CN114214330A

CN114214330A - Quality control product for detecting chordoma, and preparation method and application thereof

Info

Publication number: CN114214330A
Application number: CN202111565983.XA
Authority: CN
Inventors: 李连杰; 李明振; 蔡宁; 胡旻; 潘丽
Original assignee: Hangzhou Bailing Biological Technology Co ltd
Current assignee: Hangzhou Bailing Biological Technology Co ltd
Priority date: 2021-12-20
Filing date: 2021-12-20
Publication date: 2022-03-22

Abstract

The invention discloses a quality control product for detecting chordoma, a preparation method and application thereof, and belongs to the technical field of immunodetection. Particularly discloses ssDNA for constructing mammal cells stably expressing Brachyury, the prepared mammal cells, application of the mammal cells in preparing a quality control product and the quality control product prepared by the mammal cells. By using the invention, the mammal cell capable of stably expressing Brachyury can be prepared, and the overexpression state can be still maintained after passage for 20 generations. The invention can prepare quality control products with stable performance and ensure that the quality of the quality control products of different batches is relatively uniform.

Description

Quality control product for detecting chordoma, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of immunodetection, and particularly relates to a quality control product based on chordoma detection, and a preparation method and application thereof.

Background

With the continuous discovery of new applications of various antibodies and the emergence of more and more novel antibodies, immunohistochemistry has been an important place in pathological diagnosis and treatment, and has a great influence on many aspects such as tumor diagnosis, differential diagnosis, classification, prognosis and the like. However, immunohistochemistry has some defects and shortcomings, so that reasonable design and application of contrast in actual work are the key points of immunohistochemical quality control, and the effectiveness of the used reagent in the experimental process, the authenticity of the experimental result and the accuracy of pathological diagnosis can be effectively ensured.

Generally, the quality control product for immunohistochemical diagnosis is a section made of pathological tissues of a patient to be diagnosed, but the section has various defects. For example, first, human cases are limited in tissue and unstable in origin. For example, the classification of the immunohistochemical staining result of the breast cancer Her-2 has a clear interpretation standard, and according to the standard, breast cancer cases need to be screened, and different pathologies ranging from 0 to 3+ are selected and applied to immunohistochemical detection of the breast cancer Her-2 in daily work. However, these tissue quality controls are limited and require continued screening of a large number of cases after use to obtain test results consistent with previous quality controls. Second, the unavailability of human case tissues: for example, chordoma is a rare locally malignant invasive bone tumor, and Brachyury is considered as a diagnosis specific marker of chordoma by most researchers and clinical pathological diagnosis in recent years. However, chordoma is rare, and the abnormal tissue is difficult to obtain in positive cases, which undoubtedly adds a lot of difficulties to the work of detection personnel. Thirdly, the method comprises the following steps: the case organization is from the patient, the attribution of the case organization is attributed to the individual patient, and the use of the case organization by related personnel has certain risk on the legal attribution, and is more unlikely to be used for the commercial development.

The cell line, especially tumor cell line, has the features of fast growth speed, unlimited proliferation, easy obtaining, etc. Cells from different sources can be selected to be made into quality control products according to different detection requirements. Compared with the case tissues of the human body, the quality control product from the cells has good stability, traceable source, easy acquisition and various forms, avoids the risks in ethics and law ownership, and can be better used for commercial development. Some rare tumor cases are clinically encountered, and for most hospital pathology departments, the corresponding tissue or cell quality control is difficult to find. Therefore, in such rare cases, the quality control of cell lines can be obtained by genetically engineering means to mutate, delete, knock-in, or fuse a particular gene in the cell. However, the quality control of the cell line prepared in the prior art still has great defects, and the requirement of clinical detection is difficult to meet.

Disclosure of Invention

In order to solve at least one of the above technical problems, the present invention aims to provide a cell for constructing a marker knocking in a tumor-specific marker or knocking out a marker specifically disappearing of a tumor using the CRISPR-Cas9 technique; the cell suspension quality control product prepared by the method or the nude mouse transplanted tumor tissue quality control product is suitable for the application of immunohistochemical detection, in order to realize the purpose,

in a first aspect, the invention provides ssDNA for constructing mammalian cells stably expressing Brachyury, the nucleotide sequence of which is shown in SEQ ID No.1 or SEQ ID No. 2.

Brachyury is a transcription factor protein product of the TATA-box gene and regulates the development of notochord-derived tissues and tumors. Brachyury is highly localized in most tissues and cells of all tissue origins in normal adults, is expressed only in small amounts in the testis, spleen and small intestine, is not expressed in chondrosarcoma, myoepithelioma or many other cancer tissues (e.g., renal cell carcinoma), and is strongly expressed in chordoma, and thus is a sensitive, specific marker of chordoma.

In the present invention, the ssDNA is obtained by adding homologous arm sequences of AAVS1 to both ends of the Brachyury gene sequence, and can be inserted into AAVS1 site on the genome of the mammalian cell via a knock-out vector.

In a second aspect, the invention provides a mammalian cell stably expressing Brachyury by knocking-in ssDNA according to the first aspect of the invention into the AAVS1 locus on the genome of the mammalian cell using a knock-out vector.

The AAVS1 site (also known as the PPP1R2C site) is a "safe harbor" site that has been validated to ensure the desired function of the transferred DNA fragment. The site is an open chromosome structure and can ensure that the transgene can be normally transcribed.

In some embodiments of the invention, the mammalian cell is a human, and the mammalian cell is selected from one of a HEK-293 cell, a HeLa cell, an LNCaP cell, a HepG2 cell, and an a549 cell.

In other embodiments of the invention, the mammal is a mouse.

In a third aspect, the invention provides a method for constructing a mammalian cell stably expressing Brachyury, comprising the steps of:

s1, obtaining ssDNA according to the first aspect of the invention;

s2, co-transfecting the mammalian cell with a knock-out vector and the ssDNA obtained in step S1;

s3, screening the mammalian cells for stable expression of Brachyury.

In some embodiments of the invention, the knock-out vector is an AAVS1-Cas9n plasmid. Further, the transfection is performed using a transfection reagent, preferably the transfection reagent is Lipofectamine 3000 reagent. In some embodiments of the present invention, step S2 is specifically: diluting the AAVS1-Cas9n plasmid and the ssDNA with Opti-MEM medium, then adding P3000, mixing well, and incubating at room temperature; diluting the Lipofectamine 3000 reagent with an Opti-MEM culture medium, fully mixing, and incubating at room temperature; mixing the above two mixed solutions at a ratio of 1:1, incubating at room temperature, adding into cells, and culturing at 37 deg.C.

In some embodiments of the invention, in step S3, the screening is performed using puromycin.

Further, the mammalian cells after screening are identified by immunoblotting.

In a fourth aspect, the invention provides the use of the mammalian cell of the second aspect of the invention in the preparation of a quality control product for diagnosing chordoma.

In some embodiments of the invention, the quality control is a cellular quality control.

In other embodiments of the invention, the quality control material is a tissue quality control material.

The fifth aspect of the present invention provides a quality control product for diagnosing chordoma, which is a cell quality control product prepared from the mammalian cell according to the second aspect of the present invention.

The sixth aspect of the present invention provides a method for producing the quality control product according to the fifth aspect of the present invention, comprising the steps of:

s1', expanding the culture and collecting the mammalian cells stably expressing Brachyury;

s2', fixing the mammalian cells stably expressing Brachyury with formalin, and performing gradient ethanol dehydration;

s3', collecting cells dehydrated by ethanol, and adding wax liquid to embed into cell wax blocks;

s4', crushing the cell wax block, adding a dewaxing solution for treatment, centrifuging, and then suspending to 95% ethanol to obtain the quality control product.

In some embodiments of the present invention, in step S2', the step of performing gradient ethanol dehydration refers to performing dehydration with 50%, 75%, 95% ethanol, respectively, and preferably, dehydration is performed for 1 hour for each gradient.

In some embodiments of the invention, the quality control material is used as a positive quality control material by the following method:

HEK-293 cell suspension is prepared as a negative quality control product by the same method. If the negative quality control substance shows negative, and the positive quality control substance shows medium to strong nuclear staining of more than 80%, the experimental process and the result can be judged to be credible.

The seventh aspect of the present invention provides another quality control product for diagnosing chordoma, which is a tissue quality control product prepared from a chordoma tumor sample of a mammal other than a human, wherein the tumor is induced by the mammalian cell according to the second aspect of the present invention.

In some embodiments of the invention, the following steps are used to induce tumor development in a mammal: a female mammal is prepared, and 100. mu.L of the mammalian cells according to the second aspect of the present invention are subcutaneously inoculated to the left and right back of a nude mouse, respectively, near the underarm.

An eighth aspect of the present invention provides a method for producing a tissue quality control product according to the seventh aspect of the present invention, comprising the steps of:

s1', obtaining the chordoma tumor sample;

s2', fixing the chordoma tumor sample by using formalin, and then performing gradient ethanol dehydration;

s3', collecting the spinal cord tumor sample after ethanol dehydration, and adding wax liquid to embed into tissue wax block;

s4', slicing the tissue wax block, and placing the sliced tissue wax block on a plane support to obtain the quality control product.

