CN114225044B

CN114225044B - Reagent for modifying extracellular vesicles and preparation method thereof

Info

Publication number: CN114225044B
Application number: CN202210164997.9A
Authority: CN
Inventors: 葛啸虎; 王达; 董凤伟; 陆路; 马德美; 王淼; 程国钢; 白云飞; 韩春乐; 陈宁
Original assignee: Tianjiu Regenerative Medicine Tianjin Technology Co ltd
Current assignee: Tianjin Exosome Technology Co ltd
Priority date: 2022-02-23
Filing date: 2022-02-23
Publication date: 2023-01-31
Anticipated expiration: 2042-02-23
Also published as: CN114225044A

Abstract

The invention discloses a reagent for modifying extracellular vesicles and a preparation method thereof. The invention has the beneficial effects that: the morphology and the structural composition of the extracellular vesicles are not changed, the biological function of the extracellular vesicles is not influenced, and the extracellular vesicles can be stably, efficiently and controllably modified; for example, when the modifier is a fluorescent probe, the extracellular vesicles can be efficiently and controllably modified, a good visualization effect of the extracellular vesicles is obtained, and a new strategy can be provided for developing an extracellular vesicle in-vivo tracing method and an extracellular vesicle tracing drug.

Description

Reagent for modifying extracellular vesicles and preparation method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a reagent for modifying extracellular vesicles and a preparation method thereof.

Background

Extracellular Vesicles (EV) are a type of vesicular bodies secreted and released by a variety of living cells, ranging in diameter from 30 to 1000 nm and having a lipid bilayer structure. Extracellular vesicles widely exist in cell culture supernatants and various body fluids (such as milk, blood, urine, lymph fluid and the like) of most animals, and contained cell-specific proteins and nucleic acids can be used as signal molecules to be transmitted to other cells so as to change the functions of other cells, and the advantages of stable encapsulation effect and targeted modification of lipid bilayer structures of the extracellular vesicles are achieved, so that the extracellular vesicles become a research hotspot in the field of targeted drug delivery systems in recent years. At present, there have been increasing studies showing that extracellular vesicles are a novel endogenous drug carrier with good stability, excellent biocompatibility and inherent long-term circulation ability, suitable for the delivery of various small molecule chemical drugs, proteins, nucleic acids and gene therapeutic agents. For example, the extracellular vesicles from the mesenchymal stem cells show obvious anti-proliferation activity on human pancreatic cancer cells after being loaded with paclitaxel. However, the types of drugs that can be used for loading and delivery of extracellular vesicles are limited, and mainly include small-molecule chemical drugs. The polypeptide, protein molecule and nucleic acid medicine have high requirements on the loading of extracellular vesicles due to the complex structure, so that the medicine is loaded in a form of coating the extracellular vesicles, and the medicine is rarely loaded in a chemical coupling mode. Most of the extracellular vesicle drug loading methods mainly based on drug coating methods have the disadvantages of low drug loading rate, poor drug loading stability, non-ideal drug delivery effect, complex operation and the like.

In addition, in vitro and in vivo tracing of extracellular vesicles is a prerequisite and key to the use of extracellular vesicles as drug carriers for disease treatment. So far, most of the tracing and labeling methods for extracellular vesicles change the morphology and the membrane structure composition of the extracellular vesicles to some extent, and influence the physicochemical properties and the biological functions of the extracellular vesicles. For example, CD9 is one of the common surface markers of extracellular vesicles and has important functions. The fluorescent molecule with carboxyl and the amino on the CD9 protein are used for marking the extracellular vesicles through esterification and crosslinking, and the result shows that the expression level of the CD9 is reduced, which indicates that the membrane composition of the marked extracellular vesicles is changed. This approach therefore affects the normal biological function of the extracellular vesicles. The method for labeling the lipid membrane of the extracellular vesicle by using the conventional membrane dye has the defects of easiness in quenching of the dye, low labeling efficiency, change of the membrane structure and the like. In addition, the existing extracellular vesicle tracing and labeling method has the defects of immature technology, low repeatability and the like. These problems severely hamper the progress of the study for visualization of extracellular vesicles. Therefore, there is a need for a stable and reliable method for modifying extracellular vesicles, which can visualize extracellular vesicles by coupling fluorescent molecules without affecting the morphology, structure and biological function of extracellular vesicles, and further study the biological function and therapeutic effect of extracellular vesicles. The extracellular vesicle modification method can also be used for coupling small-molecule chemical drugs, polypeptides, protein molecules, nucleic acid macromolecules and other drugs with the extracellular vesicles so as to realize loading and delivery of the extracellular vesicle drugs.

Disclosure of Invention

In order to solve the technical problems, the invention provides a reagent for modifying extracellular vesicles and a preparation method thereof.

The technical scheme adopted by the invention is as follows: a compound has a structure shown in formula 2;

formula 2;

wherein n is less than or equal to 14, n is an even number, and R is a modifier.

Preferably, the modifier is a small molecule compound or a large molecule compound;

preferably, the small molecule compound is a fluorescent probe or a chemical drug; the macromolecular compound is a nucleic acid fragment, polypeptide or protein molecule.

The method for preparing the compound shown in the formula 2 comprises the steps of carrying out click chemical coupling on an azide modification substance and carboxyl activated dibenzocyclooctynoic acid to form a reagent for modifying extracellular vesicles.

Preferably, the crosslinking agent consisting of carbodiimide and N-hydroxysuccinimide activates the carboxyl group of diphenylcyclooctyne acid to obtain diphenylcyclooctyne succinimide ester.

Preferably, the molar ratio of carbodiimide, N-hydroxysuccinimide and diphenylcyclooctynoic acid is 1-1.1.

Preferably, the carbodiimide is dicyclohexylcarbodiimide or 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride;

the structural formula of the biphenyl cyclooctynoic acid is as follows:

formula 1;

wherein n is an even number.

An agent for modifying extracellular vesicles comprising a compound of formula 2.

A method of modifying extracellular vesicles by incubating a compound of formula 2 in admixture with extracellular vesicles, or incubating an agent that modifies extracellular vesicles in admixture with extracellular vesicles.

Preferably, the incubation condition is to take ultrapure water, physiological saline or PBS buffer solution as a solvent, and the reaction is carried out for 0.5-1 h at 25-37 ℃.

Preferably, the modified extracellular vesicles are prepared and purified by centrifugation at 20-25 ℃ and 10000-12000 g for 50-100 min.

Preferably, the extracellular vesicles are extracellular vesicles derived from milk sources, blood, urine or stem cells.

Modified extracellular vesicles prepared by the method of modifying extracellular vesicles.

The invention has the advantages and positive effects that: the reagent for modifying the extracellular vesicles is prepared by coupling a modification object subjected to azide modification and diphenylcyclooctynoic acid (micromolecule Linker) activated by carboxyl by utilizing the advantages of sensitive, rapid, efficient and simple and convenient operation of click chemical reaction and the like, and the reagent for modifying the extracellular vesicles simultaneously has a functional group and an active ester group of the modification object; the modification process can stably, efficiently and controllably modify the extracellular vesicles without changing the morphology and the structural composition of the extracellular vesicles and influencing the biological functions of the extracellular vesicles, and is favorable for the research of the molecular loading function and the labeling function of the extracellular vesicles.

For example, when the modifier is a fluorescent probe, the extracellular vesicles can be fluorescently labeled, and the in-vitro detection experiment of a nano-flow type, a cell flow type and a laser confocal microscope shows that the labeling efficiency of the fluorescence labeling method for the extracellular vesicles exceeds 95%, the labeling efficiency does not change significantly (95%) after 6 days of fluorescence labeling, and the labeling method can selectively label extracellular vesicle membrane lipid molecules; the invention realizes the stable, efficient and controllable marking of the extracellular vesicles, obtains good visualization effect of the extracellular vesicles, and provides a new strategy for developing an extracellular vesicle in-vivo tracing method and an extracellular vesicle tracing medicament.

