CN114214451B - SNP locus linked with artemisinin content and application thereof - Google Patents
SNP locus linked with artemisinin content and application thereof Download PDFInfo
- Publication number
- CN114214451B CN114214451B CN202111646620.9A CN202111646620A CN114214451B CN 114214451 B CN114214451 B CN 114214451B CN 202111646620 A CN202111646620 A CN 202111646620A CN 114214451 B CN114214451 B CN 114214451B
- Authority
- CN
- China
- Prior art keywords
- content
- artemisinin
- artemisia annua
- primer
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP locus linked with artemisinin content and application thereof, wherein the SNP locus is positioned at 31bp of a nucleotide sequence shown as SEQ ID NO.1, and polymorphism is A/T. The invention utilizes the specificity SNP locus linked with the artemisinin and combines with KASP detection technology to solve the technical problem in the traditional molecular marker assisted breeding, and can rapidly, accurately, efficiently and high-throughput identify the content level of the artemisinin in the artemisia annua without agarose gel electrophoresis, thereby accelerating the breeding process of the artemisia annua material.
Description
Technical Field
The invention belongs to the field of agricultural molecular biology, and particularly relates to SNP loci linked with artemisinin content and application thereof.
Background
Malaria is one of the global diseases seriously harming human health, and the annual global morbidity is up to 2-3 hundred million and the annual average mortality is up to 30-50 ten thousand according to statistics of world health organization. With the use of artemisinin-based combination therapy (artemsinin-based combination therapy, ACT), malaria morbidity and mortality have decreased in the last decade, with a particularly significant decrease in africa in the disaster area.
The medicinal plant artemisia annua is the only natural source of artemisinin and is the most main source at present. The biosynthetic process of artemisinin belongs to an isoprenoid metabolic synthesis pathway, and isopentenyl pyrophosphate (isopentenyl diphosphate, IPP) is provided by mevalonic acid (MVA) pathway in the cytoplasm and methyl erythritol-4-phosphate (methylerythritol phosphate, MEP) pathway in the plastid, and is catalyzed to farnesyl pyrophosphate (farnesyl diphosphate, FPP). FPP is catalyzed by amorphadiene synthase (ADS) to produce amorphadiene. Amorphadiene undergoes 3 steps of reactions catalyzed by cytochrome P450 monooxidase (CYP 71AV 1) to form arteannuin, artemisine aldehyde, and artemisine acid, respectively. Artemisinin can form dihydroartemisinic aldehyde under the catalysis of artemisinic aldehyde double bond reductase [ artemisinic aldehyde delta-11 (13) reduction enzyme, DBR2 ]. Dihydroarteannuin can be catalyzed by aldehyde dehydrogenase 1 (aldehyde dehydrogenase 1, ALDH1) to form the direct precursor of artemisinin, dihydroarteannuin. Meanwhile, artemisinic acid is also produced by artemisinic aldehyde under the catalysis of CYP71AV1 and ALDH 1. The conversion of dihydroartemisinic acid to artemisinin, and artemisinic acid to artemisinin B is considered to be a non-enzymatic photooxidation reaction. At present, the over-expression of ADS, CYP71AV1, DBR2 and ALDH1 genes can obviously improve the content of artemisinin, which can reach 2-3 times of that of a control group. In the artemisinin biosynthesis process, genes controlling synthesis of the key enzymes ADS, CYP71AV1, DBR2 and ALDH1 play a crucial role.
The SNP molecular markers linked with ADS, CYP71AV1, DBR2 and ALDH1 genes are searched, and the KASP detection technology is combined, so that the Artemisia annua varieties with high artemisinin content can be rapidly and high-throughput screened, and the method has important significance for breeding the varieties with high artemisinin content.
Disclosure of Invention
The present invention aims to solve at least one of the technical problems in the prior art described above. For this purpose, the invention proposes a SNP locus linked to the artemisinin content.
The invention also provides a primer group for detecting the SNP locus.
The invention also provides a kit.
The invention also provides a gene chip.
The invention also provides application of the SNP locus, the primer set, the kit and/or the gene chip.
The invention also provides a detection method of the SNP locus.
According to a first aspect of the present invention, there is provided a SNP site linked to artemisinin content, said SNP site being located at 31bp of the nucleotide sequence as set forth in SEQ ID NO.1, the polymorphism being A/T.
According to a second aspect of the present invention, there is provided a Primer set for amplifying the above SNP site, the Primer set comprising a specific Primer and a universal Primer, wherein the specific Primer sequence comprises Primer X and Primer Y.
In some embodiments of the invention, the specific primer nucleotide sequence is shown as SEQ ID NO.2, SEQ ID NO. 3.
According to some embodiments of the invention, the primer set further comprises a universal primer having a nucleotide sequence as shown in SEQ ID NO. 4.
In some embodiments of the invention, the specific primer is linked to FAM and HEX fluorescent linker sequences, respectively.
According to a third aspect of the present invention, a kit is presented, comprising the above primer set.
According to a fourth aspect of the present invention, there is provided a gene chip comprising the above primer set.
According to a fifth aspect of the present invention, there is provided the use of the above SNP site, primer set, kit and/or gene chip, the use being:
(1) Application in detecting arteannuin content;
(2) Application in identifying and screening Artemisia annua with arteannuin content of 1.70-1.99wt%;
(3) Application in molecular marker assisted breeding of Artemisia annua;
(4) Application in the breeding of artemisia annua;
(5) The application in preparing the product of the artemisia annua breeding.
In some embodiments of the invention, the use is in genotyping of artemisia annua.
According to a sixth aspect of the present invention, there is provided a method for detecting artemisinin content using the above SNP site, comprising the steps of:
s1, extracting genome DNA from artemisia annua;
s2, carrying out polymorphism detection on the SNP locus on the genome DNA extracted in the step S1, and judging the content of artemisinin in the artemisia annua to be detected according to a detection result.
In some embodiments of the invention, if the base corresponding to the SNP locus is detected to be A: T, the artemisinin content in the artemisia annua to be detected is 1.70-1.99wt%.
In some embodiments of the present invention, preferably, in step S1, the extraction of genomic DNA from artemisia annua employs a simplified CTAB method (cetyl trimethylammonium bromide method).
In some embodiments of the present invention, preferably, in step S2, SNP sites are detected using the KASP (competitive allele-specific PCR) technique.
A method of breeding artemisia annua, comprising the steps of: by using the genotype detection method, the artemisia annua with the artemisinin content of 1.70-1.99wt% is selected for subsequent breeding.
The SNP locus linked to the artemisinin content according to the embodiment of the invention has at least the following beneficial effects: the SNP locus detection linked with the artemisinin can rapidly and accurately identify the artemisia annua with the artemisinin content of 1.70-1.99wt%. The invention utilizes the specific SNP locus linked with the artemisinin and combines with KASP detection technology to solve the technical problem in the traditional molecular marker assisted breeding, does not need agarose gel electrophoresis, can rapidly, accurately, efficiently and high-throughput identify the content level of the artemisinin in the artemisia annua, screens the artemisia annua variety with the artemisinin content of 1.70-1.99wt% and accelerates the breeding process of the artemisia annua.
Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.
Drawings
The invention is further described with reference to the accompanying drawings and examples, in which:
FIG. 1 is a flowchart showing SNP site marker development in example 1 of the invention;
FIG. 2 is a pattern diagram of molecular markers Ar900005_K01 in example 1 of the present invention.
Detailed Description
The conception and the technical effects produced by the present invention will be clearly and completely described in conjunction with the embodiments below to fully understand the objects, features and effects of the present invention. It is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments, and that other embodiments obtained by those skilled in the art without inventive effort are within the scope of the present invention based on the embodiments of the present invention. The test methods used in the examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.
The embodiment of the invention comprises the following steps: SNP locus linked with artemisinin content, the development process of the SNP locus marker, as shown in figure 1, finds that ADS, CYP71AV1, DBR2 and ALDH1 genes play an important role in the artemisinin biosynthesis pathway through related researches; amplifying target genes of samples with different artemisinin contents, excavating related SNP loci, comparing target gene generation sequencing results to obtain SNP loci, extracting SNP loci and flanking sequences, designing and synthesizing primer sequences of markers, and screening and testing the markers, wherein the method comprises the following steps of:
1 primer design
According to literature ADS, CYP71AV1, DBR2 and ALDH1 genes play an important role in the artemisinin biosynthesis pathway. Carrying out target gene amplification on samples with different artemisinin contents, and excavating related SNP loci. By comparing the sequencing result of the target gene generation, the A/T variation (SNP molecular marker Ar900005 _K01) exists at 159849 th base of the LBNU01012211.1 sequence of the reference genome. The 100bp flanking sequences before and after the locus in the reference genome are extracted, and the primers are designed by using a BatchPrimer3 primer design website. The label consists of 3 primers, wherein the 5' ends of the 2 specific primers are respectively connected with FAM and HEX fluorescent linker sequences. Primers were commissioned for Invitrogen corporation synthesis.
The nucleotide sequence of the SNP molecular marker Ar 900005-K01 polymorphic site is shown in SEQ ID NO. 1:
CATGGTCAAACAGAAGCGGGAGCCAATGGA[A/T]GTGAGGAGGAAGTAGCTCAGTTGATGAAAA(SEQ ID NO.1)。
SNP molecular markers designed based on KASP reaction principle and single base difference of materials are utilized to carry out genotype detection on samples with high flux. As shown in Table 1, the label consisted of 3 primers, the 5' ends of 2 specific primers were each ligated to a specific fluorescent sequence of KASP reagent of LGC company, 1 universal primer. If the PCR product only detects a fluorescence signal corresponding to the Primer X, the base of the detection site is A, and the artemisinin content in the test material cannot be distinguished; if only the fluorescence signal corresponding to the Primer Y is detected, the base of the detection site is T, and the artemisinin content in the test material cannot be distinguished; if the fluorescence signals corresponding to the Primer X and the Primer Y are detected at the same time, the base of the detection site is A to T, the test material is heterozygous genotype, and the artemisinin content is 1.70-1.99wt%.
TABLE 1 marker information
2 sample detection
DNA extraction: extracting genome DNA from Artemisia annua, adopting a simplified CTAB method, comprising the following steps:
(1) Taking about 30mg of blades to 1.3mL of a 96-well plate, placing the blades in a freeze dryer, and vacuumizing for 12 hours or more;
(2) After vacuumizing, adding two steel balls into each hole by using a bead divider, covering a silica gel film, grinding for 1min in a high-flux grinding instrument, immediately separating in a deep-hole plate centrifuge, and centrifuging the ground tissue to the bottom of the hole;
(3) Adding 700 mu L of CTAB extracting solution into each hole by using a pipetting workstation TECAN, shaking and uniformly mixing, placing into a 65 ℃ water bath kettle for warm bath for about 1-1.5h, taking 1.3mL of 96-well plates on a vortex oscillator for shaking for several times every 20 min;
(4) Taking out 1.3mL 96-well plate after the warm bath is finished, placing the 96-well plate into a deep-well plate refrigerated centrifuge, and centrifuging at 4000rpm for 10min;
(5) Transferring 380 mu L of supernatant in each well to a new 1.3mL 96-well plate by using a pipetting workstation TECAN, adding equal volume chloroform, mixing uniformly upside down, standing for 2min, placing in a deep-hole plate refrigerated centrifuge, centrifuging at 4000rpm for 10min;
(6) After centrifugation, 250. Mu.L of supernatant is extracted by a pipetting workstation TECAN to 0.8mL of 96-well plate with 250. Mu.L of isopropanol added in advance, and the mixture is uniformly mixed by vortex oscillation and placed in a refrigerator at the temperature of minus 20 ℃ for precipitation for 1 hour or more;
(7) Taking out 0.8mL of the 96-well plate, placing the 96-well plate in a deep-hole plate refrigerated centrifuge, centrifuging at 4000rpm for 15min;
(8) Discarding the supernatant, adding 250 μL of 70% ethanol into each well by using a pipetting workstation TECAN, oscillating for several times on a vortex oscillator, centrifuging for 15min at 5000 rpm;
(9) Discarding the supernatant, and placing in a 65 ℃ oven for 30min to dry;
(10) 200. Mu.L of sterilized ultrapure water was added to each well, and the mixture was left at room temperature overnight for dissolution.