In some embodiments of the present invention, in step S2 ", the step of performing gradient ethanol dehydration refers to performing dehydration using 50%, 75%, 95% ethanol, respectively, and preferably, dehydration is performed for 1 hour for each gradient.

In some embodiments of the invention, in step S4 ″, the tissue wax block is sliced at a thickness of 1-3 μm.

the same method is used for preparing the normal tissue wax block from the same source as a negative quality control product. If the negative quality control substance shows negative, and the positive quality control substance shows medium to strong nuclear staining of more than 80%, the experimental process and the result can be judged to be credible.

In the present invention, the diagnosis of chordoma is based on in situ detection methods, in particular, immunohistochemistry or in situ hybridization.

The invention has the advantages of

Compared with the prior art, the invention has the following beneficial effects:

by using the invention, the mammal cell capable of stably expressing Brachyury can be prepared, and the overexpression state can be still maintained after passage for 20 generations.

The invention can ensure that the quality of the quality control products of different batches is relatively uniform, and has the advantages of low cost and convenient storage and transportation.

The invention can prepare cell quality control products with stable performance, and the dyeing intensity is not obviously weakened after half a year or even 1 year of storage.

The tissue quality control product with stable performance can be prepared by the method and can be stored for years.

The invention can be applied to different occasions to prepare different types of quality control products, and has wider application range.

Drawings

FIG. 1 shows the results of immunoblot detection of Brachyury knock-in cell lines prepared using ssDNA-1 in example 1 of the present invention.

FIG. 2 shows the results of immunoblot detection of the Brachyury knock-in cell line prepared using ssDNA-2 in example 1 of the present invention.

FIG. 3 shows the results of the immunoblot assay for stable expression of Brachyury by the Brachyury knock-in cell line in example 2 of the invention.

FIG. 4 shows immunohistochemical staining results of HEK-293 cell wax block suspension negative quality control and HEK-293-Brachyury cell wax block positive quality control newly prepared in example 3 of the present invention.

FIG. 5 shows immunohistochemical staining results of HEK-293 cell wax block suspension negative quality control and HEK-293-Brachyury cell wax block positive quality control stored at-20 ℃ for half a year in example 3 of the present invention.

FIG. 6 shows the immunohistochemical staining results of the HEK-293 cell nude mouse transplanted tumor tissue negative quality control product and the HEK-293-Brachyury cell nude mouse transplanted tumor tissue positive quality control product newly prepared in example 4 of the present invention.

FIG. 7 shows the immunohistochemical staining results of the HEK-293 cell nude mouse transplanted tumor tissue negative quality control product and the HEK-293-Brachyury cell nude mouse transplanted tumor tissue positive quality control product which are stored at room temperature in a dark place for half a year in example 4 of the present invention.

Detailed Description

Unless otherwise indicated, implied from the context, or customary in the art, all parts and percentages herein are by weight and the testing and characterization methods used are synchronized with the filing date of the present application. Where applicable, the contents of any patent, patent application, or publication referred to in this application are incorporated herein by reference in their entirety and their equivalent family patents are also incorporated by reference, especially as they disclose definitions relating to synthetic techniques, products and process designs, polymers, comonomers, initiators or catalysts, and the like, in the art. To the extent that a definition of a particular term disclosed in the prior art is inconsistent with any definitions provided herein, the definition of the term provided herein controls.

The numerical ranges in this application are approximations, and thus may include values outside of the ranges unless otherwise specified. A numerical range includes all numbers from the lower value to the upper value, in increments of 1 unit, provided that there is a separation of at least 2 units between any lower value and any higher value. For example, if a compositional, physical, or other property (e.g., molecular weight, melt index, etc.) is recited as 100 to 1000, it is intended that all individual values, e.g., 100, 101, 102, etc., and all subranges, e.g., 100 to 166, 155 to 170, 198 to 200, etc., are explicitly recited. For ranges containing a numerical value less than 1 or containing a fraction greater than 1 (e.g., 1.1, 1.5, etc.), then 1 unit is considered appropriate to be 0.0001, 0.001, 0.01, or 0.1. For ranges containing single digit numbers less than 10 (e.g., 1 to 5), 1 unit is typically considered 0.1. These are merely specific examples of what is intended to be expressed and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application.

When used with respect to chemical compounds, the singular includes all isomeric forms and vice versa (e.g., "hexane" includes all isomers of hexane, individually or collectively) unless expressly specified otherwise. In addition, unless explicitly stated otherwise, the use of the terms "a", "an" or "the" are intended to include the plural forms thereof.

The terms "comprising," "including," "having," and derivatives thereof do not exclude the presence of any other component, step or procedure, and are not intended to exclude the presence of other elements, steps or procedures not expressly disclosed herein. To the extent that any doubt is eliminated, all compositions herein containing, including, or having the term "comprise" may contain any additional additive, adjuvant, or compound, unless expressly stated otherwise. Rather, the term "consisting essentially of … …" excludes any other components, steps or processes from the scope of any of the terms hereinafter recited, insofar as such terms are necessary for performance. The term "consisting of … …" does not include any components, steps or processes not specifically described or listed. Unless explicitly stated otherwise, the term "or" refers to the listed individual members or any combination thereof.

In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.

Examples

The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

The molecular biological experiments, which are not specifically described in the following examples, were performed according to the specific methods listed in the manual of molecular cloning, laboratory manual (fourth edition) (j. sambrook, m.r. green, 2017), or according to the kit and product instructions. Other experimental methods, unless otherwise specified, are conventional. The instruments used in the following examples are, unless otherwise specified, laboratory-standard instruments; the test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 insertion of Brachyury Gene into HEK-293 cells Using CRISPR-Cas9 technology

Synthesis of Brachyury ssDNA

The AAVS1 site is an open chromosomal structure, and is inserted at a site that ensures that the transferred Brachyury gene is normally transcribed. The inventor designs homologous arm sequences of AAVS1 with the sizes of about 300nt and 600nt at two ends of the Brachyury gene sequence respectively, and synthesizes Brachyury ssDNA-1 and ssDNA-2 by Jinwei Zhi company, wherein the ssDNA-1 nucleotide sequence is as follows (SEQ ID No. 1):

TCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCATGAGCTCCCCTGGCACCGAGAGCGCGGGAAAGAGCCTGCAGTACCGAGTGGACCACCTGCTGAGCGCCGTGGAGAATGAGCTGCAGGCGGGCAGCGAGAAGGGCGACCCCACAGAGCGCGAACTGCGCGTGGGCCTGGAGGAGAGCGAGCTGTGGCTGCGCTTCAAGGAGCTCACCAATGAGATGATCGTGACCAAGAACGGCAGGAGGATGTTTCCGGTGCTGAAGGTGAACGTGTCTGGCCTGGACCCCAACGCCATGTACTCCTTCCTGCTGGACTTCGTGGCGGCGGACAACCACCGCTGGAAGTACGTGAACGGGGAATGGGTGCCGGGGGGCAAGCCGGAGCCGCAGGCGCCCAGCTGCGTCTACATCCACCCCGACTCGCCCAACTTCGGGGCCCACTGGATGAAGGCTCCCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATCCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTGGTCCAGCCTTGGAATGCCTGCCCATCCCAGCATGCTCCCCGTGAGCCACAATGCCAGCCCACCTACCAGCTCCAGTCAGTACCCCAGCCTGTGGTCTGTGAGCAACGGCGCCGTCACCCCGGGCTCCCAGGCAGCAGCCGTGTCCAACGGGCTGGGGGCCCAGTTCTTCCGGGGCTCCCCCGCGCACTACACACCCCTCACCCATCCGGTCTCGGCGCCCTCTTCCTCGGGATCCCCACTGTACGAAGGGGCGGCCGCGGCCACAGACATCGTGGACAGCCAGTACGACGCCGCAGCCCAAGGCCGCCTCATAGCCTCATGGACACCTGTGTCGCCACCTTCCATGTGAACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCT

the ssDNA-2 nucleotide sequence is as follows (SEQ ID No. 2):

GTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCGGGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCATGAGCTCCCCTGGCACCGAGAGCGCGGGAAAGAGCCTGCAGTACCGAGTGGACCACCTGCTGAGCGCCGTGGAGAATGAGCTGCAGGCGGGCAGCGAGAAGGGCGACCCCACAGAGCGCGAACTGCGCGTGGGCCTGGAGGAGAGCGAGCTGTGGCTGCGCTTCAAGGAGCTCACCAATGAGATGATCGTGACCAAGAACGGCAGGAGGATGTTTCCGGTGCTGAAGGTGAACGTGTCTGGCCTGGACCCCAACGCCATGTACTCCTTCCTGCTGGACTTCGTGGCGGCGGACAACCACCGCTGGAAGTACGTGAACGGGGAATGGGTGCCGGGGGGCAAGCCGGAGCCGCAGGCGCCCAGCTGCGTCTACATCCACCCCGACTCGCCCAACTTCGGGGCCCACTGGATGAAGGCTCCCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATCCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTGGTCCAGCCTTGGAATGCCTGCCCATCCCAGCATGCTCCCCGTGAGCCACAATGCCAGCCCACCTACCAGCTCCAGTCAGTACCCCAGCCTGTGGTCTGTGAGCAACGGCGCCGTCACCCCGGGCTCCCAGGCAGCAGCCGTGTCCAACGGGCTGGGGGCCCAGTTCTTCCGGGGCTCCCCCGCGCACTACACACCCCTCACCCATCCGGTCTCGGCGCCCTCTTCCTCGGGATCCCCACTGTACGAAGGGGCGGCCGCGGCCACAGACATCGTGGACAGCCAGTACGACGCCGCAGCCCAAGGCCGCCTCATAGCCTCATGGACACCTGTGTCGCCACCTTCCATGTGAACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCCGTCCTGGCAGGGCTGTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTGTGAGAATGGTGCGTCCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTCTCTTTCTCCATCC

transfection of HEK-293 cells

And (3) inoculating HEK-293 cells in a logarithmic growth phase into a 6-well plate, and performing a transfection experiment when the cell fusion degree is 50-70% after 12-24 hours. Cell transfection was performed using Lipofectamine 3000 according to the protocol, and the plasmid transfection ratios are shown in Table 1. Respectively diluting the suspension A and the suspension B by using an Opti-MEM culture medium, then respectively adding P3000, fully and uniformly mixing, and incubating for 5 minutes at room temperature; diluting the Lipofectamine 3000 reagent by using an Opti-MEM culture medium, fully mixing the reagent uniformly, and incubating the reagent for 5 minutes at room temperature; and (3) adding the equivalent-volume diluted Lipofectamine 3000 reagent into the diluted suspension A and the diluted suspension B respectively, mixing uniformly, continuing to incubate for 15-20 minutes at room temperature, dripping into cells respectively, and culturing at constant temperature of 37 ℃.

Table 1: description of plasmid transfection

DNA premix	Ratio of
		A suspension	AAVS1-Cas9n plasmid: brachyury ssDNA-1 ═ 1:1.5
B suspension	AAVS1-Cas9n plasmid: brachyury ssDNA-2 ═ 1:1.5

3. Screening and identification of HEK-293 cells stably expressing Brachyury

a) After 24-48 hours of transfection, replacing a fresh culture medium, and adding puromycin (puromycin) with the final concentration of 2 mug/mL for cell screening, wherein the puromycin screening time is 5-7 days;

b) and (3) sucking 1000-2000 screened cells, inoculating the cells into a 96-well cell culture plate by a limiting dilution method, and finally enabling the final volume of each well in the 96-well to be 200 mu L. Culturing for 5-7 days in a 37 ℃ cell culture box until a monoclonal cell subline with a single cell source is grown;

c) and respectively transferring the marked monoclonal cell sublines in the 96-well plate into a large cell culture container for amplification culture, respectively extracting proteins when the number of cells is enough, and performing immunoblotting identification by using a Brachyury antibody and an internal reference beta-actin antibody, wherein the results are shown in figures 1 and 2, and the detection of Brachyury protein expression by single cell clone is shown.

d) Through the verification of protein level, the Brachyury gene is successfully inserted into the AAVS1 site, the construction of the Brachyury over-expressed HEK-293 cell is successful, the A suspension generates 5 Brachyury knock-in cell lines with the numbers of 3, 8-11, and the B suspension generates 2 Brachyury knock-in cell lines with the numbers of 9 and 11. Therefore, ssDNA-1 is further optimized compared with ssDNA-2, the Brachyury knock-in cells are easier to obtain, the sequence of the ssDNA-1 is shorter, and the synthesis cost is relatively reduced.

Example 2 verification of Stable expression of Brachyury by the cell line HEK-293-Brachyury

One cell (cell line No. 9 produced by suspension a) was selected from among several Brachyury knock-in cell lines HEK-293-Brachyury obtained in example 1, and subcultured continuously, and cells of different passage numbers were collected, and proteins were extracted to prepare protein lysates. The method comprises the following specific steps:

(1) selecting a Brachyury knock-in cell line HEK-293-Brachyury obtained in example 1 for culture, and subculturing the Brachyury knock-in cell line in a new culture flask when the cell is in a logarithmic growth phase;

(2) continuously carrying out cell passage, carrying out the passage on the cells according to the method when the cell density in a culture flask reaches about 80%, respectively collecting the cells of the 5 th generation, the 10 th generation and the 20 th generation, and extracting protein to prepare protein lysate;

(3) immunoblot identification using the Brachyury antibody and the internal reference beta-actin antibody revealed that the expression levels of Brachyury protein were not significantly different in the cells of passage 5 (Line1), passage 10 (Line 2) and passage 20 (Line 3) as shown in FIG. 3, demonstrating that HEK-293-Brachyury cells were able to consistently and stably express Brachyury protein.

Example 3 preparation of quality control products Using cell line HEK-293-Brachyury stably expressing Brachyury

The Brachyury knock-in cell line (cell line No. 9 from suspension a) obtained in example 1 was subjected to scale-up culture, and after completion of the culture, the cells were collected by centrifugation to prepare a cell wax pellet. The method comprises the following specific steps:

(1) selecting a Brachyury knock-in cell line HEK-293-Brachyury obtained in example 1, carrying out expanded culture and collecting HEK-293-Brachyury cells, and simultaneously carrying out expanded culture and collecting non-knock-in HEK-293 cells;

(2) formalin is used for fixing the cells, and the cells are dehydrated by 50 percent, 75 percent and 95 percent of ethanol respectively for 1 hour and then immersed into wax liquid for embedding to prepare cell wax blocks;

(3) crushing the cell wax block by a homogenizer, adding a dewaxing solution for treatment for 5 minutes, centrifuging, and then suspending to 95% ethanol, and storing at-20 ℃ for later use;

(4) when detecting a sample, dripping 2 mu L of quality control product suspension liquid on the periphery of a sample glass slide to be detected, and detecting according to an immunohistochemical experimental standard flow. Each target point is respectively provided with 1 pair of quality control products formed by 1 negative quality control product and 1 positive quality control product, wherein HEK-293 cell suspension is a negative control product, and HEK-293-Brachyury cell suspension is a positive control product;

(5) and (4) interpretation of results: the negative control quality control point shows negative, the positive control quality control point shows medium to strong nuclear staining of more than 80%, the experimental process and the result can be judged to be credible, as shown in figures 4 and 5, the newly prepared cell suspension quality control product and the cell suspension quality control product stored at the temperature of 20 ℃ below zero for half a year (6 months) have no obvious difference in the form of cells and the immunohistochemical staining effect, wherein the negative quality control product shows negative, and the positive quality control product shows strong nuclear staining of more than 95%, so that the stability of the quality control product suspension is proved to be better.

EXAMPLE 4 preparation of nude mouse transplanted tumor tissue and preparation of quality control product Using HEK-293-Brachyury cells

The knockin cell line HEK-293-Brachyury (cell line No. 9 from suspension A) obtained in example 1 was subjected to scale-up culture, and after completion of the culture, the cells were collected by centrifugation and resuspended in PBS. The method comprises the following specific steps:

(1) expanding and collecting HEK-293 and HEK-293-Brachyury cells by cell culture, wherein the concentration of the cells after PBS is resuspended is about 5-10 multiplied by 10⁷/mL；

(2) Preparing female BALB/C/nu/nu strain nude mice (provided by animal experiment research center of Zhejiang university of traditional Chinese medicine with license number SYXK (Zhe) 2021-0012) with age of 4-5 weeks and weight of 20.0 +/-2.0 g, and 100 mu L of the nude mice are subcutaneously inoculated with the parts close to the armpits at the left and the right of the nude mice respectively, wherein the next day is the inoculation day 1;

(3) observing the diet condition and mental condition of the nude mice every day, collecting tumor blocks on the backs of the nude mice about 25-30 days after inoculation, fixing the tumor blocks for 24 hours by formalin, dehydrating the tumor blocks for 1 hour by 50%, 75% and 95% ethanol respectively, and immersing the tumor blocks into wax liquid to be buried into tissue wax blocks;

(4) slicing the tissue wax block in a thickness of 1-3 μm, placing the slice on a glass slide to prepare a quality control product, and detecting according to an immunohistochemical experimental standard flow;

(5) and (4) interpretation of results: the quality control product shows that the quality control product is more than 80% of medium to strong nuclear staining, the experimental process and the result can be judged to be credible, as shown in figures 6 and 7, the newly manufactured tissue quality control product and the tissue quality control product which is preserved for half a year at room temperature in a dark place have no obvious difference in the form of cells in tissues and the immunohistochemical staining effect, wherein the negative tissue quality control product shows negative, and the positive tissue quality control product shows more than 90% of strong nuclear staining, so that the stability of the tissue quality control product is proved to be better.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

SEQUENCE LISTING

<110> Hangzhou Bailing Biotechnology Ltd

<120> quality control product for detecting chordoma, preparation method and application thereof

<130> XYY202111574

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1724

<212> DNA

<213> Artificial Sequence

<220>

<223> ssDNA

<400> 1

tcctgtggat tcgggtcacc tctcactcct ttcatttggg cagctcccct acccccctta 60

cctctctagt ctgtgctagc tcttccagcc ccctgtcatg gcatcttcca ggggtccgag 120

agctcagcta gtcttcttcc tccaacccgg gcccctatgt ccacttcagg acagcatgtt 180

tgctgcctcc agggatcctg tgtccccgag ctgggaccac cttatattcc cagggccggt 240

taatgtggct ctggttctgg gtacttttat ctgtcccctc caccccacag tggggcatga 300

gctcccctgg caccgagagc gcgggaaaga gcctgcagta ccgagtggac cacctgctga 360

gcgccgtgga gaatgagctg caggcgggca gcgagaaggg cgaccccaca gagcgcgaac 420

tgcgcgtggg cctggaggag agcgagctgt ggctgcgctt caaggagctc accaatgaga 480

tgatcgtgac caagaacggc aggaggatgt ttccggtgct gaaggtgaac gtgtctggcc 540

tggaccccaa cgccatgtac tccttcctgc tggacttcgt ggcggcggac aaccaccgct 600

ggaagtacgt gaacggggaa tgggtgccgg ggggcaagcc ggagccgcag gcgcccagct 660

gcgtctacat ccaccccgac tcgcccaact tcggggccca ctggatgaag gctcccgtct 720

ccttcagcaa agtcaagctc accaacaagc tcaacggagg gggccagatc atgctgaact 780

ccttgcataa gtatgagcct cgaatccaca tagtgagagt tgggggtcca cagcgcatga 840

tcaccagcca ctgcttccct gagacccagt tcatagcggt gactgcttat cagaacgagg 900

agatcacagc tcttaaaatt aagtacaatc catttgcaaa agctttcctt gatgcaaagg 960

aaagaagtga tcacaaagag atgatggagg aacccggaga cagccagcaa cctgggtact 1020

cccaatccta ttctgacaac tcacctgcat gtttatccat gctgcaatcc catgacaatt 1080

ggtccagcct tggaatgcct gcccatccca gcatgctccc cgtgagccac aatgccagcc 1140

cacctaccag ctccagtcag taccccagcc tgtggtctgt gagcaacggc gccgtcaccc 1200

cgggctccca ggcagcagcc gtgtccaacg ggctgggggc ccagttcttc cggggctccc 1260

ccgcgcacta cacacccctc acccatccgg tctcggcgcc ctcttcctcg ggatccccac 1320

tgtacgaagg ggcggccgcg gccacagaca tcgtggacag ccagtacgac gccgcagccc 1380

aaggccgcct catagcctca tggacacctg tgtcgccacc ttccatgtga actagggaca 1440

ggattggtga cagaaaagcc ccatccttag gcctcctcct tcctagtctc ctgatattgg 1500

gtctaacccc cacctcctgt taggcagatt ccttatctgg tgacacaccc ccatttcctg 1560

gagccatctc tctccttgcc agaacctcta aggtttgctt acgatggagc cagagaggat 1620

cctgggaggg agagcttggc agggggtggg agggaagggg gggatgcgtg acctgcccgg 1680

ttctcagtgg ccaccctgcg ctaccctctc ccagaacctg agct 1724

<210> 2

<211> 2351

<212> DNA

<213> Artificial Sequence

<220>

<223> ssDNA

<400> 2

gtgatgtcct ctgagcggat cctccccgtg tctgggtcct ctccgggcat ctctcctccc 60

tcacccaacc ccatgccgtc ttcactcgct gggttccctt ttccttctcc ttctggggcc 120

tgtgccatct ctcgtttctt aggatggcct tctccgacgg atgtctccct tgcgtcccgc 180

ctccccttct tgtaggcctg catcatcacc gtttttctgg acaaccccaa agtaccccgt 240

ctccctggct ttagccacct ctccatcctc ttgctttctt tgcctggaca ccccgttctc 300

ctgtggattc gggtcacctc tcactccttt catttgggca gctcccctac cccccttacc 360

tctctagtct gtgctagctc ttccagcccc ctgtcatggc atcttccagg ggtccgagag 420

ctcagctagt cttcttcctc caacccgggc ccctatgtcc acttcaggac agcatgtttg 480

ctgcctccag ggatcctgtg tccccgagct gggaccacct tatattccca gggccggtta 540

atgtggctct ggttctgggt acttttatct gtcccctcca ccccacagtg gggcatgagc 600

tcccctggca ccgagagcgc gggaaagagc ctgcagtacc gagtggacca cctgctgagc 660

gccgtggaga atgagctgca ggcgggcagc gagaagggcg accccacaga gcgcgaactg 720

cgcgtgggcc tggaggagag cgagctgtgg ctgcgcttca aggagctcac caatgagatg 780

atcgtgacca agaacggcag gaggatgttt ccggtgctga aggtgaacgt gtctggcctg 840

gaccccaacg ccatgtactc cttcctgctg gacttcgtgg cggcggacaa ccaccgctgg 900

aagtacgtga acggggaatg ggtgccgggg ggcaagccgg agccgcaggc gcccagctgc 960

gtctacatcc accccgactc gcccaacttc ggggcccact ggatgaaggc tcccgtctcc 1020

ttcagcaaag tcaagctcac caacaagctc aacggagggg gccagatcat gctgaactcc 1080

ttgcataagt atgagcctcg aatccacata gtgagagttg ggggtccaca gcgcatgatc 1140

accagccact gcttccctga gacccagttc atagcggtga ctgcttatca gaacgaggag 1200

atcacagctc ttaaaattaa gtacaatcca tttgcaaaag ctttccttga tgcaaaggaa 1260

agaagtgatc acaaagagat gatggaggaa cccggagaca gccagcaacc tgggtactcc 1320

caatcctatt ctgacaactc acctgcatgt ttatccatgc tgcaatccca tgacaattgg 1380

tccagccttg gaatgcctgc ccatcccagc atgctccccg tgagccacaa tgccagccca 1440

cctaccagct ccagtcagta ccccagcctg tggtctgtga gcaacggcgc cgtcaccccg 1500

ggctcccagg cagcagccgt gtccaacggg ctgggggccc agttcttccg gggctccccc 1560

gcgcactaca cacccctcac ccatccggtc tcggcgccct cttcctcggg atccccactg 1620

tacgaagggg cggccgcggc cacagacatc gtggacagcc agtacgacgc cgcagcccaa 1680

ggccgcctca tagcctcatg gacacctgtg tcgccacctt ccatgtgaac tagggacagg 1740

attggtgaca gaaaagcccc atccttaggc ctcctccttc ctagtctcct gatattgggt 1800

ctaaccccca cctcctgtta ggcagattcc ttatctggtg acacaccccc atttcctgga 1860

gccatctctc tccttgccag aacctctaag gtttgcttac gatggagcca gagaggatcc 1920

tgggagggag agcttggcag ggggtgggag ggaagggggg gatgcgtgac ctgcccggtt 1980

ctcagtggcc accctgcgct accctctccc agaacctgag ctgctctgac gcggctgtct 2040

ggtgcgtttc actgatcctg gtgctgcagc ttccttacac ttcccaagag gagaagcagt 2100

ttggaaaaac aaaatcagaa taagttggtc ctgagttcta actttggctc ttcacctttc 2160

tagtccccaa tttatattgt tcctccgtgc gtcagtttta cctgtgagat aaggccagta 2220

gccagccccg tcctggcagg gctgtggtga ggaggggggt gtccgtgtgg aaaactccct 2280

ttgtgagaat ggtgcgtcct aggtgttcac caggtcgtgg ccgcctctac tccctttctc 2340

tttctccatc c 2351

Claims

1. ssDNA for use in the construction of mammalian cells stably expressing Brachyury, having the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No. 2.

2. A mammalian cell that stably expresses Brachyury by knocking-in the ssDNA of claim 1 into the AAVS1 locus on the genome of the mammalian cell using a knock-out vector.

3. A method of constructing a mammalian cell that stably expresses Brachyury, comprising the steps of:

s1, obtaining ssDNA of claim 1;

s3, screening the mammalian cells for stable expression of Brachyury.

4. Use of the mammalian cell of claim 2 for the preparation of a quality control product for the diagnosis of chordoma.

5. A quality control product for diagnosing chordoma, which is prepared from the mammalian cell of claim 2.

6. The method for preparing a quality control material according to claim 5, comprising the steps of:

7. A quality control product for diagnosing chordoma, which is prepared from a chordoma tumor sample of a mammal other than human, wherein the tumor is induced by the mammalian cells of claim 2.

8. The method for preparing a quality control material according to claim 7, comprising the steps of:

s1', obtaining the chordoma tumor sample;