Drawings

FIG. 1 is a scheme for preparing the fluorescent labeling method and fluorescent labeling reagent for extracellular vesicles according to example 2;

FIG. 2 is a structural diagram of the extracellular vesicles after fluorescent labeling in example 2;

fig. 3 is a graph showing the fluorescence labeling rate and the particle size distribution of extracellular vesicles, in which fig. 3A is the fluorescence labeling rate of example 2, fig. 3B is the fluorescence labeling rate of a comparative example, fig. 3C is a flow histogram of the comparative example after coupling with latex microspheres (latex microbeads), fig. 3D is the particle size distribution of example 2, and fig. 3E is the particle size distribution of unlabeled extracellular vesicles;

FIG. 4 is the fluorescence labeling rate of example 2 and comparative example after proteinase K action for 24 hours, wherein FIG. 4A is the fluorescence labeling rate of example 2, FIG. 4B is the fluorescence labeling rate of comparative example, and FIG. 4C is the average fluorescence intensity of extracellular vesicles of example 2 and comparative example after proteinase K action for 24 hours;

FIG. 5 is the fluorescence labeling rate of example 2 and comparative example after 6 days of fluorescence labeling, wherein FIG. 5A is the fluorescence labeling rate of example 2 and FIG. 5B is the fluorescence labeling rate of comparative example;

fig. 6 is a transmission electron micrograph (morphological characterization) of extracellular vesicles, wherein fig. 6A is a transmission electron micrograph of example 2, fig. 6B is a transmission electron micrograph of a comparative example, and fig. 6C is a transmission electron micrograph of unlabeled extracellular vesicles;

FIG. 7 shows the Western blot identification of unlabeled extracellular vesicles, the fluorescently labeled extracellular vesicle marker proteins CD9 and CD81 obtained in example 2, and TSG101, where EVs represents the unlabeled extracellular vesicles, and AF488-EVs represents the fluorescently labeled extracellular vesicles obtained in example 2;

fig. 8 is a purity analysis of extracellular vesicles, wherein fig. 8A is a purity analysis of fluorescently-labeled extracellular vesicles obtained in example 2, and fig. 8B is a purity analysis of unlabeled extracellular vesicles;

fig. 9 is a graph of FSC-SSC scatter plots of unlabeled extracellular vesicles, fig. 9B is a flow histogram of unlabeled extracellular vesicles, fig. 9C is a graph of FSC-SSC scatter plots of fluorescently-labeled extracellular vesicles obtained in example 2, and fig. 9D is a flow histogram of fluorescently-labeled extracellular vesicles obtained in example 2, for the effect of uptake of extracellular vesicles by HeLa cells; wherein EVs represents unlabeled extracellular vesicles, and AF488-EVs represents the fluorescently-labeled extracellular vesicles obtained in example 2;

fig. 10 is a graph showing the effect of uptake of extracellular vesicles by 293T cells, in which fig. 10A is a FSC-SSC scattergram of unlabeled extracellular vesicles, fig. 10B is a flow histogram of unlabeled extracellular vesicles, fig. 10C is a FSC-SSC scattergram of fluorescence-labeled extracellular vesicles obtained in example 2, and fig. 10D is a flow histogram of fluorescence-labeled extracellular vesicles obtained in example 2; wherein EVs represents unlabeled extracellular vesicles, and AF488-EVs represents the fluorescently-labeled extracellular vesicles obtained in example 2;

fig. 11 is an imaging effect of extracellular vesicles in HeLa cells, wherein fig. 11A is an imaging picture of fluorescently-labeled extracellular vesicles obtained in example 2 in HeLa cells, and fig. 11B is an imaging picture of fluorescently-labeled extracellular vesicles obtained in comparative example in HeLa cells;

fig. 12 is an imaging effect of extracellular vesicles in 293T cells, wherein fig. 12A is an image of fluorescently-labeled extracellular vesicles obtained in example 2 in 293T cells, and fig. 12B is an image of fluorescently-labeled extracellular vesicles obtained in comparative example in 293T cells;

fig. 13 shows the modification efficiency and particle size distribution of extracellular vesicles modified with doxorubicin, wherein fig. 13A shows the modification efficiency of example 11, fig. 13B shows the modification efficiency of unmodified extracellular vesicles, fig. 13C shows the particle size distribution of example 11, and fig. 13D shows the particle size distribution of unmodified extracellular vesicles;

fig. 14 is a transmission electron microscope image (morphological characterization) of extracellular vesicles with doxorubicin as a modification, wherein fig. 14A is a transmission electron microscope image of example 11, and fig. 14B is a transmission electron microscope image of unmodified extracellular vesicles;

fig. 15 is a flow histogram of an unmodified extracellular vesicle, fig. 15B is a flow histogram of an extracellular vesicle with doxorubicin as a modification obtained in example 11, fig. 15C is an image of an unmodified extracellular vesicle in U251 cell, and fig. 15D is an image of an extracellular vesicle with doxorubicin as a modification obtained in example 11 in U251 cell; wherein EVs represent unmodified extracellular vesicles, DOX-EVs represent extracellular vesicles in which the modification obtained in example 11 was doxorubicin;

fig. 16 shows the cytotoxicity of doxorubicin and doxorubicin-modified extracellular vesicles on U251 cells at different concentrations; wherein DOX represents doxorubicin, DOX-EVs represents the extracellular vesicle in which the modification obtained in example 11 was doxorubicin;

fig. 17 shows the modification efficiency and particle size distribution of extracellular vesicles modified with streptavidin molecules conjugated with fluorescent probes, where fig. 17A shows the modification efficiency of example 16, fig. 17B shows the modification efficiency of unmodified extracellular vesicles, fig. 17C shows the particle size distribution of example 16, and fig. 17D shows the particle size distribution of unmodified extracellular vesicles;

fig. 18 is a transmission electron microscope image (morphological characterization) of an extracellular vesicle using a streptavidin molecule coupled with a fluorescent probe as a modifier, wherein fig. 18A is the transmission electron microscope image of example 16, and fig. 18B is the transmission electron microscope image of an unmodified extracellular vesicle;

fig. 19 is a graph showing the effect of uptake by 293T cells of extracellular vesicles using streptavidin molecules coupled with fluorescent probes as modifiers and the effect of imaging in 293T cells, where fig. 19A is a flow histogram of unmodified extracellular vesicles, fig. 19B is a flow histogram of extracellular vesicles using streptavidin molecules coupled with fluorescent probes obtained in example 16, fig. 19C is an image of unmodified extracellular vesicles in 293T cells, and fig. 19D is an image of extracellular vesicles using streptavidin molecules coupled with fluorescent probes obtained in example 16 in 293T cells; wherein EVs represents an unmodified extracellular vesicle, and SA-EVs represents an extracellular vesicle in which the modification obtained in example 16 is a streptavidin molecule conjugated with a fluorescent probe;

FIG. 20 shows the modification efficiency and particle size distribution of extracellular vesicles using oligonucleotide molecules coupled with fluorescent probes as modifications, where FIG. 20A shows the modification efficiency of example 20, FIG. 20B shows the modification efficiency of unmodified extracellular vesicles, FIG. 20C shows the particle size distribution of example 20, and FIG. 20D shows the particle size distribution of unmodified extracellular vesicles;

fig. 21 is a transmission electron microscope image (morphological characterization) of an extracellular vesicle with an oligonucleotide molecule coupled with a fluorescent probe as a modifier, wherein fig. 21A is the transmission electron microscope image of example 20, and fig. 21B is the transmission electron microscope image of an unmodified extracellular vesicle;

fig. 22 is an effect of SH-SY5Y cell uptake and imaging in SH-SY5Y cell of extracellular vesicles using oligonucleotide molecules coupled with fluorescent probes as modifiers, wherein fig. 22A is a flow histogram of unmodified extracellular vesicles, fig. 22B is a flow histogram of extracellular vesicles of oligonucleotide molecules coupled with fluorescent probes obtained in example 20, fig. 22C is an image of unmodified extracellular vesicles in SH-SY5Y cell, and fig. 22D is an image of extracellular vesicles of oligonucleotide molecules coupled with fluorescent probes obtained in example 20 in SH-SY5Y cell; wherein EVs represents an unmodified extracellular vesicle, and ASO-EVs represents an extracellular vesicle in which the modification obtained in example 20 is an oligonucleotide molecule coupled with a fluorescent probe;

FIG. 23 illustrates the molecular structure of the active principle of the modifying agent prepared in certain embodiments;

FIG. 24 is a molecular structure of an effective component of the modifying agent in example 16;

FIG. 25 illustrates the molecular structure of an active principle of a modifying agent prepared in accordance with certain embodiments;

FIG. 26 is a molecular structure of an active ingredient of the modification reagent in example 17.

Detailed Description

The invention discloses a preparation method of a reagent for modifying extracellular vesicles, wherein azide modification modifier is chemically coupled with carboxyl-activated diphenylcyclooctynoic acid by clicking to form the reagent for modifying extracellular vesicles; the prepared reagent for modifying the extracellular vesicles can be efficiently and stably connected to the extracellular vesicles after being incubated with the extracellular vesicles. In the marking behavior of the extracellular vesicles, the extracellular vesicles can be stably, efficiently and controllably marked; even when extracellular vesicles are used as the carrier, efficient and stable loading can be achieved.

Activating carboxyl of diphenylcyclooctyne acid by using a cross-linking agent consisting of carbodiimide and N-hydroxysuccinimide (NHS) to obtain diphenylcyclooctyne succinimide ester; the molar ratio of carbodiimide to N-hydroxysuccinimide to diphenylcyclooctynoic acid is 1-1.1:1-1.3:1; preferably 1:1:1; the carbodiimide is Dicyclohexylcarbodiimide (DCC) or 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC & HCl); EDC & HCl is preferred; the structure of the dibenzocyclooctynoic acid is shown as a formula 1;

formula 1;

wherein n is an even number.

The structure of the prepared reagent for modifying the extracellular vesicles is shown in formula 2;

formula 2;

Modifying the extracellular vesicles by using an extracellular vesicle modifying reagent, and mixing and incubating the compound shown in the formula 2 and the extracellular vesicles to obtain the modified extracellular vesicles.

In some embodiments of the invention, the modifier is a small molecule compound or a large molecule compound; the small molecule compound can be a fluorescent probe or a chemical drug; the macromolecular compound can be a nucleic acid fragment, such as an oligonucleotide with a sequence from 5 'end to 3' end being GTGTGTCTCCAATGCCTGCTTTCTTCAG, or a polypeptide or protein molecule, such as streptavidin.

The modifier may be a fluorescent probe. In one embodiment of the invention, the modifier is a fluorescent probe micromolecular compound, and the azide-modified fluorescent probe is rhodamine 110-azide or TAMRA-azide; the molar ratio of the azide-modified fluorescent probe to the dibenzocyclooctyne succinimide ester is 1; the structure of the prepared product is shown as a formula 3;

formula 3;

wherein m is more than or equal to 3 and m is an integer, n is less than or equal to 14 and n is an even number, R ₁ Is hydroxy, amino or dimethylamino, R ₂ Is oxygen atom, amino or dimethylamino.

When the compound of formula 3 modifies the extracellular vesicles, co-culturing the compound of formula 3 and the extracellular vesicles, wherein the amount of the compound of formula 3 is 7-10 nmol, preferably 7 nmol, based on 200 μ g protein/150 μ L PBS of extracellular vesicles; the incubation condition is that ultrapure water, normal saline or PBS buffer solution is used as solvent, and the reaction is carried out for 0.5-1 h at 25-37 ℃. Obtaining the fluorescent-labeled extracellular vesicles, wherein the structure of the extracellular vesicle-fluorescent probe conjugate is shown in figure 2. During the reaction, the temperature is preferably 25 ℃, the solvent is preferably PBS buffer, and the reaction time is preferably 0.5h.

After the preparation of the fluorescent-labeled extracellular vesicles, carrying out centrifugal separation and purification through a 100 kD ultrafiltration tube (millipore, UFC 910096), wherein the centrifugal conditions are 20-25 ℃,10000-12000 g are centrifuged for 50-100 min; the centrifugation temperature is preferably 25 ℃, the centrifugation speed is preferably 10000 g, and the centrifugation time is preferably 60min.

The modifier can be a small molecule chemical drug. In one embodiment of the invention, the modifier is a Doxorubicin (DOX) small molecule compound, and the azide-modified doxorubicin is doxorubicin azide; the molar ratio of the azide-modified doxorubicin to the dibenzocyclooctyne succinimide ester is 1; the structure of the prepared product is shown as a formula 4;

and (4) formula 4.

Experiments show that the extracellular vesicle-fluorescent probe conjugate obtained by the extracellular vesicle fluorescent labeling method can be phagocytized by various cells including tumor cells and endothelial cells. When the modifier is a drug, the modifier can also specifically act on tumor cells.

The modifier may be a protein of a macromolecule. In one embodiment of the invention, the modifier is a protein macromolecular compound coupled with a fluorescent probe, and the azide-modified protein macromolecular compound is azide streptavidin; the nitridized streptavidin is coupled with rhodamine 110; the molar ratio of the azide-modified streptavidin to the dibenzocyclooctyne succinimide ester is 1; the structure of the prepared product is shown in figure 23, wherein n is less than or equal to 14 and n is an even number.

The modification may be a nucleic acid fragment. In one embodiment of the invention, the modifier is a nucleic acid fragment macromolecular compound coupled with a fluorescent probe, and the nucleic acid fragment macromolecular compound modified by azide is an azide oligonucleotide; the azido oligonucleotide is coupled with rhodamine 110, and the nucleic acid sequence of the azido oligonucleotide is GTGTGTCTCCAATGCCTGCTTTCTTCAG from the 5 'end to the 3' end; the molar ratio of the azide-modified oligonucleotide to the dibenzocyclooctyne succinimide ester is 1; the structure of the prepared product is shown in figure 25, wherein n is less than or equal to 14 and n is an even number.

The extracellular vesicles are derived from milk, blood, urine or stem cells, wherein the stem cells comprise one or more of umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells, bone marrow mesenchymal stem cells and placenta mesenchymal stem cells. In certain embodiments of the invention, the labelling effect is optimal when the extracellular vesicles are of milk origin. Compared with stem cells and other extracellular vesicles from other sources, the extracellular vesicles prepared from the milk with low cost have the advantages of simple preparation process, high yield and high purity, and are particularly suitable for in-vivo and in-vitro tracing research and tracing drug development of the extracellular vesicles.

According to the invention, by utilizing the advantages of sensitive, rapid and efficient click chemistry reaction, simplicity and convenience in operation and the like, the azide-modified modifier is coupled with the carboxyl-activated dibenzocyclooctynoic acid (micromolecule Linker), and the reagent for modifying the extracellular vesicles, which simultaneously has functional groups and active ester groups, is prepared. And the reagent for modifying the extracellular vesicles realizes stable, efficient and controllable modification of the extracellular vesicles under the conditions of not changing the morphology and the structural composition of the extracellular vesicles and not influencing the biological functions of the extracellular vesicles. Taking a modifier as an example of the fluorescent probe, in the preparation of the fluorescent labeling reagent, the azide of the fluorescent probe and the diphenylcyclooctyne are subjected to click chemical reaction, so that the fluorescent labeling reagent belongs to azide-cycloalkyne cycloaddition click coupling (SPAAC) without metal catalysis. Compared with the traditional copper ion catalyzed click coupling (CuAAC), the SPAAC can complete coupling marking more efficiently and sensitively. And copper ions do not participate in catalysis, so that the denaturation and toxicity of extracellular vesicle protein possibly caused by heavy metal are avoided. In addition, the fluorescent probe used for labeling is not limited to a structure other than an azide group, and may be a fluorescent probe having any structure, and therefore the types of fluorescent probes used for labeling extracellular vesicles in the present invention are expanded.

The following describes the scheme of the present invention with reference to the accompanying drawings, wherein experimental methods without specific description of operation steps are all performed according to corresponding commercial specifications, and instruments, reagents and consumables used in the examples can be purchased from commercial companies if no special description is provided. The experimental methods in the examples of the present invention are all conventional methods unless otherwise specified; the quantitative test results in the examples are average values of three parallel repeated test results.

Example 1:

fresh milk is separated and purified through processes of acid precipitation (pH 4.0), ultracentrifugation, column chromatography and the like in sequence to obtain the extracellular vesicles derived from the milk, the particle size distribution of the extracellular vesicles derived from the milk is represented through a nano-flow detection technology, the morphology of the extracellular vesicles is observed through a transmission electron microscope, the marker protein of the extracellular vesicles is detected through Western blot, and the purity of the extracellular vesicles is detected through ultrahigh liquid phase-molecular exclusion chromatography, and the results are respectively shown in fig. 3E, fig. 6C, fig. 7 and fig. 8B.

Example 2: preparation of fluorescent labeling reagent

EDC & HCl (5.8 mg, 30. Mu. Mol, 1.0 eq.) was mixed with NHS (3.5 mg, 30. Mu. Mol, 1.0 eq.) and DMSO (832. Mu.L) was added to prepare 36.1 mM activated crosslinker. Adding diphenyl cyclooctyne adipic acid (10 mg, 30 mu mol, 1.0 eq.) into an activating crosslinking agent, fully and uniformly mixing at room temperature, and activating carboxyl to obtain diphenyl cyclooctyne succinimide ester.

The fluorescent probe azide fluoride 488 (1 mg, 1.74. Mu. Mol) was dissolved in DMSO (205. Mu.L) to prepare 8.5 mM azide fluoride 488 fluorescent dye. 168. Mu.L of azide fluorine 488 fluorescence dye (1.428. Mu. Mol) is added into dibenzocyclooctyne succinimide ester, and after fully mixing at room temperature, the prepared dibenzocyclooctyne succinimide ester fluorescence labeling reagent (1 mL) with the effective component of fluorescence probe azide fluorine 488 is coupled is stored at 2-8 ℃.

mu.L of the fluorescent labeling reagent and 150. Mu.L of the milk-derived extracellular vesicles (containing 200. Mu.g of protein) prepared in example 1 were thoroughly mixed at room temperature, and 45. Mu.L of PBS buffer was added thereto to carry out a reaction for 0.5 hour, thereby completing the fluorescent labeling of the milk-derived extracellular vesicles. The final concentration of extracellular vesicles in the examples was 1000. Mu.g/mL protein.

The mixture of the above examples was transferred to a 100 kD ultrafiltration tube (millipore, UFC 910096), filled with PBS buffer, and centrifuged at 10000 g continuously for 4 times at 25 ℃ for 60min (15 min for each centrifugation), and then the small molecule compounds in the reaction system were separated and removed to obtain purified fluorescent probe azide-fluorine 488-labeled milk-derived extracellular vesicles.

The azide fluoride 488-labeled milk-derived extracellular vesicles obtained in the examples were resuspended in 200. Mu.L of PBS buffer and stored in a-80 ℃ freezer for use.

The scheme for preparing the azide fluoride 488-labeled milk-derived extracellular vesicles obtained in the example and the fluorescence labeling reagent are shown in fig. 1.

The molecular structure of the effective component of the fluorescence labeling reagent is shown as a formula 3;

and (3) formula.

Comparative example:

mu.L of dibenzocyclooctyne succinimidyl ester DBCO-NHS (containing dibenzocyclooctynoic acid structure n =2, 10 mg/mL, lumiprobe) was added to 200. Mu.L of extracellular vesicle suspension (particle size 2.8X 10) ¹² in/mL), protected from light at room temperatureIncubate for 1 h. Then 3.8. Mu.L of the azide fluorescent probe Alexa Fluor was added ^TM 488 after azide (5 mg/mL, life Technologies) was added to the extracellular vesicle suspension prepared in example 1, it was incubated for 4 hours at room temperature in the dark. The molar ratio of extracellular vesicles, DBCO-NHS and fluorescent probes in the system is 1:400:400.

the mixture of the above comparative examples was transferred to a 100 kD ultrafiltration tube (Nanosep) ^® 300 K, pall Life Sciences) filled with PBS buffer solution, continuously centrifuging for 3 times at 14000 g speed for 15 min (5 min each time) at 4 ℃, separating and removing unconjugated fluorescent probe in the reaction system to obtain a purified fluorescent probe Alexa Fluor ^TM 488 azide-labeled extracellular vesicles.

Alexa Fluor obtained in comparative example was resuspended in 200. Mu.L PBS ^TM 488 The azide-labeled extracellular vesicles were stored in a freezer at-80 ℃ until use.

Example 3: application of nano-flow detection technology to characterize fluorescence labeling rate and particle size distribution of extracellular vesicles

The extracellular vesicles labeled by the fluorescent molecules in example 2 and the comparative example are diluted by 1000 times with PBS respectively, monodisperse Nano fluorescent silica spheres with the particle size of 250 +/-5 nm are selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with the particle size of 68 +/-2 nm,91 +/-3 nm,113 +/-3 nm and 155 +/-3 nm are selected for particle size standard of the Nano flow detector, and the fluorescence labeling rate of at least 5000 extracellular vesicles in example 2 and the comparative example is detected by Nano flow cytometry (NanoFCM) respectively.

Detection conditions are as follows: 488 The detection channels of the nm laser are respectively a scattering channel and an FITC fluorescence channel, the attenuation coefficient is 10%, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

150 mu L of milk-derived extracellular vesicle (containing 200 mu g of protein) stock solution is diluted by 1000 times by PBS, 250 +/-5 nm of monodisperse Nano fluorescent silica spheres are selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with the particle diameters of 68 +/-2 nm,91 +/-3 nm,113 +/-3 nm and 155 +/-3 nm are selected for particle diameter standard of the Nano flow detector, and the particle diameters of the fluorescence-labeled extracellular vesicles and the unlabeled extracellular vesicles are respectively detected by Nano flow cytometry (NanoFCM). Detection conditions are as follows: the detection channel is a scattering channel, the attenuation coefficient is 10%, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

As shown in fig. 3A, the fluorescence labeling rate of the extracellular vesicles obtained in example 2 was 97.1%; as shown in fig. 3B, the labeling rate of the extracellular vesicles obtained by the comparative example was 19.8%. It is demonstrated that the rate of fluorescence labeling of the extracellular vesicles obtained in example 2 is much higher than that of the comparative example. In fig. 3C, the fluorescence labeling rate of the latex microspheres (latex microbeads) coupled in the comparative example is 99.9% as detected by flow cytometry, but the number of extracellular vesicles coupled to a single microsphere cannot be known, so that the fluorescence labeling signal of the latex microspheres in the comparative example can only be represented, and the fluorescence labeling rate of the extracellular vesicles cannot be intuitively reflected. As shown in fig. 3D, the average particle size of the extracellular vesicles obtained in example 2 was 77.92 nm; as shown in fig. 3E, the mean particle size of unlabeled extracellular vesicles was 72.99 nm. It is demonstrated that the average particle size of the extracellular vesicles obtained in example 2 was slightly increased, but not significantly changed, compared to the unlabeled extracellular vesicles.

mu.L of proteinase K (20 mg/mL, molecular weight 29.3 kD) was added to 200. Mu.L of each of the fluorescently labeled extracellular vesicles obtained in example 2 and 200. Mu.L of the fluorescently labeled extracellular vesicles obtained in comparative example, and the mixture was mixed well and incubated at 37 ℃ for 24 hours. The mixture of the product of example 2/the product of comparative example was transferred to a 100 kD ultrafiltration tube (millipore, UFC 910096), filled with PBS buffer, and centrifuged at 10000 g continuously for 4 times at 25 ℃ for 60min (15 min for each centrifugation), and then proteinase K and dissociated fluorescent probe molecules in the reaction system were separated and removed. The fluorescence labeling rate of the extracellular vesicles in the purified product of example 2/the product of comparative example was measured by Nano flow cytometry (Nano fcm), respectively.

As shown in fig. 4A, the fluorescence labeling rate of example 2 after 24 hours of proteinase K was 96.0%, which did not change significantly from that before the action (97.1%, fig. 3A); as shown in FIG. 4B, the fluorescence labeling rate of the comparative example decreased to 8.3% after 24 hours of proteinase K. The fluorescent labeling method of example 2 is capable of selectively labeling extracellular vesicle membrane lipid molecules, and is not strongly labeled for membrane proteins, and thus is not sensitive to proteinase K. In contrast, the fluorescence labeling method of the comparative example is more likely to label the membrane protein, and thus the fluorescence labeling rate decreases after hydrolysis by proteinase K. As shown in FIG. 4C, the mean fluorescence intensity of the extracellular vesicles in example 2 after 24 hours of proteinase K was 9584.6, and the mean fluorescence intensity of the extracellular vesicles in comparative example was 1764.3, which is only 18.4% of the former.

After 6 days of fluorescent labeling, the fluorescent labeling rate of the extracellular vesicles in example 2 and comparative example was measured by Nano flow cytometry (Nano fcm), respectively.

As shown in fig. 5A, the fluorescence labeling rate of the extracellular vesicles in example 2 was 97.0% after 6 days of fluorescence labeling, and did not change significantly compared to that before 6 days (97.1%, fig. 3A); as shown in fig. 5B, the fluorescence labeling rate of the extracellular vesicles in the comparative example decreased to 10.8% after 6 days of fluorescence labeling. It is shown that the fluorescence labeling method of example 2 is more stable than the comparative example.

Example 4: transmission electron microscope for observing morphology of extracellular vesicles

The fluorescent-labeled extracellular vesicles obtained in example 2 and comparative example and unlabeled extracellular vesicles (200. Mu.g of protein/150. Mu.L of PBS) were diluted 10-fold with PBS, 10. Mu.L of each was mixed with the same volume of 4% Paraformaldehyde (PFA) and fixed, and then allowed to stand for 15 min. Dripping 15 μ L of sample on 200 mesh copper net, standing at room temperature for 3 min, and sucking off excessive liquid on the copper net with absorbent paper; dropwise adding a 2% uranyl acetate solution (15 mu L) onto a copper net of a sample, standing at room temperature for 1 min, carrying out negative dyeing on the sample, sucking excess liquid on the copper net with absorbent paper, observing the prepared sample under a Transmission Electron Microscope (TEM), and collecting pictures.

As shown in fig. 6A, the fluorescent-labeled extracellular vesicles obtained in example 2 were unchanged in morphology and had a cup-saucer-like vesicle structure, as compared with unlabeled extracellular vesicles (fig. 6C); in contrast, only part of the fluorescent-labeled extracellular vesicles obtained in the comparative example (fig. 6B) retained the saucer-like vesicle structure, and the rest underwent some morphological changes.

Example 5: detection of marker proteins CD9, CD81 and TSG101 of extracellular vesicles by Western blot

Protein sample preparation: respectively adding RIPA lysate into unlabeled extracellular vesicles and the fluorescence-labeled extracellular vesicles obtained in example 2 to lyse the extracellular vesicles, repeatedly blowing the vesicles, transferring the vesicles into a clean 1.5mL EP tube, lysing the vesicles on ice for 30 min, performing vortex oscillation once every 10 min, centrifuging the vesicles at 12000 rpm at 4 ℃ for 15 min, and transferring the supernatant into a new EP tube; measuring extracellular vesicle protein concentration by BCA method, adding 5 times of loading buffer solution into the rest protein solution, boiling in boiling water for 10 min, and storing in refrigerator at-80 deg.C.

Polyacrylamide gel electrophoresis: the clean glass plate is arranged on a glue making frame, the bottom edges of the glass plate are tightly matched, and the leakage is checked by using distilled water. Preparing 10% separating gel solution according to the separating gel formula, mixing well, adding 4.5ml separating gel solution into the gap of the glass plate by using a liquid transfer device, immediately and slowly adding distilled water to flatten the liquid surface of the separating gel, and solidifying the separating gel after about 20 min. Then preparing 5% concentrated glue solution according to the formula, pouring 1.5ml of concentrated glue solution above the separation glue, immediately inserting a comb, and waiting for the concentrated glue to solidify. Placing the prepared rubber plate in an electrophoresis tank, enabling the short glass plate to be inward, adding electrophoresis liquid between the two glass plates, taking out the comb, unifying the sample loading amount according to the measured protein concentration, adding a protein sample into a sample loading hole, adding the electrophoresis liquid to the mark position of the electrophoresis tank, starting electrophoresis at 90V, adjusting the voltage to 120V when bromophenol blue moves to the separation rubber position, and stopping electrophoresis until the bromophenol blue is close to the bottom of the glass plates.

Film transfer and sealing: placing polyacrylamide gel on one side of a black splint, shearing a PVDF membrane with a proper size, placing the PVDF membrane in methanol for activation for 60 s, placing the PVDF membrane on the gel, removing bubbles, clamping a membrane transferring clamp, placing the PVDF membrane in a membrane transferring groove, adding a membrane transferring liquid, and transferring the PVDF membrane for 2 h under the constant pressure of ice bath and 120V. The PVDF membrane after the membrane transfer was taken out, washed with TBST solution, placed in 5% skim milk (blocking solution), and blocked at room temperature for 1 hour at 100 rpm using a horizontal shaker.

Antibody hybridization: 1) Primary antibody incubation: diluting primary antibodies (CD 9, dilution ratio 1 1000, cd81, dilution ratio 1: 10000) with blocking solution according to the instructions, transferring 2 mL of the primary antibodies into an antibody incubation box, cutting off a target strip by a contrast protein Marker, soaking the target strip in the corresponding primary antibody, and incubating overnight at 4 ℃; 2) And (3) secondary antibody incubation: washing the target strip with TBST for 5 min, repeating for 3 times, adding corresponding secondary antibody, incubating at 100 rpm for 2 h with horizontal shaker at room temperature, washing with TBS for 5 min, and repeating for 3 times.

Luminescence detection: and (3) mixing the luminescent liquid A and the luminescent liquid B in equal proportion to prepare working liquid, dripping the luminescent liquid on the film in a dark room, and carrying out exposure, development and fixation when the target strip emits green fluorescence.

As shown in fig. 7, the expression levels of the marker proteins CD9, CD81 and TSG101 of the fluorescently labeled extracellular vesicles obtained in example 2 were substantially identical to those of the unlabeled extracellular vesicles.

Example 6: detection of the purity of extracellular vesicles by ultra high liquid-size exclusion chromatography

Unlabeled extracellular vesicles and the fluorescently labeled extracellular vesicles obtained in example 2 were each diluted 10-fold (at a concentration of at least 2X 10) with PBS ¹⁰ Number of particles/mL), extracellular vesicle purity was determined by ultra-high liquid phase-size exclusion chromatography (UPLC-SEC). Detection conditions are as follows: acclaim & lt & gt SEC-1000 LC chromatographic column (7 mu m,1000, 7.8 x 150 mM), 20 mM phosphate buffer solution (containing 150 mM NaCl) with pH7.2 as a mobile phase, flow rate of 0.3 mL/min, column temperature of 25 ℃, detection wavelength of 280 nm and sample injection amount of 25 mu L.

As shown in fig. 8A, the purity of the fluorescence-labeled extracellular vesicles obtained in example 2 was 90.68%; as shown in fig. 8B, the purity of the unlabeled extracellular vesicles was 96.38%. It is demonstrated that the purity of the fluorescence-labeled extracellular vesicles obtained in example 2 was substantially identical to that of the unlabeled extracellular vesicles.

In summary, the results of examples 2 to 6 demonstrate that the method for preparing fluorescently-labeled extracellular vesicles using a fluorescent probe as a modification according to the present invention has the advantages of higher fluorescence labeling rate, selective labeling of extracellular vesicle membrane lipid molecules, more stable fluorescence labeling effect, and better preservation of extracellular vesicle morphology, compared to the known methods for preparing fluorescently-labeled extracellular vesicles (comparative examples) in the literature. In addition, the method for preparing the fluorescence labeling extracellular vesicles by taking the fluorescent probe as the modifier does not obviously change the expression levels of the extracellular vesicle surface protein markers CD9, CD81 and TSG101, and can basically keep the purity of the extracellular vesicles.

Example 7: detection of the Effect of fluorescent-labeled extracellular vesicles taken up by human cervical carcinoma cells by flow cytometry

Culture of human cervical cancer cells (HeLa): in 24-well culture plates at 5X 10 ⁴ HeLa cells were seeded per well by adding 500. Mu.L of MEM complete medium (containing 10% FBS and 1% diabody) per well at 37 ℃ and 5% ₂ After culturing for 24 hours under the conditions, 50. Mu.L of unlabeled extracellular vesicles or the extracellular vesicles obtained in example 2 were added to each well, ensuring that the final concentration of extracellular vesicles per well was 50. Mu.g/mL, and after mixing well, CO was reduced at 37 ℃ and 5% ₂ Incubation was continued for 4 h under conditions.

Cell treatment before detection: after discarding the medium from each well of the 24-well plate, 500. Mu.L of PBS buffer was added to wash the cells. PBS was discarded, and after 200. Mu.L of trypsinized cells was added to each well for 3 min, digestion was terminated by adding 300. Mu.L of 10% FBS directly. The mixture was transferred to a 1.5mL EP tube and centrifuged at 350 g for 5 min. After discarding the supernatant, 1 mL of PBS was added to resuspend the cells, and the cells were centrifuged again at 350 g for 5 min. After discarding the supernatant, 200-400. Mu.L of PBS was added to resuspend the cells, which were then tested on the machine.

As shown in fig. 9, the fluorescently labeled extracellular vesicles obtained in example 2 were taken up by 84.02% of the population in HeLa cells.

Example 8: detection of the Effect of uptake of fluorescently-labeled extracellular vesicles by human Kidney epithelial cells by flow cytometry

Culture of human renal epithelial cells (293T): in 24-well plates at 5X 10 ⁴ 293T cells were plated per well with 500. Mu.L of DMEM complete medium (containing 10% FBS and 1% diabody) at 37 ℃ and 5% ₂ After culturing for 24 h under the conditions, 50. Mu.L of unlabeled extracellular vesicles are added to each wellOr the extracellular vesicles obtained in example 2, ensuring a final concentration of the extracellular vesicles per well of 50. Mu.g/mL, after mixing homogeneously, CO% at 37 ℃ and 5% ₂ Incubation was continued for 4 h under conditions.

Cell treatment before detection: after discarding the medium from each well of the 24-well plate, 500. Mu.L of PBS buffer was added to wash the cells. PBS was discarded, and after 200. Mu.L of trypsinized cells was added to each well for 3 min, digestion was terminated by adding 300. Mu.L of 10% FBS directly. The mixture was transferred to a 1.5mL EP tube and centrifuged at 350 g for 5 min. After discarding the supernatant, 1 mL of PBS was added to resuspend the cells, and the cells were centrifuged again at 350 g for 5 min. After discarding the supernatant, adding 200-400 μ L PBS to resuspend the cells, and detecting on a machine.

As shown in fig. 10, the fluorescently-labeled extracellular vesicles obtained in example 2 were taken up by 98.20% of the population in 293T cells.

Example 9: imaging of fluorescent-labeled extracellular vesicles in human cervical cancer cells by confocal laser microscopy

Culture of human cervical cancer cells (HeLa): heLa cells were cultured on cell crawlers in each well of a 24-well culture plate. Adding the fluorescent-labeled extracellular vesicles obtained in example 2 to each well when the degree of cell fusion is 70 to 80%, ensuring that the final concentration of the extracellular vesicles per well is 50. Mu.g/mL, mixing well, and then adding CO at 37 ℃ and 5% ₂ Incubation was continued for 24 h under these conditions. After discarding the medium, the cells were washed 3 times with PBS buffer, fixed for 10 min with 4% PFA, washed 3 times with PBS and then stained with DAPI, a nuclear fluorescent dye, for 15 min. After that, the cells were washed 3 more times with PBS, and the images of the fluorescence-labeled extracellular vesicles obtained in the examples in HeLa cells were observed under a confocal laser microscope. Detection conditions are as follows: ex =488 nm, em =520 to 550 nm.

The fluorescent-labeled extracellular vesicles obtained in the comparative example were co-cultured with HeLa cells for 24 hours in the same manner, and their intracellular imaging was observed under a laser confocal microscope.

As shown in fig. 11A, the fluorescently labeled extracellular vesicles obtained in example 2 were clearly visible in HeLa cells, whereas the extracellular vesicles obtained in comparative example (fig. 11B) were imaged weaker in HeLa cells than in example 2.

Example 10: observation of fluorescence-labeled extracellular vesicles in human renal epithelial cells by confocal laser microscopy

Culture of human renal epithelial cells (293T): 293T cells were cultured on cell crawlers in each well of a 24-well culture plate. When the cell fusion degree reaches 70 to 80 percent, the fluorescent-labeled extracellular vesicles obtained in example 2 are added into each hole, the final concentration of the extracellular vesicles in each hole is ensured to be 50 mu g/mL, and after the cells are uniformly mixed, the CO content is reduced at 37 ℃ and 5% ₂ Incubation was continued for 24 h under conditions. After discarding the medium, the cells were washed 3 times with PBS buffer, fixed for 10 min by adding 4% PFA, washed 3 times with PBS and then stained for 15 min with the nuclear fluorescent dye DAPI. After that, the cells were washed 3 more times with PBS, and the images of the fluorescence-labeled extracellular vesicles obtained in the examples in 293T cells were observed under a confocal laser microscope. Detection conditions are as follows: ex =488 nm, em =520 to 550 nm.

The fluorescent-labeled extracellular vesicles obtained in the comparative example were co-cultured with 293T cells for 24 hours in the same manner, and their intracellular imaging was observed under a confocal laser microscope.

As shown in fig. 12, the fluorescently labeled extracellular vesicles obtained in example 2 were clearly visible in 293T cells, whereas the extracellular vesicles obtained in comparative example (fig. 12B) were imaged weaker in 293T cells than in example 2.

It can be seen from examples 2-10 that the morphology of the fluorescent-labeled extracellular vesicles prepared by the present invention is unchanged, the protein expression level is consistent with that of the unmodified extracellular vesicles, and the fluorescent-labeled extracellular vesicles have high cellular uptake and good modification effects.

Example 11: preparation of doxorubicin modifying agent

EDC & HCl (5.8 mg, 30. Mu. Mol, 1.0 eq.) was mixed with NHS (3.5 mg, 30. Mu. Mol, 1.0 eq.) and DMSO (832. Mu.L) was added to make 36.1 mM activated crosslinker. Adding diphenyl cyclooctyne adipic acid (10 mg, 30 mu mol, 1.0 eq.) into an activating crosslinking agent, fully and uniformly mixing at room temperature, and activating carboxyl to obtain diphenyl cyclooctyne succinimide ester.

An 8.5 mM solution of doxorubicin azide derivative (1 mg, 1.53. Mu. Mol) was prepared in DMSO (180. Mu.L). 168. Mu.L of doxorubicin azide (1.428. Mu. Mol) was added to dibenzocyclooctyne succinimide ester, and after thoroughly mixing at room temperature, a modification reagent (1 mL) of dibenzocyclooctyne succinimide ester whose active ingredient was doxorubicin conjugated was prepared, and the resulting mixture was stored at 2 to 8 ℃.

mu.L of the modification reagent was mixed well with 150. Mu.L of the milk-derived extracellular vesicles (containing 200. Mu.g of protein) prepared in example 1 at room temperature, and 45. Mu.L of PBS buffer was added thereto to carry out a reaction for 0.5h, thereby completing the modification of the milk-derived extracellular vesicles. The final concentration of extracellular vesicles in the examples was 1000. Mu.g/mL protein.

The mixture of the above examples was transferred to a 100 kD ultrafiltration tube (millipore, UFC 910096), filled with PBS buffer, and centrifuged continuously at 10000 g for 4 times at 25 ℃ for 60min (15 min per centrifugation), and then the small molecule compounds in the reaction system were separated and removed to obtain purified doxorubicin-modified milk-derived extracellular vesicles.

The doxorubicin-modified milk-derived extracellular vesicles obtained in the examples were resuspended in 200. Mu.L of PBS buffer and stored in a-80 ℃ freezer for later use.

The molecular structure of the effective component of the modifying reagent is shown as a formula 4;

and (4) formula 4.

Example 12: characterization of modification efficiency and particle size distribution of extracellular vesicles by using nano-flow detection technology

The extracellular vesicles modified by doxorubicin in example 11 were diluted 1000 times with PBS, monodisperse nanoscopic fluorescent silica spheres of 250 ± 5 nm were selected for optical calibration and counting standard of a nanoflow detector, a group of nanoscopic spheres with particle sizes of 68 ± 2 nm,91 ± 3 nm,113 ± 3 nm, and 155 ± 3 nm were selected for particle size standard of a nanoflow detector, and the modification efficiency of at least 5000 extracellular vesicles in example 11 was detected by nanoflow cytometry (Nano fcm).

Detection conditions are as follows: 488 The detection channel of the nm laser is a scattering channel and an FITC fluorescence channel respectively, the attenuation coefficient is 10 percent, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

150 mu L of milk-derived extracellular vesicle (containing 200 mu g of protein) stock solution is diluted by 1000 times by PBS, 250 +/-5 nm of monodisperse Nano fluorescent silica spheres are selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with the particle diameters of 68 +/-2 nm,91 +/-3 nm,113 +/-3 nm and 155 +/-3 nm are selected for particle diameter standard of the Nano flow detector, and the particle diameters of doxorubicin-modified extracellular vesicles and unmodified extracellular vesicles are detected respectively by Nano flow cytometry (NanoFCM). Detection conditions are as follows: the detection channel is a scattering channel, the attenuation coefficient is 10%, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

As shown in fig. 13A, the doxorubicin modification efficiency of the extracellular vesicles obtained from example 11 was 90.9%; as shown in fig. 13B, the modification efficiency of the unmodified extracellular vesicles was 0.2%. Example 11 shows that extracellular vesicles with highly effective modified doxorubicin were obtained. As shown in fig. 13C, the average particle size of the extracellular vesicles obtained in example 11 was 76.22 nm; as shown in fig. 13D, the mean particle size of the unmodified extracellular vesicles was 73.90 nm. The average particle size of the extracellular vesicles obtained in example 11 was slightly increased compared to that of the unmodified extracellular vesicles, but was not significantly changed.

Example 13: transmission electron microscope for observing morphology of extracellular vesicles

The doxorubicin-modified extracellular vesicles obtained in example 11 and unmodified extracellular vesicles (200 μ g protein/150 μ L PBS) were each diluted 10-fold with PBS, 10 μ L each was mixed with the same volume of 4% Paraformaldehyde (PFA) and fixed, and then allowed to stand for 15 min. Dripping 15 μ L of sample on 200 mesh copper net, standing at room temperature for 3 min, and sucking off excessive liquid on the copper net with absorbent paper; dripping 2% uranyl acetate solution (15 mu L) on a copper mesh of a sample, standing for 1 min at room temperature, carrying out negative dyeing on the sample, sucking redundant liquid on the copper mesh by using absorbent paper, placing the prepared sample under a Transmission Electron Microscope (TEM) for observation, and collecting pictures.

As shown in fig. 14A, the doxorubicin-modified extracellular vesicle obtained in example 11 has an unchanged morphology and a more complete saucer-like vesicle structure, compared with the unmodified extracellular vesicle (fig. 14B).

Example 14: detecting the effect of taking the extracellular vesicles taking the doxorubicin as a modifier by human glioma cells through flow cytometry and laser confocal microscopy

Culture of human glioma cells (U251) for flow cytometry detection analysis: in 24-well plates at 5X 10 ⁴ Seed U251 cells per well, adding 500 μ L of MEM complete medium (containing 10% FBS and 1% diabody) per well, at 37 deg.C and 5% ₂ Adding 50. Mu.L of the unmodified extracellular vesicles or the doxorubicin-modified extracellular vesicles obtained in example 11 to each well after culturing for 24 hours under the conditions ensuring that the final concentration of the extracellular vesicles per well is 50. Mu.g/mL, mixing well, and then CO% ₂ Incubation was continued for 4 h under conditions.

Cell treatment before detection: after the medium was discarded from each well of the 24-well plate, 500. Mu.L of PBS buffer was added to wash the cells. PBS was discarded, and after 200. Mu.L of trypsinized cells was added to each well for 3 min, digestion was terminated by adding 300. Mu.L of 10% FBS directly. The mixture was transferred to a 1.5mL EP tube per well and centrifuged at 350 g for 5 min. After discarding the supernatant, 1 mL of PBS was added to resuspend the cells, and the cells were centrifuged again at 350 g for 5 min. After discarding the supernatant, 200-400. Mu.L of PBS was added to resuspend the cells, which were then tested on a machine.

As shown in fig. 15B, the doxorubicin-modified extracellular vesicles obtained in example 11 were taken up by 99.17% of the population in U251 cells compared to unmodified extracellular vesicles (fig. 15A).

Culture of human glioma cells (U251) for confocal laser microscopy: u251 cells were cultured on cell crawlers in each well of a 24-well culture plate. Adding unmodified extracellular vesicles or doxorubicin-modified extracellular vesicles obtained in example 11 into each hole when the cell fusion degree reaches 70-80%, ensuring that the final concentration of the extracellular vesicles in each hole is 50 μ g/mL, uniformly mixing, and then, adding CO at 37 ℃ and 5% ₂ Under the condition ofIncubation was continued for 24 h. After discarding the medium, the cells were washed 3 times with PBS buffer, fixed for 10 min with 4% PFA, washed 3 times with PBS and then stained with DAPI, a nuclear fluorescent dye, for 15 min. After that, the cells were washed 3 more times with PBS, and the imaging of the doxorubicin-modified extracellular vesicles obtained in example 11 in U251 cells was observed under a confocal laser microscope. Detection conditions are as follows: ex =488 nm, em =520 to 550 nm.

As shown in fig. 15D, the doxorubicin-modified extracellular vesicles obtained in example 11 were clearly visible in U251 cells, compared to the unmodified extracellular vesicles (fig. 15C).

Example 15: activity test of extracellular vesicles taking doxorubicin as modifier at cellular level

Example 14 it has been demonstrated that the doxorubicin-modified extracellular vesicles obtained in example 11 can be taken up by human glioma cells (U251), and therefore the cytotoxicity level of the doxorubicin-modified extracellular vesicles obtained in example 11 was evaluated by the thiazole blue (MTT) method in order to find application in the field of tumor therapy.

The MTT method is one of the methods commonly used in laboratories for detecting cell viability. The principle is that MTT can be reduced to water-insoluble blue-purple crystalline formazan by succinate dehydrogenase in mitochondria of living cells and deposited in the cells for color development, thereby detecting the survival state (cell vitality) of the cells. Seeding U251 cells at 3000/well in 96-well plates, using high-glucose DMEM medium (containing 10% FBS and 1% diabody) at 37 ℃ and 5% ₂ Culturing for 24 h under the condition. Thereafter, doxorubicin at various concentrations and the doxorubicin-modified extracellular vesicles obtained in example 11 were added to each well, mixed well, and then CO was concentrated at 37 ℃ and 5% ₂ Incubation was continued for 24 h under these conditions. After discarding the medium and washing 3 times with PBS buffer, 10. Mu.L of MTT reagent (5 mg/mL) was added to each well. After 4 h incubation, media was removed from each well and washed 2 times with PBS buffer, then 150 μ L of DMSO was added and the 96 well plate was rotated horizontally for 10 min to fully dissolve formazan. The absorbance of each well at 570nm was measured by a microplate reader, and doxorubicin and the doxorubicin-modified extracellular vesicle pair obtained in example 11 were calculated and evaluated by ratio using untreated cells as a negative reference groupEffect of U251 cell viability.

As shown in fig. 16, U251 cell viability decreased significantly as the doxorubicin-modified extracellular vesicle concentration obtained in example 11 increased. Compared with the effect of doxorubicin, the compound has stronger killing effect on glioma cells.

Example 16: preparation of streptavidin modification reagent

Streptavidin azide (120 mg, 1.80. Mu. Mol) conjugated with the fluorescent probe rhodamine 110 was dissolved in DMSO (214. Mu.L) to prepare an 8.5 mM streptavidin azide solution. 168. Mu.L of streptavidin azide (1.428. Mu. Mol) was added to dibenzocyclooctyne succinimide ester, and after thoroughly mixing at room temperature, a modification reagent (1 mL) of dibenzocyclooctyne succinimide ester with streptavidin coupled as an active ingredient was prepared, and the resulting mixture was stored at-20 ℃.

The mixture of the above examples was transferred to a 100 kD ultrafiltration tube (millipore, UFC 910096), filled with PBS buffer, and centrifuged at 10000 g continuously for 4 times at 25 ℃ for 60min (15 min for each centrifugation), and then free streptavidin molecules and small molecule compounds in the reaction system were separated and removed to obtain purified streptavidin-modified milk-derived extracellular vesicles.

Streptavidin-modified milk-derived extracellular vesicles obtained in the examples were resuspended in 200. Mu.L of PBS buffer and stored in a freezer at-80 ℃ until use.

The molecular structure of the active ingredient of the modifying agent is shown in FIG. 24.

Example 17: characterization of modification efficiency and particle size distribution of extracellular vesicles by using nano-flow detection technology

The extracellular vesicles modified by streptavidin in example 16 were diluted 1000 times with PBS, monodisperse Nano fluorescent silica spheres of 250 ± 5 nm were selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with particle sizes of 68 ± 2 nm,91 ± 3 nm,113 ± 3 nm, and 155 ± 3 nm were selected for particle size standard of a Nano flow detector, and the modification efficiency of at least 5000 extracellular vesicles in example 16 was detected by Nano flow cytometry (Nano fcm).

150 mu L of extracellular vesicle (containing 200 mu g of protein) stock solution from milk is diluted by 1000 times by PBS, 250 +/-5 nm of monodisperse Nano fluorescent silica spheres are selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with the particle diameters of 68 +/-2 nm,91 +/-3 nm,113 +/-3 nm and 155 +/-3 nm are selected for particle diameter standard of the Nano flow detector, and the particle diameters of streptavidin modified extracellular vesicles coupled with fluorescence probe rhodamine 110 and unmodified extracellular vesicles are respectively detected by Nano flow cytometry (NanoFCM). Detection conditions are as follows: the detection channel is a scattering channel, the attenuation coefficient is 10%, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

As shown in fig. 17A, the streptavidin modification efficiency of the extracellular vesicles obtained from example 16 was 78.5%; as shown in fig. 17B, the modification efficiency of the unmodified extracellular vesicles was 0.9%. Example 16 demonstrates the production of extracellular vesicles that are highly effective in modifying streptavidin. As shown in fig. 17C, the average particle size of the extracellular vesicles obtained in example 16 was 80.35 nm; as shown in fig. 17D, the mean particle size of the unmodified extracellular vesicles was 75.88 nm. It is demonstrated that the average particle size of the extracellular vesicles obtained in example 16 was slightly increased, but not significantly changed, compared to the unmodified extracellular vesicles.

Example 18: transmission electron microscope for observing morphology of extracellular vesicles

The streptavidin-modified extracellular vesicles obtained in example 16 and unmodified extracellular vesicles (200. Mu.g protein/150. Mu.L PBS) were diluted 10-fold with PBS, 10. Mu.L of each was mixed with the same volume of 4% Paraformaldehyde (PFA) and fixed, and then allowed to stand for 15 min. Dripping 15 μ L of sample on 200 mesh copper net, standing at room temperature for 3 min, and sucking off excessive liquid on the copper net with absorbent paper; dropwise adding a 2% uranyl acetate solution (15 mu L) onto a copper net of a sample, standing at room temperature for 1 min, carrying out negative dyeing on the sample, sucking excess liquid on the copper net with absorbent paper, observing the prepared sample under a Transmission Electron Microscope (TEM), and collecting pictures.

As shown in fig. 18A, the streptavidin-modified extracellular vesicles obtained in example 16 have a morphology that is unchanged from that of unmodified extracellular vesicles (fig. 18B), and the morphology is a more complete saucer-like vesicle structure.

Example 19: detecting the effect of the outer vesicle taking streptavidin as modifier taken by human kidney epithelial cells by flow cytometry and laser confocal microscopy

Culture of human renal epithelial cells (293T) for flow cytometry detection analysis: in 24-well culture plates at 5X 10 ⁴ 293T cells were seeded per well in 500. Mu.L of DMEM complete medium (10% FBS and 1% diabody) at 37 ℃ and 5% CO ₂ After culturing for 24 h under the conditions, 50. Mu.L of unmodified extracellular vesicles or streptavidin-modified extracellular vesicles obtained in example 16 were added to each well, ensuring that the final concentration of extracellular vesicles per well was 50. Mu.g/mL, and after mixing well, the ratio of CO was reduced at 37 ℃ and 5% ₂ Incubation was continued for 4 h under conditions.

As shown in fig. 19B, the streptavidin-modified extracellular vesicles obtained in example 16 were taken up by 98.51% of the population in 293T cells compared to unmodified extracellular vesicles (fig. 19A).

Culture of human renal epithelial cells (293T) for confocal laser microscopy: 293T cells were cultured on cell crawlers in each well of a 24-well culture plate. Adding unmodified extracellular vesicles or the streptavidin-modified extracellular vesicles obtained in example 16 into each hole when the cell fusion degree reaches 70-80%, ensuring that the final concentration of the extracellular vesicles in each hole is 50 μ g/mL, uniformly mixing, and then adding CO at 37 ℃ and 5% ₂ Incubation was continued for 24 h under conditions. After discarding the medium, the cells were washed 3 times with PBS buffer, fixed for 10 min with 4% PFA, washed 3 times with PBS and then stained with DAPI, a nuclear fluorescent dye, for 15 min. After that, the cells were washed 3 times with PBS, and the streptavidin-modified extracellular vesicles obtained in example 16 were imaged in 293T cells under a confocal laser microscope. Detection conditions are as follows: ex =488 nm, em =520 to 550 nm.

As shown in fig. 19D, the streptavidin-modified extracellular vesicles obtained in example 16 were clearly visible in 293T cells, compared to unmodified extracellular vesicles (fig. 19C).

Example 20: preparation of oligonucleotide modifying reagents

An 8.5 mM azido oligonucleotide solution was prepared by dissolving azido oligonucleotide (15 mg, 1.78. Mu. Mol) coupled with the fluorescent probe rhodamine 110 in DMSO (209. Mu.L). 168 mu L of azido oligonucleotide (1.428 mu mol) is added into dibenzocyclooctyne succinimide ester, and the obtained mixture is fully mixed at room temperature to prepare a modification reagent (1 mL) of dibenzocyclooctyne succinimide ester with an effective component coupled with oligonucleotide, and the modified reagent is placed at the temperature of minus 20 ℃ for storage.

mu.L of the modification reagent was thoroughly mixed with 150. Mu.L of the milk-derived extracellular vesicles (containing 200. Mu.g of protein) prepared in example 1 at room temperature, and 45. Mu.L of PBS buffer was added thereto to carry out a reaction for 0.5 hour, thereby completing the modification of the milk-derived extracellular vesicles. The final concentration of extracellular vesicles in the examples was 1000. Mu.g/mL protein.

The mixture of the above examples was transferred to a 100 kD ultrafiltration tube (millipore, UFC 910096), filled with PBS buffer, and centrifuged continuously at 10000 g for 4 times at 25 ℃ for 60min (15 min for each centrifugation), and then free oligonucleotide molecules and small molecule compounds in the reaction system were separated and removed to obtain purified oligonucleotide-modified milk-derived extracellular vesicles.

The oligonucleotide-modified milk-derived extracellular vesicles obtained in example were resuspended in 200. Mu.L of PBS buffer and stored in a freezer at-80 ℃.

The molecular structure of the active ingredient of the modifying reagent is shown in FIG. 26.

Example 21: characterization of modification efficiency and particle size distribution of extracellular vesicles by using nanoflow detection technology

The oligonucleotide-modified extracellular vesicles of example 20 were diluted 1000 times with PBS, monodisperse Nano fluorescent silica spheres of 250 ± 5 nm were selected for optical calibration and counting standard of the Nano flow detector, a group of Nano silica spheres with particle sizes of 68 ± 2 nm,91 ± 3 nm,113 ± 3 nm, and 155 ± 3 nm were selected for particle size standard of the Nano flow detector, and the modification efficiency of at least 5000 extracellular vesicles of example 20 was detected by Nano flow cytometry (Nano fcm).

150 mu L of extracellular vesicle (containing 200 mu g of protein) stock solution from milk source is diluted by 1000 times by PBS, 250 +/-5 nm of monodisperse Nano fluorescent silica spheres are selected for optical calibration and counting standard of a Nano flow detector, a group of Nano silica spheres with the particle diameters of 68 +/-2 nm,91 +/-3 nm,113 +/-3 nm and 155 +/-3 nm are selected for particle diameter standard of the Nano flow detector, and the particle diameters of the oligonucleotide-modified extracellular vesicle coupled with the fluorescent probe rhodamine 110 and the unmodified extracellular vesicle are respectively detected by Nano flow detection technology (NanoFCM). Detection conditions are as follows: the detection channel is a scattering channel, the attenuation coefficient is 10%, the sample introduction pressure is 1.0kPa, and the sample introduction speed is 25.10 nL/min.

As shown in fig. 20A, the oligonucleotide modification efficiency of the extracellular vesicles obtained in example 20 was 81.0%; as shown in fig. 20B, the modification efficiency of the unmodified extracellular vesicles was 0.8%. Explanation example 20 extracellular vesicles were obtained which were highly efficient modified oligonucleotides. As shown in fig. 20C, the average particle size of the extracellular vesicles obtained in example 20 was 80.90 nm; as shown in fig. 20D, the average particle size of the unmodified extracellular vesicles was 78.69 nm. It is demonstrated that the average particle size of the extracellular vesicles obtained in example 20 was slightly increased, but not significantly changed, compared to the unmodified extracellular vesicles.

Example 22: morphology of extracellular vesicles observed by transmission electron microscopy

The oligonucleotide-modified extracellular vesicles obtained in example 20 and unmodified extracellular vesicles (200. Mu.g of protein/150. Mu.L of PBS) were diluted 10-fold with PBS, and 10. Mu.L of each was mixed with the same volume of 4% Paraformaldehyde (PFA) and fixed, followed by standing for 15 min. Dripping 15 μ L of sample on 200 mesh copper net, standing at room temperature for 3 min, and sucking off excessive liquid on the copper net with absorbent paper; dropwise adding a 2% uranyl acetate solution (15 mu L) onto a copper net of a sample, standing at room temperature for 1 min, carrying out negative dyeing on the sample, sucking excess liquid on the copper net with absorbent paper, observing the prepared sample under a Transmission Electron Microscope (TEM), and collecting pictures.

As shown in fig. 21A, the oligonucleotide-modified extracellular vesicles obtained in example 20 had a morphology that was unchanged and a more complete saucer-like vesicle structure than the unmodified extracellular vesicles (fig. 21B).

Example 23: detecting the effect of the extracellular vesicles taking the oligonucleotides as the modifier taken by the human neuroblastoma cells through flow cytometry and laser confocal microscopy

Culture of human neuroblastoma cells (SH-SY 5Y) for flow cytometry detection analysis: in 24-well culture plates at 5X 10 ⁴ SH-SY5Y cells were seeded per well by adding 500. Mu.L of MEM/F12 complete medium (containing 15% FBS and 1% double antibody) per well and by CO-reduction at 37 ℃ and 5% ₂ Adding 50. Mu.L of the unmodified extracellular vesicles or the oligonucleotide-modified extracellular vesicles obtained in example 20 to each well after culturing for 24 hours under the conditions ensuring that the final concentration of the extracellular vesicles per well is 50. Mu.g/mL, mixing well, and then CO% ₂ Incubation was continued for 4 h under conditions.

Cell treatment before detection: after the medium was discarded from each well of the 24-well plate, 500. Mu.L of PBS buffer was added to wash the cells. PBS was discarded, and after 200. Mu.L of trypsinized cells was added to each well for 3 min, digestion was terminated by adding 300. Mu.L of 10% FBS directly. The mixture was transferred to a 1.5mL EP tube per well and centrifuged at 350 g for 5 min. After discarding the supernatant, 1 mL of PBS was added to resuspend the cells, and the cells were centrifuged again at 350 g for 5 min. After discarding the supernatant, 200-400. Mu.L of PBS was added to resuspend the cells, which were then tested on the machine.

As shown in fig. 22B, the oligonucleotide-modified extracellular vesicles obtained in example 20 were taken up by 100.00% of the population in SH-SY5Y cells compared to unmodified extracellular vesicles (fig. 22A).

Culture of human neuroblastoma cells (SH-SY 5Y) for confocal laser microscopy: SH-SY5Y cells were cultured on cell crawlers in each well of a 24-well culture plate. When the cell fusion degree reaches 70 to 80 percent, adding unmodified extracellular vesicles or the oligonucleotide-modified extracellular vesicles obtained in example 20 into each hole, ensuring that the final concentration of the extracellular vesicles in each hole is 50 mug/mL, mixing uniformly, and then, changing the cell ratio to CO at 37 ℃ and 5% ₂ Incubation was continued for 24 h under these conditions. After discarding the medium, the cells were washed 3 times with PBS buffer, fixed for 10 min with 4% PFA, washed 3 times with PBS and then stained with DAPI, a nuclear fluorescent dye, for 15 min. Thereafter, it is washed 3 more times with PBS, optionallyThe imaging of the oligonucleotide-modified extracellular vesicles obtained in example 20 in SH-SY5Y cells was observed under a confocal laser microscope. Detection conditions are as follows: ex =488 nm, em =520 to 550 nm.

As shown in fig. 22D, the oligonucleotide-modified extracellular vesicles obtained in example 20 were clearly visible in SH-SY5Y cells, compared to the unmodified extracellular vesicles (fig. 22C).

The cell culture medium, FBS, double antibody, pancreatin and other reagents are all purchased from Gibco company, and cell culture consumables such as culture plates and climbing sheets are all purchased from Corning company. The embodiment shows that the modification method can efficiently and stably carry out different types of modification on the extracellular vesicles, connect various macromolecular compounds or small molecular compounds to the extracellular vesicles, mark the extracellular vesicles, or transport the modifications to a designated position through the carrying of the extracellular vesicles.

The embodiments of the present invention have been described in detail, but the description is only for the preferred embodiments of the present invention and should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made within the scope of the present invention shall fall within the scope of the present invention.

Claims

1. A method of modifying extracellular vesicles, comprising: incubating the compound of formula 2 in admixture with extracellular vesicles;

formula 2;

wherein n is more than or equal to 4 and less than or equal to 14, n is an even number, and R is a modifier;

the modifier is a small molecular compound, and the small molecular compound is a fluorescent probe or a chemical drug;

firstly, azidation modification is carried out, and then click chemical coupling is carried out on the azidation modification and the carboxyl activated dibenzocyclooctynoic acid to form a reagent shown as a formula 2 for modifying the extracellular vesicles; the compound of formula 2 containing the modification is then mixed with the extracellular vesicles and incubated to attach them to the extracellular vesicles.

2. The method of modifying extracellular vesicles according to claim 1, wherein: the modifier is a fluorescent probe, in particular to rhodamine 110-azide or TAMRA-azide;

or the modifier is a chemical drug, in particular doxorubicin.

3. The method of modifying extracellular vesicles of claim 1, wherein: and (3) activating carboxyl of the diphenylcyclooctyne acid by using a crosslinking agent consisting of carbodiimide and N-hydroxysuccinimide to obtain diphenylcyclooctyne succinimide ester.

4. A method of modifying extracellular vesicles according to claim 3, wherein: the molar ratio of carbodiimide, N-hydroxysuccinimide and dibenzocyclooctynoic acid is 1-1.1.

5. The method of modifying extracellular vesicles of claim 4, wherein: the carbodiimide is dicyclohexylcarbodiimide or 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride;

the structural formula of the diphenyl cyclooctynoic acid is as follows:

formula 1;

wherein n is more than or equal to 4 and less than or equal to 14, and n is an even number.

6. The method of modifying extracellular vesicles according to claim 1, wherein: the incubation condition is that ultrapure water, normal saline or PBS buffer solution is used as solvent, and the reaction is carried out for 0.5-1 h at 25-37 ℃.

7. The method of modifying extracellular vesicles of claim 1, wherein: and (3) preparing the modified extracellular vesicles, and then performing centrifugal separation and purification on the modified extracellular vesicles under the centrifugal conditions of 20-25 ℃ and 10000-12000 g for 50-100 min.

8. The method of modifying extracellular vesicles according to claim 1, wherein: the extracellular vesicles are derived from milk sources, blood, urine or stem cells.

9. A modified extracellular vesicle produced by the method for modifying extracellular vesicles according to any one of claims 1 to 8.