KASP reaction test: the KASP reaction test was performed on a Douglas Arraytape genotyping platform, the reaction system is shown in table 2, from which it can be seen that the amplification system used for the PCR amplification reaction was 0.8 μl: after 20ng-50ng of the sample DNA was dried, 0.0013. Mu.L of each of 100. Mu.M of the two specific primers, 0.0033. Mu.L of 100. Mu.M of the universal primer, 0.3945. Mu.L of 2 XSKASP Master Mix, and 0.3996. Mu.L of ultrapure water were added. The PCR amplification is completed in a water bath thermal cycler, and the TouchDown PCR reaction conditions are as follows: pre-denaturation at 94℃for 15min; the first step of amplification reaction, denaturation at 94 ℃ for 20s, annealing at 65-57 ℃ and extension for 60s,10 cycles, wherein the annealing and extension temperature in each cycle is reduced by 0.8 ℃; the second amplification step was performed by denaturation at 94℃for 20s, annealing at 57℃and extension for 60s for 30 cycles. After the reaction is completed, the fluorescent data of KASP reaction products are read by using an Arrayape scanning system, and the result of fluorescent scanning is automatically converted into a pattern.
TABLE 2 KASP detection reaction System
| Final concentration | Volume of | |
| 100μM Primer C | 0.42μM | 0.0033μL |
| 100μM Primer X | 0.17μM | 0.0013μL |
| 100μM Primer Y | 0.17μM | 0.0013μL |
| 2×KASP Master Mix | 1× | 0.3945μL |
| Ultrapure water | 0.3996μL | |
| DNA (drying) | 20ng-50ng | |
| Total volume of | 0.8μL |
3 mark type data
According to the above detection method, 129 parts of Artemisia annua samples of known genotype and artemisinin content were subjected to KASP reaction verification with a marker Ar900005 _K01.
TABLE 3 Table 3
| Sample Name | Ar900005_K01 | Artemisinin content (%) |
| 190-1 | A:A | 2.24 |
| 131-1 | A:A | 2.18 |
| 65-1 | A:A | 2.15 |
| 139-1 | A:A | 2.13 |
| 122-1 | A:A | 2.1 |
| 152-7 | A:T | 1.99 |
| 152-6 | A:T | 1.98 |
| 148-34 | A:T | 1.89 |
| 148-49 | A:T | 1.89 |
| 148-48 | A:T | 1.85 |
| 148-37 | A:T | 1.82 |
| 152-35 | A:T | 1.80 |
| 148-39 | A:T | 1.77 |
| 152-11 | A:T | 1.73 |
| 152-44 | A:T | 1.71 |
| 152-68 | A:T | 1.70 |
| 93-23-1 | A:A | 1.68 |
| 146-23-1 | A:A | 1.66 |
| 146-26-1 | A:A | 1.63 |
| 146-21-1 | A:A | 1.58 |
| 146-13-1 | A:A | 1.53 |
As a result, as shown in FIG. 2 and Table 3, FIG. 2 is a genotyping chart, from which it can be seen that the detection result of 32 samples at the target site is base A: T, of which 30 are medium arteannuin content materials (medium arteannuin content represents arteannuin content of 1.70-1.99 wt%), 1 are high arteannuin content materials (high arteannuin content represents arteannuin content of more than 2.00 wt%), and 1 are low arteannuin content materials (low arteannuin content material represents arteannuin content of less than 1.69 wt%), the phenotype of the medium arteannuin content sample of 93.7% can be explained; the detection result of 94 samples at the target site is base A, and the artemisinin content in the materials cannot be distinguished; 3 samples cannot be typed at the target site; table 3 shows that the content of artemisinin corresponding to the heterozygous genotype A: T is 1.70-1.99wt%, the content of artemisinin represented by the base A: A cannot be judged, meanwhile, the Artemisia annua material corresponding to the base T: T is not detected in 129 parts of materials, and the result shows that the marker Ar 900005-K01 is accurate in typing, can be used for screening and detecting Artemisia annua with the content of artemisinin of 1.70-1.99wt% and assists in the breeding process of the Artemisia annua material.
4 specificity experiments
According to the above detection method, 26 parts of the artemisia annua material to be detected, which is completely different from the 129 parts of artemisia annua material, was typed with the above SNP molecular markers, and the results are shown in Table 4.
TABLE 4 Table 4
As can be seen from the table, the content of artemisinin in the artemisia annua to be detected corresponding to the heterozygous genotype A: T is 1.70-1.99wt%, and the result is consistent with the result of the artemisinin content of 26 artemisia annua materials to be detected obtained by adopting HPLC measurement, and the result shows that the marker Ar 900005-K01 is accurate in typing, and can be effectively used for screening and detecting the artemisia annua with the artemisinin content of 1.70-1.99wt%.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of one of ordinary skill in the art without departing from the spirit of the present invention. Furthermore, embodiments of the invention and features of the embodiments may be combined with each other without conflict.
Sequence listing
<110> Huazhi biotechnology Co., ltd
Hunan Xingchen Biotechnology Co., Ltd.
<120> SNP site linked with artemisinin content and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 61
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
catggtcaaa cagaagcggg agccaatgga agtgaggagg aagtagctca gttgatgaaa 60
a 61
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
agaagcggga gccaatggaa 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
agaagcggga gccaatggat 20
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ctctccatgt tttcatcaac tgagctac 28
Claims (7)
1. The primer group for amplifying SNP molecular markers linked with artemisinin content is characterized by comprising a specific primer and a universal primer, wherein the nucleotide sequence of the specific primer is shown as SEQ ID NO.2 and SEQ ID NO. 3; the nucleotide sequence of the universal primer is shown as SEQ ID NO. 4; the SNP molecular marker is positioned at 31bp of a nucleotide sequence shown as SEQ ID NO.1, and the polymorphism is A/T.
2. The primer set of claim 1 wherein the specific primers are linked to FAM and HEX fluorescent linker sequences, respectively.
3. A kit comprising the primer set of claim 1 or 2.
4. A gene chip comprising the primer set according to claim 1 or 2.
5. The primer set of claim 1 or 2, the kit of claim 3 or any of the following applications of the gene chip of claim 4:
(1) Application in detecting arteannuin content;
(2) Application in identifying and screening Artemisia annua with arteannuin content of 1.70-1.99 wt%;
(3) Application in molecular marker assisted breeding of Artemisia annua; the breeding is to select artemisia annua with the artemisia annua content of 1.70-1.99wt percent for breeding;
the SNP molecular marker is positioned at 31bp of a nucleotide sequence shown as SEQ ID NO.1, and the polymorphism is A/T.
6. A method for detecting artemisinin content using the primer set of the SNP molecular markers as set forth in claim 1, characterized in that the method comprises the steps of:
s1, extracting genome DNA from artemisia annua;
s2, carrying out polymorphism detection on the SNP molecular marker by using the primer set of the SNP molecular marker extracted in the step S1, and judging the content of artemisinin in the artemisia annua to be detected according to the detection result.
7. A method of breeding artemisia annua, comprising the steps of: the method of claim 6, further breeding the Artemisia annua with arteannuin content of 1.70-1.99. 1.99wt%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111646620.9A CN114214451B (en) | 2021-12-29 | 2021-12-29 | SNP locus linked with artemisinin content and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111646620.9A CN114214451B (en) | 2021-12-29 | 2021-12-29 | SNP locus linked with artemisinin content and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114214451A CN114214451A (en) | 2022-03-22 |
| CN114214451B true CN114214451B (en) | 2023-06-23 |
Family
ID=80706952
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111646620.9A Active CN114214451B (en) | 2021-12-29 | 2021-12-29 | SNP locus linked with artemisinin content and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114214451B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755060B (en) * | 2016-11-17 | 2020-05-26 | 上海交通大学 | Method for improving artemisinin content by co-transferring FPS and DBR2 genes and prepared sweet wormwood herb |
| CN106480088A (en) * | 2016-11-17 | 2017-03-08 | 上海交通大学 | A kind of method for improving content of artemisinin in sweet wormwood |
| CN112662678B (en) * | 2020-12-08 | 2022-12-23 | 上海交通大学 | Sweet wormwood MYB transcription factor AaMYB15 and application thereof |
-
2021
- 2021-12-29 CN CN202111646620.9A patent/CN114214451B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114214451A (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mir et al. | 10 Future Prospects of Molecular Markers in Plants | |
| WO2012097353A1 (en) | Methods, compositions, and kits for detecting rare cells | |
| CN106434940A (en) | Kit used for SNP detection of personalized medicine relaed genes of statin lipid-lowering medicine and detecting method thereof | |
| CN110607386B (en) | KASP primer combination suitable for construction of tomato DNA fingerprint database and application thereof | |
| CN114292944B (en) | SNP molecular marker linked with pepper epidemic disease resistance and application thereof | |
| CN115505648A (en) | Development and application of KASP molecular marker of drought-resistant gene of corn | |
| KR102010632B1 (en) | Reagent for detecting cross contamination of PDX-model related with human and mouse, the kit comprising the same, and the method for the cross contamination detection | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN114214451B (en) | SNP locus linked with artemisinin content and application thereof | |
| CN105624315A (en) | Primers and reagent kit for detecting polymorphism of ALDH2 gene c.1510 locus | |
| CN114231655B (en) | SNP locus linked with artemisinin content and application thereof | |
| Henry | Evolution of DNA marker technology in plants | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN114250315B (en) | SNP molecular marker linked with rice cadmium absorption related gene OsNramp5 and application thereof | |
| CN110331202A (en) | It is a kind of for detecting the kit and method of BRAC1 gene SNP | |
| CN113046349B (en) | SNP molecular marker combination for detecting rice Wx gene and application thereof | |
| CN114606337A (en) | KaSP marker development of rice grain type gene GLW7 and application thereof | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN112501338A (en) | Development and application of SNP molecular marker of rice grain width and grain weight gene GS5 | |
| CN112251516A (en) | Method for detecting standard weight day age of pig by using No. 7 chromosome of pig and kit thereof | |
| CN116377114A (en) | SNP molecular marker linked with corn stem rot resistance gene ZmAuxRP1 and application thereof | |
| CN116732214A (en) | Gene gn1a related to lodging resistance of rice R498 Linked SNP molecular marker and application thereof | |
| CN110272987A (en) | A kind of site mthfr gene C677T rapid typing detection reagent box and method | |
| CN116287414A (en) | Molecular marker for detecting corn stem rot resistance gene ZmCCT and application thereof | |
| KR102563613B1 (en) | Development of SNP markers and use thereof for discrimination of Pyogo mushroom cultivar Chamaram |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |