAATATCTACAAAAAACCCGGGGATC
CTCTAGA
△hepT-P7C6-R：5’-CGGGCCTGAAAAGTTCAAGCGAAAACATACCAC
R-△hepT-F：5’-GCTTGAACTTTTCAGGCCCGCCTC
R-△hepT-R:5’-CGTTCTTTCAAGGACGAAAACG
the PCR amplification systems of the left and right homology arms are as follows: ddH 2 O10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL,Primer star 12.5uL each. PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃for 10s,55℃for 5s,72℃for 10 s) and finally extension at 72℃for 5min.
Intermediate fragment PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃for 10s,55℃for 5s,72℃for 12 s) and finally extension at 72℃for 5min.
And (3) purifying a target gene band amplified product, chemically converting the target gene band amplified product into competent cells of the strain BS01, and after the transformant grows on a flat plate to be converted, picking up the transformant for liquid culture, and verifying the PCR bacterial liquid to obtain the delta hepT strain, namely the strain BS02.
Construction of Strain BS03
Coli (Escherichia coli) was cultured to the medium of exponential growth, 3mL of the bacterial liquid was centrifuged at 10,000Xg for 5min, and the supernatant was discarded, and genomic DNA was extracted according to the kit instructions.
The following primers (SEQ ID NOS.13-14) were designed for amplification of the Escherichia coli yqiD gene (yqiD gene fragment shown in SEQ ID NO. 25):
yqiD-F:CGGGATCCTGTTTATCGCCTGGTACTGG
yqiD-R:CGGAATTCTTATTCTACCTTTTCGGCTGTCT
wherein the upstream primer cleavage site is BamHI (underlined in hepT-F) and the downstream primer cleavage site is EcoRI (underlined in hepT-R).
PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃10s,55℃5s,72℃2 s) and finally extension at 72℃for 5min.
After the amplified product is purified, the PCR product and the vector pHY-p43 are subjected to double digestion by BamHI and EcoRI, the recovered products of the two are connected for 16 hours at the temperature of 4 ℃ by using T4 ligase, and the recombinant plasmid pHY-yqiD is transferred to a strain BS02 to obtain a BS/pHY-yqiD engineering bacterium, namely the strain BS03 is obtained, and MK-4 can be produced.
(the test pattern is shown in FIG. 4)
Construction of Strain BS04
BS00 was cultured to the mid-exponential growth phase, 3mL of the bacterial liquid was centrifuged at 10,000Xg for 5min, and the supernatant was discarded, and genomic DNA was extracted according to the kit instructions.
The following primers (SEQ ID NOS: 15-16) were designed for amplification of the B.subtilis168 hepT gene:
hepT-F:5’–GACCGCTGGATCCATGTTAAATATCATTCGTTTACTGGC
hepT-R:5’–CGTGAATTCTTAAAATTTTCTTTTACCGATATATTTTGCG
wherein the upstream primer cleavage site is BamHI (underlined in hepT-F) and the downstream primer cleavage site is EcoRI (underlined in hepT-R).
PCR amplification conditions: denaturation at 98℃for 3min,34 cycles (98℃for 10s,55℃for 5s,72℃for 11 s) and finally extension at 72℃for 5min.
After purification of the amplified product, the PCR product and the vector pHY-p43 were digested with BamHI and EcoRI, the recovered products of both were ligated at 4℃for 16h with T4 ligase, and the recombinant plasmid pHY-hepT was transferred to strain BS02 to give the BS/pHY-hepT engineering bacterium, strain BS04, which produced MK-7.
Construction of Strain BS05
PCR point mutation primers are designed according to the amino acid sites to be mutated, and products are amplified by PCR by taking recombinant plasmid pHY-hepT as a template. Wherein, the PCR point mutation primer (shown in SEQ ID NO. 17-18) is a forward primer and a reverse primer as follows:
D112A-F:TGGCATCTTTGGTTCATGCCGATGTCATTGATGATGCA
D112A-R:TGCATCATCAATGACATCGGCATGAACCAAAGATGCCA
wherein the underlined parts represent the codons corresponding to the mutation of aspartic acid at position 112 to alanine, respectively, encoded by the mutant gene. The PCR amplification system is as follows: plasmid DNA 1uL,Buffer with MgSO 4 5uL, primer each 1uL,dNTP 1uL,DNA Polymerase 1.2uL,ddH 2 O was added to 50uL, and the PCR amplification conditions were denatured at 95℃for 3min, and the mixture was cycled 18 times (95℃for 30s,60℃for 60s,68℃for 76 s) and 68℃for 10 min.
The PCR product was treated with DpnI enzyme at 37 ℃And 3h, removing the template DNA, transforming the digested product into escherichia coli DH5 alpha competent cells to obtain transformants of the related mutant strains, extracting plasmids, and sequencing and verifying. Transferring the recombinant plasmid pHY-hepT' with the corresponding hepT locus successfully mutated into the strain BS02 to obtain the mutant strain BS02 to be expressed D112A I.e., strain BS05, can produce MK-5 (test pattern is shown in FIG. 5).
Construction of Strain BS06
PCR point mutation primers are designed according to the amino acid sites to be mutated, and products are amplified by PCR by taking recombinant plasmid pHY-hepT as a template. Wherein, the PCR point mutation primer (shown in SEQ ID NO. 19-20) is a forward primer and a reverse primer as follows:
D116A-F:GGTTCATGATGATGTCATTGCCGATGCAGAGCTTCGCCGAGG
D116A-R:CCTCGGCGAAGCTCTGCATCGGCAATGACATCATCATGAACC
wherein the underlined parts represent the codons corresponding to the mutation of aspartic acid at position 116 to alanine, respectively, encoded by the mutant gene. The PCR amplification system is as follows: plasmid DNA 1uL,Buffer with MgSO 4 5uL, primer each 1uL,dNTP 1uL,DNA Polymerase 1.2uL,ddH 2 O was added to 50uL, and the PCR amplification conditions were denatured at 95℃for 3min, and the mixture was cycled 18 times (95℃for 30s,60℃for 60s,68℃for 76 s) and 68℃for 10 min.
The PCR product was treated with DpnI enzyme at 37℃for 3h, template DNA was removed, E.coli DH 5. Alpha. Competent cells were transformed with the digested product, transformants of the relevant mutant strain were obtained, plasmids were extracted, and sequencing verified. Transferring the recombinant plasmid pHY-hepT' with the corresponding hepT locus successfully mutated into the strain BS02 to obtain the mutant strain BS02 to be expressed D116A I.e., strain BS06, can produce MK-6 (the test pattern is shown in FIG. 6).
Construction of Strain BS07
PCR point mutation primers are designed according to the amino acid sites to be mutated, and products are amplified by PCR by taking recombinant plasmid pHY-hepT as a template. Wherein, the PCR point mutation primers (shown in SEQ ID NO. 21-22) are the following forward primer and reverse primer:
I115D-F:CTTTGGTTCATGATGATGTCGATGATGATGCAGAGCTTCGCC
I115D-R:GGCGAAGCTCTGCATCATCATCGACATCATCATGAACCAAAG
wherein the underlined parts represent the codons corresponding to the mutation of isoleucine 115 to aspartic acid encoded by the mutant gene, respectively. The PCR amplification system is as follows: plasmid DNA 1uL,Buffer with MgSO 4 5uL, primer each 1uL,dNTP 1uL,DNA Polymerase 1.2uL,ddH 2 O was added to 50uL, and the PCR amplification conditions were denatured at 95℃for 3min, and the mixture was cycled 18 times (95℃for 30s,60℃for 60s,68℃for 76 s) and 68℃for 10 min.
The PCR product was treated with DpnI enzyme at 37℃for 3h, template DNA was removed, E.coli DH 5. Alpha. Competent cells were transformed with the digested product, transformants of the relevant mutant strain were obtained, plasmids were extracted, and sequencing verified. Transferring the recombinant plasmid pHY-hepT' "with the corresponding hepT locus successfully mutated into the strain BS02 to obtain the mutant strain BS02 to be expressed D115A I.e., strain BS07, can produce MK-8 (test pattern is shown in FIG. 8).
Identification of mutant Gene sequences
After picking single colony from an ampicillin or chloramphenicol resistance plate, carrying out colony PCR preliminary verification, after verification success, picking a proper amount of single colony, inoculating the single colony into a small test tube containing LB culture medium of ampicillin (100 ug/mL) or chloramphenicol (25 ug/mL), placing the small test tube into a shaking table at 37 ℃ for shaking culture for 8 hours at 200r/min, sucking 1.5mL of bacterial liquid, sending the bacterial liquid to general biological limited company for sequencing, and determining that mutation is successful by sequencing the colony with correct verification result.
Vitamin K 2 Extraction assay of (a)
After the engineering bacteria are cultured for 6 days, 0.5mL of fermentation liquor is taken, 1mL of normal butanol is added for shaking vigorously for 5min, and then centrifugation is carried out for 10min at 8000rpm, and an upper organic phase is collected. The collected upper organic phase is protected from light, and is detected by high performance liquid chromatography after passing through an organic filter membrane with the thickness of 0.45 mu m. The detection conditions are mobile phase: methanol: dichloromethane = 4:1, flow rate: 1.0mL/min, detection wavelength: 248nm, temperature: and (3) quantitatively detecting the peak time of the reference sample and the standard curve of the reference sample at 30 ℃. As shown in FIG. 9, the results of the measurement show that the vitamin K can be obtained from BS00 and BS02-BS07 2 Wherein the amount of MK-7 produced by BS00 is 8.42.+ -. 0.47mg/L and the amount of MK-4 produced by BS02 is3.36.+ -. 0.26mg/L, BS05 produced MK-5 in an amount of 4.71.+ -. 0.52mg/L, BS06 produced MK-6 in an amount of 5.45.+ -. 0.63mg/L, BS04 produced MK-7 in an amount of 38.25.+ -. 0.66 mg/L, and BS07 produced MK-8 in an amount of 14.29.+ -. 0.34mg/L.
Those of ordinary skill in the art will appreciate that: the discussion of any of the embodiments above is merely exemplary and is not intended to suggest that the scope of the disclosure, including the claims, is limited to these examples; combinations of features of the above embodiments or in different embodiments are also possible within the spirit of the present disclosure, steps may be implemented in any order, and there are many other variations of the different aspects of one or more embodiments described above which are not provided in detail for the sake of brevity.
The present disclosure is intended to embrace all such alternatives, modifications and variances which fall within the broad scope of the appended claims. Accordingly, any omissions, modifications, equivalents, improvements and the like, which are within the spirit and principle of the invention, are intended to be included within the scope of the present disclosure.
Sequence listing
<110> university of Anhui engineering
<120> a method for biosynthesis of vitamin K2 series products
<130> 1
<141> 2021-12-27
<160> 25
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 1
atcatcaatg acatcatcat gaacc 25
<210> 2
<211> 30
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 2
ccccgggtac cattatgcag gactcaaaag 30
<210> 3
<211> 27
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 3
ctgcataatg gtacccgggg atcctct 27
<210> 4
<211> 38
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 4
ggacaagggt gatatttgtt caagcgaaaa cataccac 38
<210> 5
<211> 34
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 5
tttcgcttga acaaatatca cccttgtccc caaa 34
<210> 6
<211> 25
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 6
tggaggacat agaacatgaa agaag 25
<210> 7
<211> 22
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 7
tgatcgtcat tctgtccaat gt 22
<210> 8
<211> 42
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 8
ggatccccgg gttttttgta gatattaaga aatttctccg cc 42
<210> 9
<211> 46
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 9
cggagaaatt tcttaatatc tacaaaaaac ccggggatcc tctaga 46
<210> 10
<211> 33
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 10
cgggcctgaa aagttcaagc gaaaacatac cac 33
<210> 11
<211> 24
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 11
gcttgaactt ttcaggcccg cctc 24
<210> 12
<211> 22
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 12
cgttctttca aggacgaaaa cg 22
<210> 13
<211> 28
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 13
cgggatcctg tttatcgcct ggtactgg 28
<210> 14
<211> 31
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 14
cggaattctt attctacctt ttcggctgtc t 31
<210> 15
<211> 39
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 15
gaccgctgga tccatgttaa atatcattcg tttactggc 39
<210> 16
<211> 40
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 16
cgtgaattct taaaattttc ttttaccgat atattttgcg 40
<210> 17
<211> 38
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 17
tggcatcttt ggttcatgcc gatgtcattg atgatgca 38
<210> 18
<211> 38
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 18
tgcatcatca atgacatcgg catgaaccaa agatgcca 38
<210> 19
<211> 42
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 19
ggttcatgat gatgtcattg ccgatgcaga gcttcgccga gg 42
<210> 20
<211> 42
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 20
cctcggcgaa gctctgcatc ggcaatgaca tcatcatgaa cc 42
<210> 21
<211> 42
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 21
ctttggttca tgatgatgtc gatgatgatg cagagcttcg cc 42
<210> 22
<211> 42
<212> DNA
<213> Synthesis of human beings (Synthetic)
<400> 22
ggcgaagctc tgcatcatca tcgacatcat catgaaccaa ag 42
<210> 23
<211> 756
<212> DNA
<213> Bacillus subtilis168 (Bacillus subtilis 168)
<400> 23
ttgcaagaca tctacggaac tttagccaat ctgaacacga aattaaaaca aaagctgtct 60
catccttatt tagcgaagca tatttctgcg ccgaaaattg atgaggataa gcttcttctt 120
tttcatgctt tatttgaaga agccgacata aaaaacaacg acagagaaaa ttatattgta 180
acagcgatgc ttgtacaaag cgcccttgat acccatgatg aagtgacgac agctagagtc 240
ataaaacgag acgaaaacaa aaaccgccaa ttgactgttc tcgcgggcga ttatttcagc 300
gggctgtact actctttact atctgaaatg aaggatatct acatgattcg gacgcttgct 360
acagccatta aagaaatcaa cgaacataaa attcgtctgt atgaccgttc tttcaaggac 420
gaaaacgatt ttttcgaaag tgtcggcatc gttgaatcag ctttattcca tcgtgtggcg 480
gaacacttca acctcccgcg ctggaaaaag ctgtcgagtg atttttttgt atttaagcgg 540
cttatgaacg gaaatgatgc atttctggat gtgatcggca gttttataca gctgggaaaa 600
acaaaagaag agatattaga agattgtttt aaaaaagcga aaaacagcat tgagtcactt 660
ctgcctctaa attcacctat tcagaacatt ttaataaacc gtctgaagac aatcagccaa 720
gatcaaacct atcatcagaa agtggaagaa gggtaa 756
<210> 24
<211> 1047
<212> DNA
<213> Bacillus subtilis168 (Bacillus subtilis 168)
<400> 24
atgttaaata tcattcgttt actggcggag tcgctgccac gcatatcgga tggaaatgaa 60
aacacagatg tttgggtgaa tgatatgaaa tttaaaatgg cctactcttt tttaaatgac 120
gatattgatg taatcgaaag agaacttgaa caaaccgtac gttccgatta cccgctttta 180
agcgaggcag gtcttcacct gctgcaggcc ggagggaaac gtattcggcc tgttttcgtg 240
ctgctttctg gcatgtttgg cgattatgat attaataaga ttaaatatgt cgccgtcact 300
ctggaaatga ttcacatggc atctttggtt catgatgatg tcattgatga tgcagagctt 360
cgccgaggaa aaccgacaat caaagcaaag tgggacaatc gtattgcgat gtacacaggc 420
gattatatgc ttgcgggatc tcttgaaatg atgacgagaa ttaacgaacc gaaagcccat 480
aggattttgt cacagacgat cgttgaagtt tgtctagggg aaattgagca gatcaaagac 540
aaatacaaca tggaacaaaa tctcagaacg tatctccgcc gtatcaaaag aaaaacagct 600
ctcttgatcg cggtcagctg ccagcttggt gccattgcgt ctggagctga tgagaagatt 660
cataaggcat tgtactggtt tgggtattac gtcggcatgt cttatcagat tattgatgat 720
attcttgatt ttacttcaac tgaggaagag ctgggtaaac ccgtaggagg agatttgctt 780
caaggaaacg tcacattgcc agtgctgtat gccctgaaaa atcctgcatt aaaaaaccag 840
cttaaattga ttaacagtga gacaacgcag gaacagcttg aaccaatcat tgaagaaatc 900
aaaaaaacag atgcaattga agcatctatg gcagtaagcg aaatgtatct gcagaaagct 960
tttcagaaat taaacacgct tcctcgaggg cgcgcacgct cgtctcttgc agccatcgca 1020
aaatatatcg gtaaaagaaa attttaa 1047
<210> 25
<211> 170
<212> DNA
<213> Escherichia coli
<400> 25
tgtttatcgc ctggtactgg attgtattga ttgctctggt tgtggtgggt tatttcctgc 60
atttgaaacg ttattgtcgg gcgtttcgcc aggacagaga cgcactgctt gaagcgcgga 120
acaaatactt aaacagtacg agagaagaga cagccgaaaa ggtagaataa 170
Claims (10)
1. Vitamin K 2 A method for biosynthesis of a series of products, comprising the steps of:
step one, knocking out the hepS gene in the Bacillus subtilis168 gene, purifying an amplified product, and then chemically converting the amplified product into Bacillus subtilis competent cells to obtain a delta hepS strain BS01;
step two, knocking out the hepT gene in Bacillus subtilis168 genes, purifying an amplified product, and then chemically converting the amplified product into BS01 competent cells to obtain delta hepT strain BS02;
step three, amplifying the yqiD gene of the escherichia coli or the hepT gene of Bacillus subtilis by PCR; connecting the obtained PCR product with an expression vector pHY-P43 to obtain a recombinant plasmid, and transferring to BS02 to obtain the vitamin K 2 Engineering bacteria of serial products.
2. Vitamin K according to claim 1 2 A method for biosynthesis of a series of products, characterized in that the method for obtaining Δheps strain BS01 in step one comprises the steps of:
a1, culturing Bacillus subtilis168 original bacteria to an exponential growth medium phase, and extracting whole genome DNA;
a2, culturing Escherichia coli JM109 containing the P7C6 plasmid to an exponential growth medium phase, and extracting the P7C6 plasmid;
a3, taking Bacillus subtilis168 whole genome DNA as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA is used as a template of the intermediate fragment, a specific primer shown as SEQ ID NO.1-6 is designed for PCR amplification, and amplified products are purified and then are chemically transformed into Bacillus subtilis competent cells, thus obtaining the plasmid DNA.
3. Vitamin K according to claim 1 2 A method for biosynthesis of a series of products, characterized in that the method for obtaining ΔhepT strain BS02 in step two comprises the steps of:
b1, culturing Bacillus subtilis168 original bacteria to an exponential growth medium phase, and extracting whole genome DNA;
b2, culturing Escherichia coli JM109 containing the P7C6 plasmid to an exponential growth medium phase, and extracting the P7C6 plasmid;
b3, taking Bacillus subtilis168 whole genome DNA as a template of a left homology arm and a right homology arm; the P7C6 plasmid DNA is used as a template of the intermediate fragment, a specific primer shown as SEQ ID NO.7-12 is designed for PCR amplification, and after the amplification product is purified, the amplification product is chemically transformed into BS01 competent cells, so that the PCR-based plasmid DNA is obtained.
4. Vitamin K according to claim 1 2 The biosynthesis method of the serial products is characterized in that primer pairs of the hepT gene of Bacillus subtilis and 168 are shown in SEQ ID NO.13-14, the obtained PCR products are connected with an expression vector pHY-P43 to obtain a recombinant plasmid pHY-yqiD, and the obtained BS/pHY-yqiD engineering bacteria are BS03 for producing MK-4.
5. Vitamin K according to claim 1 2 The biosynthesis method of the serial products is characterized in that the primer pair for amplifying the yqiD gene of the escherichia coli by PCR is shown as SEQ ID No.15-16, the obtained PCR product is connected with an expression vector pHY-P43 to obtain a recombinant plasmid pHY-hepT, and the obtained BS/pHY-hepT engineering bacterium is BS04.
6. Vitamin K according to claim 5 2 The biosynthesis method of the serial products is characterized by further comprising the steps of designing PCR point mutation primers according to amino acid sites to be mutated, taking a recombinant plasmid pHY-hepT as a template, amplifying the products by PCR, converting the obtained recombinant plasmid, and transferring to BS02 to obtain the vitamin K 2 Serial productsMutant strains of the species.
7. Vitamin K according to claim 6 2 A biosynthesis method of serial products is characterized in that the amino acid site to be mutated is aspartic acid at 112 th site of hepT, PCR point mutation primer pairs are designed as shown in SEQ ID NO.17-18 to mutate the aspartic acid at 112 th site into alanine, and amplification product transformation treatment is carried out to obtain recombinant plasmid pHY-hepT' to obtain mutant strain BS02 D112A BS05 for MK-5 production.
8. Vitamin K according to claim 6 2 A biosynthesis method of serial products is characterized in that the amino acid site to be mutated is aspartic acid at position 116 of hepT, a PCR point mutation primer pair is designed as shown in SEQ ID NO.19-20 to mutate aspartic acid at position 116 into alanine, and amplification product transformation treatment is carried out to obtain recombinant plasmid pHY-hepT to obtain mutant strain BS02 D116A BS06 for producing MK-6.
9. Vitamin K according to claim 6 2 A biosynthesis method of serial products is characterized in that the amino acid site to be mutated is isoleucine at position 115 of the hepT, a PCR point mutation primer pair is designed as shown in SEQ ID NO.21-22 to mutate the isoleucine at position 115 into aspartic acid, and amplification product transformation treatment is carried out to obtain a recombinant plasmid pHY-hepT' ", thus obtaining a mutant strain BS02 D115A BS07 for producing MK-8.
10. Vitamin K according to any of claims 6-9 2 A method for biosynthesis of a series of products, characterized in that the PCR amplification system is plasmid DNA 1uL,Buffer with MgSO 4 5uL, primer each 1uL,dNTP 1uL,DNA Polymerase 1.2uL,ddH 2 O was made up to 50uL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111614876.1A CN114231554B (en) | 2021-12-27 | 2021-12-27 | Vitamin k 2 Biosynthesis method of serial products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111614876.1A CN114231554B (en) | 2021-12-27 | 2021-12-27 | Vitamin k 2 Biosynthesis method of serial products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114231554A CN114231554A (en) | 2022-03-25 |
| CN114231554B true CN114231554B (en) | 2023-07-28 |
Family
ID=80763567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111614876.1A Withdrawn - After Issue CN114231554B (en) | 2021-12-27 | 2021-12-27 | Vitamin k 2 Biosynthesis method of serial products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114231554B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011036156A (en) * | 2009-08-07 | 2011-02-24 | Kao Corp | Method for producing vitamin k2 |
| CN108410775A (en) * | 2018-04-27 | 2018-08-17 | 江南大学 | One plant height produces farnoquinone（MK-7）Bafillus natto and its application |
| CN112501143A (en) * | 2020-12-15 | 2021-03-16 | 安徽工程大学 | Isoprenoid transferase ComQ mutant, gene, vector, engineering bacterium, preparation method and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102004062386B4 (en) * | 2003-12-24 | 2010-06-24 | Food Industry Research And Development Institute | Monacolin K biosynthesis genes |
| CN110229772B (en) * | 2019-06-04 | 2021-05-28 | 南通励成生物工程有限公司 | Recombinant bacillus subtilis for increasing yield of hepta-menadione and application thereof |
-
2021
- 2021-12-27 CN CN202111614876.1A patent/CN114231554B/en not_active Withdrawn - After Issue
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011036156A (en) * | 2009-08-07 | 2011-02-24 | Kao Corp | Method for producing vitamin k2 |
| CN108410775A (en) * | 2018-04-27 | 2018-08-17 | 江南大学 | One plant height produces farnoquinone（MK-7）Bafillus natto and its application |
| CN112501143A (en) * | 2020-12-15 | 2021-03-16 | 安徽工程大学 | Isoprenoid transferase ComQ mutant, gene, vector, engineering bacterium, preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| Enhancing menaquinone-7 production in recombinant Bacillus amyloliquefaciens by metabolic pathway engineering;Xu, JZ等;《RSC ADVANCES》;第7卷(第45期);第28527-28534页 * |
| 不同培养条件对枯草芽胞杆菌BS168-ΔsinＲ 生物膜形成及维生素K2 产量的影响;吴静等;《食品与发酵工业》;第47卷(第14期);第23-30页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114231554A (en) | 2022-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100797643B1 (en) | Pyruvate producting yeast strain | |
| US9062334B2 (en) | Method for producing pyrroloquinoline quinone using a bacterium of the genus Methylobacterium or Hyphomicrobium | |
| CN109666620B (en) | Engineering strain for producing tagatose, construction method and application thereof | |
| CN105255925A (en) | Efficient preparation method and gene engineering bacteria of sucrose isomerase | |
| KR20140005170A (en) | Microorganisms for 1,3-propanediol production using high glycerine concentration | |
| US20230265411A1 (en) | Strain Producing D-allulose 3-epimerase and Application thereof | |
| JP2008029329A (en) | Method for producing yeast and l-lactic acid | |
| CN111748535B (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN109486834B (en) | Recombinant lactococcus lactis for high yield of nisin and construction method thereof | |
| CN113025548B (en) | Recombinant bacterium for producing 2' -fucosyllactose based on kosakonia sp | |
| CN107619817B (en) | Escherichia coli recombinant strain for producing 3-dehydroshikimic acid and construction method and application thereof | |
| CN112080452B (en) | High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application | |
| CN106701649B (en) | L-glutamine producing strain and method for producing L-glutamine | |
| CN114231554B (en) | Vitamin k 2 Biosynthesis method of serial products | |
| CN114250240B (en) | Method for regulating escherichia coli bacterial membrane morphology and efficiently synthesizing MK-7 | |
| WO2020042697A1 (en) | Recombinant microorganism, preparation method therefor and application thereof in producing coenzyme q10 | |
| CN107299074B (en) | Construction method and application of formate dehydrogenase engineering strain | |
| CN111549045B (en) | Vitamin K improvement by utilizing recombinant bacillus natto 2 Method for producing yield | |
| TW202202621A (en) | Novel promoter and method of producing glutathione using the same | |
| KR102602060B1 (en) | Recombinant microorganism for producing 2,3-butanediol with reduced by-product production and method for producing 2,3-butanediol using the same | |
| CN116463306B (en) | Shikimate dehydrogenase mutant and method for producing shikimate by using same | |
| EP3625337A1 (en) | Process for producing an organic compound | |
| CN114806902B (en) | Method for obtaining non-transgenic trichoderma reesei targeted genetic engineering improved strain and application | |
| CN114934028B (en) | L-sorbose dehydrogenase mutant and application thereof | |
| KR20230039826A (en) | Recombinant microorganism with controlled production ability of polyol and viscous polymer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20220325 |
|
| WW01 | Invention patent application withdrawn after publication | ||
| CI02 | Correction of invention patent application |
Correction item: withdrawal of application for invention after its publication Correct: Withdrawal of an application for a patent for invention after its publication False: Withdrawal of invention patent application after publication Number: 51-01 Volume: 38 |
|
| CI02 | Correction of invention patent application | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |